Core–shell structured CdTe/CdS@SiO2@CdTe@SiO2 composite fluorescent spheres: Synthesis and application for Cd2+ detection

Core–shell structured quantum dot (QD)–silica fluorescent nanoparticles have attracted a great deal of attention due to the excellent optical properties of QDs and the stability of silica. In this study, core–shell structured CdTe/CdS@SiO₂@CdTe@SiO₂ fluorescent nanospheres were synthesized based on the Stöber method using multistep silica encapsulation. The second silica layer on the CdTe QDs maintained the optical stability of nanospheres and decreased adverse influences on the probe during subsequent processing. Red‐emissive CdTe/CdS QDs (630 nm) were used as a built‐in reference signal and green‐emissive CdTe QDs (550 nm) were used as a responding probe. The fluorescence of CdTe QDs was greatly quenched by added S^2?, owing to a S^2?‐induced change in the CdTe QDs surface state in the shell. Upon addition of Cd²⁺ to the S^2?‐quenched CdTe/CdS@SiO₂@CdTe@SiO₂ system, the responding signal at 550 nm was dramatically restored, whereas the emission at 630 nm remained almost unchanged; this response could be used as a ratiometric ‘off–on’ fluorescent probe for the detection of Cd²⁺. The sensing mechanism was suggested to be: the newly formed CdS‐like cluster with a higher band gap facilitated exciton/hole recombination and effectively enhanced the fluorescence of the CdTe QDs. The proposed probe shows a highly sensitive and selective response to Cd²⁺ and has potential application in the detection of Cd²⁺ in environmental or biological samples.     

A colorimetric and ratiometric fluorescent probe for sulfite based on an intramolecular cleavage mechanism

A colorimetric and ratiometric fluorescent sulfite probe, the levulinate of 4‐hydroxynaphthalimide, was successfully synthesized from 4‐hydroxy‐naphthalimide and levulinic acid. Through sulfite‐mediated intramolecular cleavage, the probe was converted into 4‐hydroxynaphthalimide, which when excited at 450 nm, displayed a large Stokes shift due to the intramolecular charge transfer process. The probe exhibited high selectivity and sensitivity towards sulfite over other typical anionic species (F^–, Cl^–, Br^–, I^–, HPO₄^2–, SO₄^2–, NO₃^–, AcO^–, ClO₄^–, HCO₃^–) in HEPES‐buffered solution (25 mm , pH 7.4, 50% acetonitrile, v/v). Copyright © 2013 John Wiley & Sons, Ltd.     

Green‐light emission through energy transfer from Ce3+ to Tb3+ ions in the Li2SO4–Al2(SO4)3 system

An energy transfer process from Ce³⁺ to Tb³⁺ ions was successfully achieved in a Li₂SO₄–Al₂(SO₄)₃ mixed‐sulphate system. A wet‐chemical synthesis was employed to prepare the Li₂SO₄–Al₂(SO₄)₃ system by doping Ce³⁺ and Tb³⁺ ions individually as well as collectively. The phases were identified using X‐ray diffraction studies. The as‐prepared samples were characterized by FT‐IR and photoluminescence measurements. Green‐light emission was exhibited by Ce³⁺, Tb³⁺ co‐doped Li₂SO₄–Al₂(SO₄)₃ system, thus, indicating its potential as a material for display devices or in the lamp industry.     

Exceptional Visible‐Light‐Driven Cocatalyst‐Free Photocatalytic Activity of g‐C3N4 by Well Designed Nanocomposites with Plasmonic Au and SnO2

In this work, plasmonic Au/SnO₂/g‐C₃N₄ (Au/SO/CN) nanocomposites have been successfully synthesized and applied in the H₂ evolution as photocatalysts, which exhibit superior photocatalytic activities and favorable stability without any cocatalyst under visible‐light irradiation. The amount‐optimized 2Au/6SO/CN nanocomposite capable of producing approximately 770 μmol g^?1 h^?1 H₂ gas under λ > 400 nm light illumination far surpasses the H₂ gas output of SO/CN (130 μmol g^?1), Au/CN (112 μmol g^?1 h^?1), and CN (11 μmol g^?1 h^?1) as a contrast. In addition, the photocatalytic activity of 2Au/6SO/CN maintains unchanged for 5 runs in 5 h. The enhanced photoactivity for H₂ evolution is attributed to the prominently promoted photogenerated charge separation via the excited electron transfer from plasmonic Au (≈520 nm) and CN (470 nm > λ > 400 nm) to SO, as indicated by the surface photovoltage spectra, photoelectrochemical I–V curves, electrochemical impedance spectra, examination of formed hydroxyl radicals, and photocurrent action spectra. Moreover, the Kelvin probe test indicates that the newly aligned conduction band of SO in the fabricated 2Au/6SO/CN is indispensable to assist developing a proper energy platform for the photocatalytic H₂ evolution. This work distinctly provides a feasible strategy to synthesize highly efficient plasmonic‐assisted CN‐based photocatalysts utilized for solar fuel production.     

An OFF–ON–OFF type fluorescent probe based on a naphthalene derivative for Al3+ and F− ions and its biological application

A novel fluorescent probe‐based naphthalene Schiff, 1‐(C2‐glucosyl‐ylimino‐methyl)‐naphthalene‐2‐ol (L) was synthesized by coupling d ‐glucosamine hydrochloride with 2‐hydroxy‐1‐naphthaldehyde. It exhibited excellent selectivity and highly sensitivity for Al³⁺ in ethanol with a strong fluorescence response, while other common metal ions such as Pb²⁺, Mg²⁺, Cu²⁺, Co²⁺, Ni²⁺, Cd²⁺, Fe²⁺, Mn²⁺, Hg²⁺, Li⁺, Na⁺, K⁺, Fe³⁺, Cr³⁺, Zn²⁺, Ag⁺, Ba²⁺ and Ca²⁺ did not cause the same fluorescence response. The probe selectively bound Al³⁺ with a binding constant (K_a) of 5.748 × 10³ M^?1 and a lowest detection limit (LOD) of 4.08 nM. Moreover, the study found that the fluorescence of the L ? Al³⁺ complex could be quenched after addition of F^? in the same medium, while other anions, including Cl^?, Br^?, I^?, NO₂^?, NO₃^?, ClO₄^?, CO₃^2?, HCO₃^?, SO₄^2?, HSO₄^?, CH₃COO^?, PO₄^3?, HPO₄^2?, S^2? and S₂O₃^2? had nearly no influence on probe behaviour. Binding of the [L ? Al³⁺] complex to a F^? anion was established by different fluorescence titration studies, with a detection limit of 3.2 nM in ethanol. The fluorescent probe was also successfully applied in the imaging detection of Al³⁺ and F^? in living cells.     

A highly selective and sensitive turn‐on fluorescent probe for the detection of Al3+ and its bioimaging

A novel fluorescent sensor, 1‐((2‐hydroxynaphthalen‐1‐yl)methylene)urea (ocn) has been designed and applied as a highly selective and sensitive fluorescent probe for recognition of Al³⁺ in Tris–HCl (pH = 7.20) solution. The probe ocn exhibits an excellent selectivity to Al³⁺ over other examined metal ions, anions and amino acids with a prominent fluorescence ‘turn‐on’ at 438 nm. ocn binds to Al³⁺ with a 2:1 binding stoichiometry and the detection limit was 0.3 μM. Furthermore, its capability of biological application was evaluated and the results showed that the sensor could be used to detect Al³⁺ in living cells.     

Redox Dynamics of Arsenic Species in the Root‐Near Environment of Juncus effusus Investigated in a Macro‐Gradient‐Free Rooted Gravel Bed Reactor

In the framework of investigating the dynamics of As species within the planted soil beds of treatment wetlands, the redox dynamics of As species particularly in the root‐near environment of the rhizosphere were investigated. For this purpose, long‐term experiments were carried out using a specially designed macro‐gradient‐free rooted gravel bed reactor, planted with Juncus effusus to treat an artificial wastewater containing As (200 μg As/L). The exceptional quality of the biofilm processes at the helophyte root‐surfaces in treatment wetlands were of special importance in this investigation. The results showed that under C‐deficient conditions, a highly efficient As immobilization (> 85 %), obviously due to adsorption and/or co‐precipitation, was attained. The addition of organic carbon immediately caused an elevated As concentration and enrichment of As(III) (nearly 80 % of total As) in the reactor. Increasing the SO₄^2– concentration in the artificial wastewater inflow facilitated a high As immobilization (> 82 %) under sulfate reducing condition. In principle, a highly efficient microbial dissimilatory sulfate reduction contributed to S^2– formation and a greater As immobilization (most likely as As₂S₃) under C surplus and reducing conditions. Significant differences in As immobilization were observed by varying the inflow of the SO₄^2– concentration (0.2, 5, 10, 25 S/L) under C surplus conditions. More As(III) precipitates (15 % less in the outflow) when the inflow of the SO₄^2– concentration was decreased from 25 mg S/L to 10 mg S/L. Immobilized As showed greater instability by releasing As(V) (up to 85 % of total As) due to changes in the dynamic redox conditions inside the reactor. Re‐oxidation of reduced sulfur into other S species (e.g. S⁰, SO₄^2–) due to plant‐root mediated O₂ release probably caused an oxidative dissolution of already precipitated insoluble As (e.g. As₂S₃) and as a consequent As remobilization. The findings of this study highlighted the significance of SO₄^2– in relation to organic C supply in planted soil beds treating As‐contaminated wastewater under constructed wetland conditions.     

A highly sensitive and selective fluorescent probe for fluoride anions based on intramolecular charge transfer

Currently, there is a great need to develop methods for the selective detection of fluoride anions (F^–) owing to their toxicity in the environment and biological function in living systems. In this study, we developed a new fluorescent probe (probe 1) employing a Si–O bond as a highly selective recognition receptor for detecting F^– via intramolecular charge transfer. Probe 1 could detect F^– quantitatively using the turn‐on fluorescence spectroscopy method with excellent sensitivity in the range of 4–38 μM and a detection limit of 0.26 μM; the detection time was < 17 min. We anticipate that probe 1 would be used widely to monitor F^– in the environment. Copyright © 2015 John Wiley & Sons, Ltd.     

Two new rhodamine‐based fluorescent chemosensors for Fe3+ in aqueous solution

Two new rhodamine‐based fluorescent probes were synthesized and characterized by NMR, high resolution mass spectrometer (HR‐MS) and IR. The probes displayed a high selectivity for Fe³⁺ among environmentally and biologically relevant metal ions in aqueous solution (CH₃OH–H₂O = 3 : 2, v/v). The significant changes in the fluorescence color could be used for naked‐eye detection. Job's plot, IR and ¹H NMR indicated the formation of 1: 1 complexes between sensor 1 and Fe³⁺. The reversibility establishes the potential of both probes as chemosensors for Fe³⁺ detection. The probe showed highly selectivity in aqueous solution and could be used over the pH range between 5 and 9. A simple paper test‐strip system for the rapid monitoring of Fe³⁺ was developed, indicating its convenient use in environmental samples. Copyright © 2014 John Wiley & Sons, Ltd.     

Terbium (III) coordination polymer–copper (II) compound as fluorescent probe for time‐resolved fluorescence ‘turn‐on’ detection of hydrogen sulfide

With recognition of the biological importance of hydrogen sulfide (H₂S), we present a simple and effective fluorescent probe for H₂S using a Tb³⁺ coordination polymer–Cu²⁺ compound (DPA/Tb/G–Cu²⁺). Dipicolinic acid (DPA) and guanosine (G) can coordinate with Tb³⁺ to form a macromolecular coordination polymer (DPA/Tb/G). DPA/Tb/G specifically binds to Cu²⁺ in the presence of coexisting cations, and obvious fluorescence quenching is observed. The quenched fluorescence can be exclusively recovered upon the addition of sulfide, which is measured in the mode of time‐resolved fluorescence. The fluorescence intensities of the DPA/Tb/G–Cu²⁺ compound enhance linearly with increasing sulfide concentrations from 1 to 30 μM. The detection limit for sulfide in aqueous solution is estimated to be 0.3 μM (at 3σ). The DPA/Tb/G–Cu²⁺ compound was successfully applied to sense H₂S in human serum samples and exhibited a satisfactory result. It displays some desirable properties, such as fast detection procedure, high selectivity and excellent sensitivity. This method is very promising to be utilized for practical detection of H₂S in biological and environmental samples.     

Flow‐injection chemiluminescence method for the determination of naphazoline hydrochloride and oxymetazoline hydrochloride

A sensitive and simple flow‐injection chemiluminescence (FI‐CL) method, which was based on the CL intensity generated from the redoxreaction of potassium permanganate (KMnO₄)–formaldehyde in vitriol (H₂SO₄) medium, has been developed, validated and applied for the determination of naphazoline hydrochloride and oxymetazoline hydrochloride. Besides oxidants and sensitizers, the effect of the concentration of H₂SO₄, KMnO₄ and formaldehyde was investigated. Under the optimum conditions, the linear range was 1.0 × 10^?2–7.0 mg/L for naphazoline hydrochloride and 5.0 × 10^?2–10.0 mg/L for oxymetazoline hydrochloride. During seven repeated inter‐day and intra‐day precision tests of 0.1, 1.0 and 10.0 mg/L samples, the relative standard deviations all corresponded to reference values. The detection limit was 8.69 × 10^?3 mg/L for naphazoline hydrochloride and 3.47 × 10^?2 mg/L for oxymetazoline hydrochloride (signal‐to‐noise ratio ≤3). This method has been successfully implemented for the determination of naphazoline hydrochloride and oxymetazoline hydrochloride in pharmaceuticals. Copyright © 2009 John Wiley & Sons, Ltd.     

Controllable Chain‐Length for Covalent Sulfur–Carbon Materials Enabling Stable and High‐Capacity Sodium Storage

Room temperature sodium–sulfur batteries have emerged as promising candidate for application in energy storage. However, the electrodes are usually obtained through infusing elemental sulfur into various carbon sources, and the precipitation of insoluble and irreversible sulfide species on the surface of carbon and sodium readily leads to continuous capacity degradation. Here, a novel strategy is demonstrated to prepare a covalent sulfur–carbon complex (SC‐BDSA) with high covalent‐sulfur concentration (40.1%) that relies on ? SO₃H (Benzenedisulfonic acid, BDSA) and SO₄^2? as the sulfur source rather than elemental sulfur. Most of the sulfur is exists in the form of O? S/C? S bridge‐bonds (short/long‐chain) whose features ensure sufficient interfacial contact and maintain high ionic/electronic conductivities of the sulfur–carbon cathode. Meanwhile, the carbon mesopores resulting from the thermal‐treated salt bath can confine a certain amount of sulfur and localize the diffluent polysulfides. Furthermore, the C? S_x? C bridges can be electrochemically broken at lower potential (<0.6 V vs Na/Na⁺) and then function as a capacity sponsor. And the R‐SO units can anchor the initially generated S_x^2? to form insoluble surface‐bound intermediates. Thus SC‐BDSA exhibits a specific capacity of 696 mAh g^?1 at 2500 mA g^?1 and excellent cycling stability for 1000 cycles with 0.035% capacity decay per cycle.     

A colorimetric fluorescent probe for rapid and specific detection of nitrite

The method of fluorescent probes has been an important technique for detection of nitrite (NO₂^?). As an important inorganic salt, excessive nitrite would threaten humans and the environment. In this paper, a colorimetric fluorescent probe P‐N (1,2‐diaminoanthraquinone) with rapid response and high selectivity, which could detect NO₂^? by visual colour changes and fluorescence spectroscopy is presented. The probe P‐N solution (pH 1) changed from pink to colourless with the addition of NO₂^? and fluorescence intensity at 639 nm clearly decreased. Good linear exists between fluorescence intensities and NO₂^? concentrations for the range 0–16 μM, and the detection limit was 54 nM (based on a 3σ/slope). Moreover, probe P‐N could also detect NO₂^? in real water samples, and results were all satisfactory. Probe P‐N shows great practical application value for detecting NO₂^? in the environment.     

A turn‐on luminescence probe for highly selective detection of an anthrax biomarker

Highly selective detection of Bacillus anthrax spores has attracted worldwide attention because Bacillus anthrax spores not only are harmful to the health of human beings and animals, but also can be used as biological warfare agents. Here, we report a simple platform by mixing EuCl₃·6H₂O and sodium polyacrylate in aqueous solution and further investigate its luminescence response towards Bacillus anthrax biomarker dipicolinic acid (DPA) as a turn‐on luminescence probe. Importantly, our probe has good sensitivity, lower detection limit, excellent selectivity as well as great anti‐interference ability due to the great luminescence enhancement of Eu³⁺. Moreover, a test paper is constructed to realize the purpose of portable detection. These results indicate that our probe is an excellent candidate for sensing DPA.     

Subcellular distribution of 35S-sulfur in spinach leaves after application of 35SO 4 2- , 35SO 3 2- , and 35SO2

³⁵SO₂, ³⁵SO ₃ ^2- , and ³⁵SO ₄ ^2- , respectively, were applied to leaves of Spinacia oleracea L. for 60 min in the light. Thereafter, the specific activity was determined in the organelles separated by means of sucrose density gradient centrifugation. In mitochondria and peroxisomes, the specific activity was equally distributed in their protein moieties. After application of ³⁵SO₂ or ³⁵SO ₃ ^2- , the chloroplast lamellae are characterized by elevated specific activity, which is not found after application of ³⁵SO ₄ ^2- . Chloroplast stroma shows a low specific incorporation rate after application of either compound, which may be due to the low turnover rate of Fraction I protein.     

Chemiluminescence selectivity enhancement in the on‐chip Ru(bpy)32+ system: The potential role of buffer type and pH in the determination of hydrochlorothiazide in combined formulations and human plasma

A simple and highly selective on‐chip Ru(bpy)₃²⁺–oxidant chemiluminescence (CL) approach for estimation of a diuretic drug, hydrochlorothiazide (HCZ), in biological fluids was realized in the presence of other fixed‐dose combination drugs by manipulating simultaneously the method of active species (Ru(bpy)₃³⁺) production and type of carrier buffer with pH used for the CL reaction. Chemical oxidation processes involved in the Ru(bpy)₃²⁺–Ce(IV) CL system have been successfully miniaturised in this study using a microfabricated device to generate Ru(bpy)₃³⁺ instantaneously. The proposed system was then screened using HCZ and other drugs in the presence of various buffers and pH to explore the difference in CL emission. Ammonium formate buffer (0.15 M) at pH 4.5 exhibited excellent selectivity towards HCZ when Ru(bpy)₃³⁺ was produced by chemical oxidation using Ce(IV). The newly developed conditions do not involve any kind of prior separation or isolation procedure to remove other combination therapy drugs in formulation and biological samples. The method under fully optimised conditions exhibited wide linearity over the concentration range 0.5–1000 ng ml^?1 and low detection and quantification limits of 0.13 and 0.47 ng ml^?1 respectively for HCZ. Acceptable levels of recoveries were obtained for HCZ from human plasma using the proposed method (98.9–100.8%) in the presence of other antihypertensive combination therapy drugs. This study postulates that such miniaturised devices may find applications especially for on‐site analysis, such as doping control examinations.     

Catalytic solid substrate-room-temperature phosphorimetry detection for trace cadmium with Cd(2+) -3.5-generation polyamidoamine dendrimer-Tween-80 complex

3.5‐Generation polyamidoamine dendrimers (3.5‐G‐D) emitted strong and stable room‐temperature phosphorescence (RTP) on filter paper when Pb²⁺ was used as a heavy atom perturber. The RTP signal of 3.5‐G‐D was sharply enhanced upon the formation of 3.5‐G‐D–Tween‐80 micelle compound. The complex Cd²⁺–3.5‐G‐D–Tween‐80, generated in the coordination reaction between Cd²⁺ and the tertiary amidocyanogen on the outer layer of 3.5‐G‐D in 3.5‐G‐D–Tween‐80 micelle compound, could catalyze KBrO₃ to oxidize 3.5‐G‐D in 3.5‐G‐D–Tween‐80, which caused the sharp quenching of the RTP signal of the system. The phosphorescence intensity change (ΔI_p) of the system had a linear relationship with the content of Cd²⁺. Thus a new catalytic solid substrate–room‐temperature phosphorimetry (SS‐RTP) for the determination of trace cadmium has been established. This highly selective and sensitive method has been applied to determine trace cadmium in biological samples with a limit of detection (LD) of 1.2 ag per spot (when the sample volume was 0.4 μL per spot, the corresponding concentration was 3.0 × 10^?15 g mL^?1), the results agreeing with those obtained by atomic absorption spectrometry. The mechanism of catalytic SS‐RTP for the determination of trace cadmium was also discussed. Copyright © 2011 John Wiley & Sons, Ltd.     

Oxidation and reduction of sulfite contribute to susceptibility and detoxification of SO2 in Populus × canescens leaves

Key Message

The critical level for SO ₂ susceptibility of Populus × canescens is approximately 1.2 μL L ^?1 SO ₂ . Both sulfite oxidation and sulfite reduction and assimilation contribute to SO ₂ detoxification.

Abstract

In the present study, uptake, susceptibility and metabolism of SO₂ were analyzed in the deciduous tree species poplar (Populus × canescens). A particular focus was on the significance of sulfite oxidase (SO) for sulfite detoxification, as SO has been characterized as a safety valve for SO₂ detoxification in herbaceous plants. For this purpose, poplar plants were exposed to different levels of SO₂ (0.65, 0.8, 1.0, 1.2 μL L^?1) and were characterized by visible injuries and at the physiological level. Gas exchange parameters (stomatal conductance for water vapor, CO₂ assimilation, SO₂ uptake) of the shoots were compared with metabolite levels (sulfate, thiols) and enzyme activities [SO, adenosine 5′-phosphosulfate reductase (APR)] in expanding leaves (80–90 % expanded). The critical dosage of SO₂ that confers injury to the leaves was 1.2 μL L^?1 SO₂. The observed increase in sulfur containing compounds (sulfate and thiols) in the expanding leaves strongly correlated with total SO₂ uptake of the plant shoot, whereas SO₂ uptake rate was strongly correlated with stomatal conductance for water vapor. Furthermore, exposure to high concentration of SO₂ revealed channeling of sulfite through assimilatory sulfate reduction that contributes in addition to SO-mediated sulfite oxidation to sulfite detoxification in expanding leaves of this woody plant species.     

Binding of Leishmania spp with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor

The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH₂]₆ ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10^?6 to 10^?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.     

Eco-friendly nonconjugated polymer dots for chemiluminometric determination of 4-nitrophenol

Polymer dots (PDs) are a new family of quantum dots for which their behavior and potential applications have not yet been completely explored. In this study, nonconjugated PDs were synthesized using a simple pyrolysis method and used for the chemiluminescence (CL) assay of 4-nitrophenol (4-NP). PDs increased the CL signal of the Ce(IV)–Na₂SO₃ reaction 39-fold. Using the CL spectrum, it was concluded that the emission at 434 nm was generated by excited PDs (PDs*), which are produced by energy transfer from SO₂* to PDs. Our experiments showed that 4-NP enhanced the CL signal of the Ce(IV)–Na₂SO₃–PDs reaction. The mechanism of this effect was explored by obtaining CL, ultraviolet–visible, and Fourier transform infrared spectra. Due to the high sensitivity and selectivity of the CL system for 4-NP, a probe was designed to determine 4-NP in the linear range 1.0–500 nmol/L with a detection limit of 0.33 nmol/L. Different spiked real samples were successfully analyzed using this probe.