Ligand binding sites for a synthetic B cell growth and differentiation factor

The mechanism of action of a group of synthetic lymphokine-like molecules, the C8-substituted guanine ribonucleosides, was studied. Among their pleiotropic effects on B cells are the increased expression of surface Ia antigens, induction of polyclonal immunoglobulin secretion, enhancement of thymus-dependent as well as thymus-independent antibody responses, and transmission of T cell-like differentiative signals to B cells. However, relatively little is known about their molecular mechanism of action. In the current article, the interaction of 8-bromo-guanosine (8BrGuo), a prototypical C8-substituted guanine ribonucleoside, with cellular components was examined. Rapidly exchangeable (free) and slowly exchangeable (bound) 8BrGuo pools exist within B cells. The bound nucleoside pool loses its ability to be retained by a boronate affinity resin (despite its resistance to metabolic processing) and localizes to the cytosol on sucrose density gradients. Binding affinity, ligand specificity, and cellular specificity of binding all correlate closely with observed functional properties of these molecules. Together, these data suggest that the binding interaction mediates the biologic activities of 8BrGuo, and that the binding site acts as a functional nucleoside receptor.     

B lymphocytes from hyporesponsive SJL mice contain aberrant nucleoside binding sites

C8-substituted guanine ribonucleosides activate B cells by a novel pathway that apparently is independent of GTP-binding proteins and protein kinase C. B lymphocytes from SJL mice are hyporesponsive to antigen-independent inductive signals transmitted by these nucleosides. In the current studies, the basis for this observation was explored. Responses of normal murine strains to these agents have been dissociated into antigen-independent (inductive) and antigen-dependent (differentiative) types by use of the 7,8-disubstituted guanine ribonucleosides. Dose-response profiles for inductive responses appear to correlate with apparent Kd values for low-affinity nucleoside binding sites; dose-response curves for antigen-dependent differentiative responses correlate with apparent Kd values for high-affinity binding sites. It was found that the SJL low-affinity site exhibits an apparent Kd that is approximately 10- to 20-fold lower in affinity for 8BrGuo than that of normal CBA mice. Although the low-affinity site in normal murine strains displays nearly equivalent affinity toward C8-substituted and 7,8-disubstituted nucleosides, the low-affinity site of SJL mice binds 7,8-disubstituted compounds with approximately 5-fold higher affinity than it does monosubstituted compounds. The dissociation constant for high-affinity nucleoside binding sites of SJL mice was only slightly different from that of CBA mice, consistent with the observation of essentially normal antigen-dependent nucleoside-mediated activity in SJL mice. The current observations support (a) a role for low-affinity binding sites in antigen-independent inductive events, (b) a role for high-affinity binding sites in antigen-dependent differentiative events mediated by substituted guanine nucleosides, and (c) the existence of aberrant low-affinity binding sites in B cells from SJL mice.     

T cell-replacing activity of C8-derivatized guanine ribonucleosides

The capacity of the C8-substituted guanine ribonucleosides to provide T cell-like signals to cultures of splenic B cells was evaluated. We showed previously that these low m.w. nucleoside derivatives traverse the cell membrane and induce their effects from an intracellular location. The current studies clearly demonstrate that 8 mercaptoguanosine (8MGuo), when added to cultures of B cells and macrophages in the presence of antigen, is capable of supplying a "second signal" for B cells, enabling them to generate high numbers of specific plaque-forming cells against the immunizing antigen. This effect is duplicated in cultures of spleen cells from congenitally athymic mice. Inhibition of interleukin 2 (IL 2) generation by cyclosporin A, such that the antibody response of normal spleen cells is entirely abrogated, has minimal effects on the T cell-replacing activity of 8MGuo. Additivity studies with MLC supernatants as well as kinetic analyses with IL 2-associated lymphokines substantiate that these factors act by a mechanism distinct from that of 8MGuo and 8BrGuo. These observations establish these nucleoside activators as exciting new probes for T helper cell activity and an effective non-T cell source of T cell-like signals.     

Activation of lymphocytes by a thiol-derivatized nucleoside: characterization of cellular parameters and responsive subpopulations

Lymphocyte activation, whether specific or nonspecific, is generally conceptualized as initiated by the binding of an activating ligand to a surface membrane receptor, followed by transduction of the signal across the cell membrane. In many situations several qualitatively distinct signals are required. We have recently described a new class of lymphocyte activator, the C8 bromine substituted guanine ribonucleosides, that traverse the cell membrane, bypassing classical triggering mechanism(s), apparently activating the lymphocyte at an intracellular site. However, the identity of the lymphocyte population(s) activated, as well as the nature of any cellular interactions involved in activation, has not been studied heretofore. The present experiments describe the cellular parameters of lymphocyte activation by a thiol substituted member of this class of activators, 8-mercaptoguanosine (8MGuo). Upon addition of this nucleoside derivative to cultures of murine spleen cells, a marked increase in [3H]TdR uptake and blast transformation ensues. Normal splenic B cells and spleen cells from congenitally athymic (nu/nu) mice are responsive to 8MGuo, whereas thymocytes and splenic T cells are not. Two subpopulations of B cells appear to be involved in the response to this nucleoside. The predominant one is a mature population that bears surface delta-chains, la antigens, C receptors, and (by indirect evidence) the Lyb3, 5, and 7 antigens. These cells also bear mu-chain and Fc receptors. In addition, a second, minor subpopulation of less mature cells that bear only mu-chain and Fc receptors also appears to be reactive to 8MGuo. The existence of this immature, reactive B cell subset was confirmed by observation of 8MGuo responsiveness in lymphocytes from 4-day-old mice whose cells do not yet exhibit these later-appearing markers. Accessory cells appear to play a minimal, if any, role in the 8MGuo response. These results establish two distinct B cell subpopulations as the major and minor cellular targets of C8-derivatized nucleosides, and suggest that the activation process results from a direct interaction between the nucleoside and target cell.     

8-Hydroxyguanosine and 8-methoxyguanosine possess immunostimulating activity for B lymphocytes

The present paper extends previous observations of Goodman and Weigle (M.G. Goodman and W.O. Weigle, J. Immunol. 128, 2399, 1982) and describes the activation of B lymphocytes by a number of C-8-substituted guanine ribonucleosides. 8-Hydroxyguanosine stimulates both proliferation and differentiation of murine B cells while 8-methoxyguanosine stimulates only differentiation and 8-aminoguanosine has no discernible effect on B-cell activation. The former two compounds also increase the magnitude of the antibody response to the type 2 antigen trinitrophenyl-AECM-Ficoll. These data demonstrate that guanosine, which is itself inhibitory to murine B cells, is converted into an immunostimulatory molecule after substitution at its C-8 position with methoxy or hydroxy groups and the bromo or mercapto group not essential for conferring biological activity to this nucleoside. However, our data also suggest that substitution of different groups at the C-8 position does influence the biological activity of this molecule.     

Purine and pyrimidine transport by cultured Novikoff cells. Specificities and mechanism of transport and relationship to phosphoribosylation.

Adenine, guanine, and hypoxanthine were rapidly incorporated into the acid-soluble nucleotide pool and nucleic acids by wild type Novikoff cells. Incorporation followed normal Michaelis-Menten kinetics, but the following evidence indicates that specific transport processes precede the phosphoribosyltransferase reactions and are the rate-limiting step in purine incorporation by whole cells. Cells of an azaguanine-resistant subline of Novikoff cells which lacked hypoxanthine-guanine phosphoribosyltransferase activity and failed to incorporate guanine or hypoxanthine into the nucleotide pool, exhibited uptake of guanine and hypoxanthine by a saturable process. Similarly, wild type cells which had been preincubated in a glucose-free basal medium containing KCN and iodoacetate transported guanine and hypoxanthine normally, although a conversion of these purines to nucleotides did not occur in these cells. The mutant and KCN-iodoacetate treated wild type cells also exhibited countertransport of guanine and hypoxanthine when preloaded with various purines, uracil, and pyrimidine nucleosides. The cells also possess a saturable transport system for uracil although they lack phosphoribosyltransferase activity for uracil. In the absence of phosphoribosylation, none of the substrates was accumulated against a concentration gradient. Thus transport is by facilitated diffusion (nonconcentrative transport). Furthermore, the apparent Km values for purine uptake by untreated wild type and azaguanine-resistant cells were higher and the apparent Vmax values were lower than those for the corresponding phosphoribosyltransferases...     

Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine

B lymphocytes require a source of T cell-like help to produce antibody to T cell-dependent antigens. T cell-derived lymphokines and C8-substituted guanine ribonucleosides (such as 8-mercaptoguanosine; 8MGuo) are effective sources of such T cell-like help. Addition of T cell-derived lymphokines to antigen-activated B cells together with 8MGuo results in synergistic B cell differentiation, amplifying the sum of the individual responses twofold to four-fold. Lymphokine activity is required at initiation of culture for optimal synergy with 8MGuo, whereas the nucleoside can be added up to 48 hr after the lymphokines with full synergy. 8MGuo provides a perceived T cell-like differentiation signal to B cells from immunodeficient xid mice, thereby distinguishing a subset of Lyb-5- nucleoside-responsive B cells from those activated by soluble anti-mu followed by B cell stimulatory factor-1, interleukin 1, and B cell differentiation factors, which are Lyb-5+. Moreover, at least a subset of the B cells recruited by the synergistic interaction of lymphokines and nucleoside is distinct from that responsive to 8MGuo + antigen, insofar as Sephadex G-10 nonadherent xid B cells fail to respond to either 8MGuo or lymphokines alone, but do respond to the combination. A distinct subpopulation can also be demonstrated among normal B cells by limiting dilution analysis in which the precursor frequency of antigen-reactive B cells in the presence of lymphokines or nucleoside alone increases substantially when both agents are present together. In concert with the kinetic data, these observations suggest that synergy derives at least in part from the ability of lymphokines to induce one or more elements the absence of which limits the capacity of a distinct B cell subpopulation to respond to 8MGuo.     

Dissociation of inductive from differentiative signals transmitted by C8-substituted guanine ribonucleosides to B cells from SJL mice

A hitherto unknown defect in the immune responsiveness of B lymphocytes from SJL mice has enabled us to distinguish two qualitatively distinct classes of signal delivered to B cells by C8-substituted guanine ribonucleosides. This defect renders B cells from SJL mice unresponsive to the inductive (early acting) signal of 8-mercaptoguanosine (8MGuo) that culminates in mitogenesis and nonspecific secretion of immunoglobulin. Unresponsiveness is not attributable to a shift in either the dose-response or kinetic profiles, nor can the presence of suppressor cells be demonstrated. In striking contrast, however, SJL B cells exhibit normal responsiveness to the differentiative (T cell-like, or late acting) signal provided by the substituted nucleoside. This signal enables SJL B cells, depleted of T cells, to respond to T cell-dependent antigens, and synergizes with T cell-derived lymphokines. These data suggest 1) that nonspecific secretion of immunoglobulin is dependent on both inductive and differentiative signals, 2) that antigen alone can supply an effective inductive signal for antigen-specific responses, and 3) that the SJL mouse will provide a useful model for selective study of inductive vs differentiative events.     

Binding of 125I-labeled granulocyte colony-stimulating factor to normal murine hemopoietic cells

The binding of granulocyte colony-stimulating factor (G-CSF) to murine bone marrow cells was investigated using a radioiodinated derivative of high specific radioactivity which retained full biological activity. The binding was time- and temperature-dependent, saturable and highly specific. The apparent dissociation constant for the reaction was 60-80 pM at 37 degrees C and 90-110 pM at 4 degrees C, similar to that found for the binding of G-CSF to murine leukemic cells (WEHI-3B D+) and significantly higher than the concentration of G-CSF required to stimulate colony formation in vitro. Autoradiographic analysis confirmed the specificity of binding since granulocytic cells were labeled but lymphocytes, erythroid cells and eosinophils were not. Blast cells and monocytic cells were partially labeled, the latter at low levels. In the neutrophilic granulocyte series, grain counts increased with cell maturity, polymorphs being the most heavily labeled but all cells showed considerable heterogeneity in the degree of labeling. Combination of Scatchard analysis of binding with autoradiographic data indicated that mature granulocytes from murine bone marrow exhibited 50-500 G-CSF receptors per cell.     

Characterization of murine lymphocyte IgE receptors by flow microfluorometry

A flow microfluorometric technique has been developed to analyze IgE receptors on splenic and mesenteric lymph node mononuclear cells from BALB/c mice. Our data show that 1) the binding of DIBADL cross-linked IgE dimers to IgE receptors is specific in that it is inhibited by monomeric rat and mouse IgE but not by mouse or rabbit IgG or by the monoclonal anti-Fc gamma R antibody 2.4G2, and conversely, the binding of DIBADL cross-linked IgG dimers is inhibited by monomeric IgG or 2.4G2 but not by rat or mouse IgE; 2) the binding of IgE dimers is saturable on cells from uninfected and Nippostrongylus brasiliensis (Nb)-infected mice; 3) IgE dimer binding is detectable on most splenic B lymphocytes from uninfected and Nb-infected mice, but not on T lymphocytes from uninfected mice, and on few, if any, T lymphocytes from Nb-infected mice; 4) Nb infection causes a parallel increase in the percentages of B lymphocytes and cells expressing IgE receptors and Fc gamma R; 5) Nb infection leads to a marked increase in B lymphocyte IgE receptor expression, has little if any effect on IgE receptor affinity, and causes only minor changes in Fc gamma R expression; and 6) in vivo activation of B lymphocytes by a goat antibody to mouse IgD decreases IgE receptor expression considerably, but has a minimal effect on Fc gamma R expression. Thus, there are separate receptors for IgE and IgG on murine B lymphocytes, and the effect of Nb infection or anti-IgD treatment on their expression is different.     

Two distinct populations of ARF bound to Golgi membranes

ADP-ribosylation factor (ARF) is a small molecular weight GTP-binding protein (20 kD) and has been implicated in vesicular protein transport. The guanine nucleotide, bound to ARF protein is believed to modulate the activity of ARF but the mechanism of action remains elusive. We have previously reported that ARF binds to Golgi membranes after Brefeldin A-sensitive nucleotide exchange of ARF-bound GDP for GTP gamma S. Here we report that treatment with phosphatidylcholine liposomes effectively removed 40-60% of ARF bound to Golgi membranes with nonhydrolyzable GTP, presumably by competing for binding of activated ARF to lipid bilayers. This revealed the presence of two different pools of ARF on Golgi membranes. Whereas total ARF binding did not appear to be saturable, the liposome-resistant pool is saturable suggesting that this pool of ARF is stabilized by interaction with a Golgi membrane-component. We propose that activation of ARF by a guanine nucleotide-exchange protein results in association of myristoylated ARF GTP with the lipid bilayer of the Golgi apparatus. Once associated with the membrane, activated ARF can diffuse freely to associate stably with a target protein or possibly can be inactivated by a GTPase activating protein (GAP) activity.     

Nucleoside transport in cultured LLC-PK1 epithelia.

The transport of nucleosides by LLC-PK1 cells, a continuous epithelial cell line derived from pig kidney, was characterised. Uridine influx was saturable (apparent Km approximately 34 microM at 22 degrees C) and inhibited by greater than 95% by nitrobenzylthioinosine (NBMPR), dilazep and a variety of purine and pyrimidine nucleosides. In contrast to other cultured animal cells, the NBMPR-sensitive nucleoside transporter in LLC-PK1 cells exhibited both a high affinity for cytidine (apparent Ki approximately 65 microM for influx) and differential 'mobility' of the carrier (the kinetic parameters of equilibrium exchange of formycin B are greater than those for formycin B influx). An additional minor component of sodium-dependent uridine influx in LLC-PK1 cells became detectable when the NBMPR-sensitive nucleoside transporter was blocked by the presence of 10 microM NBMPR. This active transport system was inhibited by adenosine, inosine and guanosine but thymidine and cytidine were without effect, inhibition properties identical to the N1 sodium-dependent nucleoside carrier in bovine renal outer cortical brush-border membrane vesicles (Williams and Jarvis (1991) Biochem. J. 274, 27-33). Late proximal tubule brush-border membrane vesicles of porcine kidney were shown to have a much reduced Na(+)-dependent uridine uptake activity compared to early proximal tubule porcine brush-border membrane vesicles. These results, together with the recent suggestion of the late proximal tubular origin of LLC-PK1 cells, suggest that in vivo nucleoside transport across the late proximal tubule cell may proceed mainly via a facilitated-diffusion process.     

Studies of cGMP analog specificity and function of the two intrasubunit binding sites of cGMP-dependent protein kinase

The specificity of the two intrasubunit cGMP binding sites of cGMP-dependent protein kinase was determined by measuring the ability of 46 cGMP analogs to compete with [3H]cGMP. Both sites of the enzyme exhibited high specificity for the ribose cyclic phosphate moiety, and lower specificity for the guanine moiety. Effects of modifications in the ribose cyclic phosphate moiety suggested that cGMP is bound at both sites by three hydrogen bonds at 2'-OH, 3'-O, and 5'-O. A negative charge in the cyclic phosphate is apparently required. Modifications of the pyrimidine part of guanine, particularly at C-1, generally caused selectivity for the rapidly exchanging site while modifications of the imidazole part of guanine at C-7 and C-8 caused selectivity for the slowly exchanging site. These increases in selectivity for a site were mainly due to losses in affinity of the other site. There was an apparent requirement of the intact amino group at C-2, particularly for the slowly exchanging site. Comparison of the molecular interactions of cAMP and cGMP with their specific protein kinases showed that both nucleotides are bound by similar forces in the 2', 3' and 5' region, both bases may be bound in syn conformation, but that each base moiety is bound by different molecular interaction, thus leading to the selectivity of the two enzymes. cGMP analogs which possessed strong selectivity for the rapidly exchanging site, but not those selective for the slowly exchanging site, stimulated the binding of [3H]cGMP. Only a few cGMP analogs were more potent than cGMP in stimulating protein kinase activity. The potency of cGMP analogs as stimulators of kinase activity correlated better with the mean binding affinity for both binding sites than with the affinity for either site alone. Two analogs added in combination were synergistic in kinase activation, particularly if one analog was selective for the slowly exchanging site and the other for the rapidly exchanging site. These observations are suggestive that cGMP binding at the rapidly exchanging site stimulates cGMP binding at the slowly exchanging site and that both sites are involved in the activation process.     

Purine Nucleoside and Nucleobase Cell Membrane Transport in Giardia lamblia

ABSTRACT. Giardia lamblia is dependent on the salvage of preformed purines and pyrimidines. This study investigated purine nucleoside and nucleobase transport utilizing rapid uptake determinations. Nucleoside substrate/velocity curves exhibited the hyperbolic kinetics of a saturable carrier-mediated system. Deoxynucleosides exhibited a much lower affinity for the transporter. Inhibition studies confirmed the relative camer affinities of these ribonucleosides and deoxyribonucleosides. The nucleobase adenine did not exhibit saturation lunetics at a comparable substrate range, and did not inhibit nucleoside transport. Dipyridamole markedly inhibited nucleoside but not nucleobase transport, confirming the separate entry pathways. When cells were depleted of ATP, the velocity of nucleoside and nucleobase transport was unchanged, indicating that it is a non-energy-dependent process. Three nucleoside analogs, formycin A, adenine arabinoside and 7–deazaadenosine, were studied. Transport kinetics ranged widely among this group and could not completely account for their cytotoxic effect. When the apparent Km and Vmax of the nucleosides were compared, an approximately linear relationship (r²= 0.95) was noted. This suggests that a high affinity of the nucleoside permease for the substrate retards disassociation of the substrate-carrier complex, slowing net influx.     

Catabolic pathways of purine ribonucleotides and deoxyribonucleotides in lymphocytes

Deficiency of either one of the subsequent purine catabolic enzymes adenosine deaminase or purine nucleoside phosphorylase results in immunodeficiency disease in humans. However, the mechanism by which impairment of purine metabolism may cause immunodeficiency is unclear. In the present work we have studied the catabolism of purine ribonucleotides and deoxyribonucleotides in T lymphocytes to better understand the role of purine nucleoside phosphorylase and adenosine deaminase in the immune function. It was found that purine deoxyribonucleotides are degraded via catabolic pathways distinctly different from those used for purine ribonucleotide degradation. Thus both adenine and guanine ribonucleotides are deaminated to IMP whereas purine deoxyribonucleotides are exclusively dephosphorylated to the corresponding deoxyribonucleosides. These findings may explain the relatively higher degradation rates of purine deoxyribonucleotides in mammalian cells as compared to purine ribonucleotides. The catabolism of purine nucleotides is tightly linked to the active purine nucleoside cycles which consist of the phosphorolysis of purine nucleosides and deoxyribonucleosides to their corresponding bases, their salvage to monophosphates and back to the corresponding ribonucleosides. The above observations also imply that a possible role of the purine nucleoside cycles is to convert purine deoxyribonucleotides into their corresponding ribonucleotide derivatives. Deficiencies of purine nucleoside phosphorylase or of adenosine deaminase activities, enzymes which participate or lead to the purine nucleoside cycles, thus result in a selective impaired deoxyribonucleotide catabolism and immunodeficiency.     

Quiescent lymphocytes express intracellular transferrin receptors

Both quiescent and concanavalin A stimulated murine splenic lymphocytes were examined for the expression of surface and intracellular binding sites for the serum glycoprotein transferrin. Transferrin binding activity was observed on the surface of mitogen stimulated cells only. When soluble detergent extracts of both populations were studied, quiescent lymphocytes were shown to contain a significant pool of non-surface exposed, intracellular receptors which was approximately 20% of the total receptor complement of proliferating cells. Because the ratio of surface to intracellular binding sites was dramatically increased following mitogen stimulation, the regulation of transferrin receptor expression during this process may involve a substantial alteration in its subcellular distribution in addition to the well documented increase in number of binding sites.     

Purification of tubulin from bovine brain and its interaction with guanine nucleotides.

A rapid and sensitive assay for [3H]GTP binding activity of tubulin has been developed. This assay method is based on the quantitative retention of [3H]GTP. Tubulin complex on a nitrocellulose membrane filter. It was also found that bovine brain tubulin is markedly stablized by glycerol and GTP against denaturation. A large-scale purification of bovine brain tubulin was achieved using the new assay procedure and by the inclusion of glycerol and GTP in a buffer solution used for column chromatograph. The purified tubulin could be stored at -80degrees in the presence of glycerol and GTP for at least a year without any apprecialbe loss of [3H]GTP- and [3H]colchicine binding activities. The interaction of tubulin with guanine nucleotides was also studied using the nitorcellulose membrane filter procedure. It was found that the binding of [3H]GTP to tubulin with an empty exchangeable site proceeded promptly within k sec while the exchange of [3H]GTP- with a GTP-tubulin complex in which the exchangeable site had been occupied with unlabeled GTP occured more slowly. The dissociation constants for GTP and GDP at the exchangeable site of tubulin were determined as 0.5 times 10-6M and 1.9 times 10-6M, respectively. 5'-Guanylylimidodiphosphate could interact, although less strongly, with tubulin at this site, whereas the interaction of other nucleoside triphosphates includint ATP, CTP, UTP, and 5'-guanylyl methylenediphosphonate was very weak, if it occured at all. The presence of Mg2+ and a free sulfhydryl group was found to be essential for binding of [3H]GTP to tubulin. Ca2+ was found to replace Mg2+ in this binding reaction.     

Structure-activity relationship of phosmidosine: importance of the 7,8-dihydro-8-oxoadenosine residue for antitumor activity

To study the structure-activity relationship of phosmidosine, a variety of phosmidosine derivatives 9a-g were synthesized by condensation of N-diisopropyl N'-(N-tritylprolyl)phosphorodiamidite 6 with appropriately protected nucleoside derivatives 7a-g. As the result, replacement of the 7,8-dihydro-8-oxoadenine base by adenine and 6-N-acetyladenine did not affect the antitumor activity. However, phosmidosine derivatives containing uracil, cytosine, and guanine in place of the 7,8-dihydro-8-oxoadenine base did not show significant activity. A plausible explanation for the selective expression of phosmidosine compared with that of phosmidosine analogs having other amino acids in place of proline is also discussed. These results suggest that phosmidosine serves as an inhibitor of prolyl adenosine 5'-phosphate (prolyl-AMP) to inhibit the peptide synthesis in cancer-related cells.     

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.