Identification and expression of a human cytomegalovirus glycoprotein with homology to the Epstein-Barr virus BXLF2 product, varicella-zoster virus gpIII, and herpes simplex virus type 1 glycoprotein H.

An open reading frame with the characteristics of a glycoprotein-coding sequence was identified by nucleotide sequencing of human cytomegalovirus (HCMV) genomic DNA. The predicted amino acid sequence was homologous with glycoprotein H of herpes simplex virus type 1 and the homologous protein of Epstein-Barr virus (BXLF2 gene product) and varicella-zoster virus (gpIII). Recombinant vaccinia viruses that expressed this gene were constructed. A glycoprotein of approximately 86 kilodaltons was immunoprecipitated from cells infected with the recombinant viruses and from HCMV-infected cells with a monoclonal antibody that efficiently neutralized HCMV infectivity. In HCMV-infected MRC5 cells, this glycoprotein was present on nuclear and cytoplasmic membranes, but in recombinant vaccinia virus-infected cells it accumulated predominantly on the nuclear membrane.     

The pseudorabies virus gII gene is closely related to the gB glycoprotein gene of herpes simplex virus.

We have looked for conserved DNA sequences between four herpes simplex virus type 1 (HSV-1) glycoprotein genes encoding gB, gC, gD, and gE and pseudorabies virus (PRV) DNA, HSV-1 DNA fragments representing these four glycoprotein-coding sequences were hybridized to restriction enzyme fragments of PRV DNA by the Southern blot procedure. Specific hybridization was observed only when HSV-1 gB DNA was used as probe. This region of hybridization was localized to a 5.2-kilobase (kb) region mapping at approximately 0.15 map units on the PRV genome. Northern blot (RNA blot) analysis, with a 1.2-kb probe derived from this segment, revealed a predominant hybridizing RNA species of approximately 3 kb in PRV-infected PK15 cells. DNA sequence analysis of the region corresponding to this RNA revealed a single large open reading frame with significant nucleotide homology with the gB gene of HSV-1 KOS 321. In addition, the beginning of the sequenced PRV region also contained the end of an open reading frame with amino acid homology to HSV-1 ICP 18.5, a protein that may be involved in viral glycoprotein transport. This sequence partially overlaps the PRV gB homolog coding sequence. We have shown that the PRV gene with homology to HSV-1 gB encoded the gII glycoprotein gene by expressing a 765-base-pair segment of the PRV open reading frame in Escherichia coli as a protein fused to beta-galactosidase. Antiserum, raised in rabbits, against this fusion protein immunoprecipitated a specific family of PRV glycoproteins of apparent molecular mass 110, 68, and 55 kilodaltons that have been identified as the gII family of glycoproteins. Analysis of the predicted amino acid sequence indicated that the PRV gII protein shares 50% amino acid homology with the aligned HSV-1 gB protein. All 10 cysteine residues located outside of the signal sequence, as well as 4 of 6 potential N-linked glycosylation sites, were conserved between the two proteins. The primary protein sequence for HSV-1 gB regions known to be involved in the rate of virus entry into the cells and cell-cell fusion, as well as regions known to be associated with monoclonal antibody resistance, were highly homologous with the PRV protein sequence. Furthermore, monospecific antibody made against PRV gII immunoprecipitated HSV-1 gB from infected cells. Taken together, these findings suggest significant conservation of structure and function between the two proteins and may indicate a common evolutionary history.     

DNA sequence of the gene for pseudorabies virus gp50, a glycoprotein without N-linked glycosylation.

The DNA sequence was determined for a region of the pseudorabies virus (PRV) genome to which a mutation defining resistance to a monoclonal antibody has been mapped (M. W. Wathen and L. M. K. Wathen, J. Virol., 51:57-62, 1984). This sequence was found to contain an open reading frame that did not include an amino acid sequence directing N-linked glycosylation. This open reading frame was expressed in uninfected Chinese hamster ovary cells to produce the PRV glycoprotein gp50. When PRV-infected Vero cells were incubated in the presence of tunicamycin, the gp50 that was produced had an identical molecular weight to that produced in the absence of drug. When infected cells were incubated in the presence of monensin, the molecular weight of gp50 was reduced from 60,000 to 45,000, but was not sensitive to endo-beta-N-acetylglucosaminidase H. These observations led to the conclusion that gp50 does not contain N-linked carbohydrate, as predicted from the DNA sequence. A region of the amino acid sequence and the positions of the cysteine residues of PRV gp50 are homologous to glycoprotein D of herpes simplex virus.     

Mapping and sequence of the gene for the pseudorabies virus glycoprotein which accumulates in the medium of infected cells.

RNA from pseudorabies virus (PRV)-infected cells was translated in a reticulocyte lysate with and without the addition of dog pancreas microsomes. Upon addition of the microsomes to the translation reaction, an additional prominent protein product was observed that was not present when microsomes were omitted. The gene coding for this processed protein and its lower-molecular-weight precursor was mapped within the small unique region of the genome by hybridization of mRNA to cloned fragments of PRV DNA and translation of the selected mRNAs. A fragment of the coding region of this gene was inserted into an open reading frame cloning vector to express part of this gene as a hybrid protein in Escherichia coli. This hybrid protein was injected into mice to raise an antiserum which was found to precipitate the glycoprotein which accumulates in the medium of PRV-infected cells. This allows us to conclude that the gene for the "excreted" glycoprotein (gX) maps to the small unique region of the genome, and that the precursor of this glycoprotein is readily processed by dog pancreas microsomes. The region of the PRV genome which codes for this glycoprotein was sequenced and found to include an open reading frame coding for 498 amino acids, flanked by sequences which contain features common to eucaryotic promoters and polyadenylation signals. The predicted protein sequence includes a hydrophobic sequence at the N-terminus which could be a signal sequence, and a hydrophobic sequence followed by a hydrophilic sequence at the C-terminus.     

Identification of the human herpesvirus 6 glycoprotein H and putative large tegument protein genes.

Determination of the nucleotide sequences of two molecular clones of human herpesvirus 6 (HHV-6) (strain GS) and comparison with those of human cytomegalovirus (HCMV) has allowed the identification of the genes for the glycoprotein H (gH) and the putative large tegument protein of HHV-6. Two molecular clones of fragments of HHV-6, the BamHI-G fragment (7,981 bp) of the clone termed pZVB43 and a HindIII fragment (8,717 bp) of the clone termed pZVH14, represent approximately 10% of the HHV-6 genome (16,689). An open reading frame within the BamHI-G fragment was designated the gH gene of HHV-6 because of the extensive sequence similarity of its predicted product (79,549 Da) to the HCMV gH gene product. The predicted product (239,589 Da) of an open reading frame within clone pZVH14 showed homology to the predicted product of the proposed gene of HCMV representing the large tegument protein. Computer analyses indicated a closer relationship of the predicted peptides of these HHV-6 genes to those of HCMV than to those of the other human herpesviruses Epstein-Barr virus, herpes simplex virus type 1, and varicella-zoster virus. The gH gene was more conserved among the human herpesvirus group, while significant sequence similarity of the tegument gene could be found only with that of HCMV. The data reported here with one conserved gene (gH) and a more divergent gene (tegument) support previous reports that HHV-6 and HCMV are more closely related to each other than to the other well-characterized human herpesviruses.     

DNA sequence of the herpes simplex virus type 1 gene encoding glycoprotein gH, and identification of homologues in the genomes of varicella-zoster virus and Epstein-Barr virus.

We have determined the sequence of herpes simplex virus type 1 DNA around the previously mapped location of sequences encoding an epitope of glycoprotein gH, and have deduced the structure of the gH gene and the amino acid sequence of gH. The unprocessed polypeptide is predicted to contain 838 amino acids, and to possess an N-terminal signal sequence and a C-terminal transmembrane sequence. Temperature-sensitive mutant tsQ26 maps within the predicted gH coding sequence. Homologous genes were identified in the genomes of two other herpesviruses, namely varicella-zoster virus and Epstein-Barr virus.     

Sequence and expression of the mouse mammary tumour virus env gene

We have determined the DNA sequence of the envelope gene region of the GR strain of mouse mammary tumour virus. The sequence extends for 3012 nucleotides from the single EcoRI site to beyond the PstI site in the 3' long terminal repeat (LTR) of the provirus. There is a major open reading frame from nucleotides 752 to 2818 which encompasses the entire env gene. This reading frame extends through a polypurine tract and into the LTR. There is another open reading frame from the first nucleotide to position 803, presumably corresponding to the end of the pol gene. The splice acceptor site which generates env mRNA has been mapped experimentally to nucleotide 750. The env gene products, gp52 and gp36, have been positioned on the sequence using the directly determined amino acid sequences of the amino terminus of gp52; and both the amino and carboxyl termini of gp36. The start of gp52 is preceded by a series of 19 uncharged amino acids which could function as a typical signal sequence, but this sequence is only part of a much longer leader peptide. The tetrad Arg-Ala-Lys-Arg is the presumed cleavage site in the gPr73env precursor, and occurs just before the gp36 amino terminus. There are five potential asparagine-linked glycosylation sites which agrees with previous experimental results. The gp36 has two long hydrophobic regions at its amino and carboxy termini, these are suggested to act as a fusion peptide and the trans-membrane anchor, respectively.     

Extracellular vaccinia virus envelope glycoprotein encoded by the A33R gene.

With the aid of three monoclonal antibodies (MAbs), a glycoprotein specifically localized to the outer envelope of vaccinia virus was shown to be encoded by the A33R gene. These MAbs reacted with a glycosylated protein that migrated as 23- to 28-kDa and 55-kDa species under reducing and nonreducing conditions, respectively. The protein recognized by the three MAbs was synthesized by all 11 orthopoxviruses tested: eight strains of vaccinia virus (including modified vaccinia virus Ankara) and one strain each of cowpox, rabbitpox, and ectromelia viruses. The observation that the protein synthesized by ectromelia virus-infected cells reacted with only one of the three MAbs provided a means of mapping the gene encoding the glycoprotein. By transfecting vaccinia virus DNA into cells infected with ectromelia virus and assaying for MAb reactivity, we mapped the glycoprotein to the A33R open reading frame. The amino acid sequence and hydrophilicity plot predicted that the A33R gene product is a type II membrane protein with two asparagine-linked glycosylation sites. Triton X-114 partitioning experiments indicated that the A33R gene product is an integral membrane protein. The ectromelia virus homolog of the vaccinia virus A33R gene was sequenced, revealing 90% predicted amino acid identity. The vaccinia and variola virus homolog sequences predict 94% identical amino acids, the latter having one fewer internal amino acid. Electron microscopy revealed that the A33R gene product is expressed on the surface of extracellular enveloped virions but not on the intracellular mature form of virus. The conservation of this protein and its specific incorporation into viral envelopes suggest that it is important for virus dissemination.     

Cloning and sequence of an infectious bovine rhinotracheitis virus (BHV-1) gene homologous to glycoprotein H of herpes simplex virus.

A homologue to the glycoprotein H (gH) gene of herpes simplex virus (HSV) has been identified in the genome of infectious bovine rhinotracheitis virus (IBR, BHV-1). The gene is located immediately downstream from the thymidine kinase gene, and codes for an open reading frame (orf) of 842 amino acids. The orf has the characteristics of a membrane glycoprotein, including an N-terminal hydrophobic region resembling a signal sequence, a C-terminal region which is probably a transmembrane domain, and six potential sites for N-linked glycosylation. This orf shows significant homology to the gH sequences of both HSV and pseudorabies virus (PRV). We conclude that this gene encodes BHV-1 gH.     

Conservation of gene organization in the lymphotropic herpesviruses herpesvirus Saimiri and Epstein-Barr virus.

By analyses of short DNA sequences, we have deduced the overall arrangement of genes in the (A + T)-rich coding sequences of herpesvirus saimiri (HVS) relative to the arrangements of homologous genes in the (G + C)-rich coding sequences of the Epstein-Barr virus (EBV) genome and the (A + T)-rich sequences of the varicella-zoster virus (VZV) genome. Fragments of HVS DNA from 13 separate sites within the 111 kilobase pairs of the light DNA coding sequences of the genome were subcloned into M13 vectors, and sequences of up to 350 bases were determined from each of these sites. Amino acid sequences predicted for fragments of open reading frames defined by these sequences were compared with a library of the protein sequences of major open reading frames predicted from the complete DNA sequences of VZV and EBV. Of the 13 short amino acid sequences obtained from HVS, only 3 were recognizably homologous to proteins encoded by VZV, but all 13 HVS sequences were unambiguously homologous to gene products encoded by EBV. The HVS reading frames identified by this method included homologs of the major capsid polypeptides, glycoprotein H, the major nonstructural DNA-binding protein, thymidine kinase, and the homolog of the regulatory gene product of the BMLF1 reading frame of EBV. Locally as well as globally, the order and relative orientation of these genes resembled that of their homologs on the EBV genome. Despite the major differences in their nucleotide compositions and in the nature and arrangements of reiterated DNA sequences, the genomes of the lymphotropic herpesviruses HVS and EBV encode closely related proteins, and they share a common organization of these coding sequences which differs from that of the neurotropic herpesviruses, VZV and herpes simplex virus.     

Transcription initiation sites and nucleotide sequence of a herpes simplex virus 1 gene conserved in the Epstein-Barr virus genome and reported to affect the transport of viral glycoproteins

Earlier reports have localized mutations which affect the processing and transport of herpes simplex virus 1 glycoproteins to a region located between the genes specifying glycoprotein B and the major viral DNA-binding protein (beta 8). The nucleotide sequence of this region contains a single long open reading frame encoding a 780-amino-acid protein with a predicted molecular weight of 83,845. To confirm the existence of this protein, rabbit polyclonal antibody was made against a synthetic peptide made according to the predicted sequence of a hydrophilic domain near the carboxy terminal of the protein. This antibody reacted with an infected cell protein of an apparent molecular weight of 95,500. We designated this protein infected cell protein 18.5 (ICP18.5). S1 nuclease analysis suggested that the 5.6-kilobase mRNA encoding ICP18.5 is initiated predominantly from one site, but three weaker initiation sites also seemed to occur within a 74-base-pair stretch of DNA. This gene appears to be conserved in the Epstein-Barr virus (EBV) genome, inasmuch as 174 of the 780 amino acids of ICP18.5 align with corresponding amino acids predicted by the EBV open reading frame BALF3. The EBV gene is located adjacent to the gene specifying a homolog of the herpes simplex virus 1 glycoprotein B.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.     

Conservation of protein coding potential in the long terminal repeats of exogenous and endogenous mouse mammary tumor viruses

In vitro protein synthesis and DNA sequence analysis indicate that mouse mammary tumor virus differs from other well-characterized retroviruses in that the long terminal repeat region of the provirus has the capacity to encode proteins. Different exogenously transmitted mouse mammary tumor virus strains and endogenous proviral units conserved this open reading frame feature in the long terminal repeat despite a variation in nucleotide sequence. The proteins encoded by the different long terminal repeats were clearly related, but showed minor variations in size and tryptic peptide maps. In each case, the largest in vitro product had a molecular weight of about 36,000 to 37,000, suggesting that the open reading frame sequences must extend for approximately 1,000 nucleotides beginning at the extreme 5' end of the long terminal repeat. The fact that the reading frame was conserved among these viruses argues in favor of an in vivo function for the open reading frame protein.     

The glycoprotein products of varicella-zoster virus gene 14 and their defective accumulation in a vaccine strain (Oka).

Many characteristics of the putative protein encoded by varicella-zoster virus (VZV) open reading fram (ORF) 14 indicate that it is a glycoprotein, which has been designated gpV. To identify the protein products of the gene, the coding sequences were placed under the control of the vaccinia virus p7.5 promoter and recombinant vaccinia viruses were constructed. Heterogeneous polypeptides with molecular weights of 95,000 to 105,000 (95K to 105K polypeptides) were expressed in cells infected by a vaccinia virus recombinant (vKIP5) containing ORF 14 from VZV Scott but were not expressed by control vaccinia viruses. These polypeptides were recognized by antibodies present in human sera that contained high levels of anti-VZV antibodies. Conversely, antisera raised in rabbits inoculated with vKIP5 reacted specifically with heterogeneous 95K to 105K polypeptides present in VZV Scott-infected but not uninfected cells; these polypeptides show a patchy plasma membrane fluorescence pattern in VZV Scott-infected cells. These same antisera neutralized VZV strain Scott infectivity in the absence of complement. Endoglycosidase F treatment of isolated gpV polypeptides and tunicamycin treatment of cells infected with the vKIP5 recombinant indicated that the polypeptides were glycosylated. Three sets of data imply that the VZV strain Oka, which has been used to produce a live attenuated virus vaccine, accumulates low levels of gpV polypeptides relative to wild-type strains: (i) blocking of antibodies in human sera with excess VZV Oka-infected cell antigen yielded residual antibodies which were reactive with the 95K to 105K gpV polypeptides expressed in cells infected by VZV strain Scott and by the vKIP5 vaccinia virus recombinant, but not with Oka-infected cell polypeptides; (ii) antisera raised to vKIP5 detected very low levels of reactive polypeptides made in VZV Oka-infected cells and neutralized VZV Oka virus much less efficiently than VZV Scott; and (iii) comparisons of the reactivity of sera from live attenuated virus vaccine vaccinees with sera derived from patients recovering from wild-type infections indicated greatly reduced levels of gpV-specific antibodies in some vaccinees.