Physical mapping of repetitive extragenic palindromic sequences in Escherichia coli and phylogenetic distribution among Escherichia coli strains and other enteric bacteria.

Repetitive extragenic palindromic (REP) sequences are highly conserved inverted repeat sequences originally discovered in Escherichia coli and Salmonella typhimurium. We have physically mapped these sequences in the E. coli genome by using Southern hybridization of an ordered phage bank of E. coli (Y. Kohara, K. Akiyama, and K. Isono, Cell 50:495-508, 1987) with generic REP probes derived from the REP consensus sequence. The set of REP probe-hybridizing clones was correlated with a set of clones expected to contain REP sequences on the basis of computer searches. We also show that a generic REP probe can be used in Southern hybridization to analyze genomic DNA digested with restriction enzymes to determine genetic relatedness among natural isolates of E. coli. A search for these sequences in other members of the family Enterobacteriaceae shows a consistent correlation between both the number of occurrences and the hybridization strength and genealogical relationship.     

Repetitive extragenic palindromic (REP) sequences in the Escherichia coli gdhA gene

Deletions of the 3' flanking DNA region of the glutamate dehydrogenase (GDH) structural gene from Escherichia coli K-12, have been produced on a plasmid that carries the complete gdhA gene. Those deletions include part of the repetitive extragenic palindromic (REP) sequences proposed by Stern et al. [Cell 37 (1984) 1015-1026], as a novel and major feature of the bacterial genome. The effect of these deletions on the final GDH level in the cell, has been determined. A broader compilation, analysis and alternative functions of the REP sequences, is also presented.     

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.     

Integration host factor binds to a unique class of complex repetitive extragenic DNA sequences in Escherichia coli

Interspersed repeated DNA sequences are characteristic features of both prokaryotic and eukaryotic genomes. REP sequences are defined as conserved repetitive extragenic palindromic sequences and are found in Escherichia coli, Salmonella typhimurium and other closely related enteric bacteria. These REP sequences may participate in the folding of the bacterial chromosome. In this work we describe a unique class of 28 conserved complex REP clusters, about 100bp long, in which two inverted REPs are separated by a singular integration host factor (IHF) recognition sequence. We term these sequences RIP (for repetitive IHF-binding palindromic) elements and demonstrate that IHF binds to them specifically. It is estimated that there are about 70 RIP elements in E. coli. Our analysis shows that the RIP elements are evenly distributed around the bacterial chromosome. The possible function of the RIP element is discussed.     

ERIC sequences: a novel family of repetitive elements in the genomes of Escherichia coli, Salmonella typhimurium and other enterobacteria

We describe a family of highly conserved, Enterobacterial Repetitive Intergenic Consensus (ERIC) sequences, 14 of which have been identified in Escherichia coli and Salmonella typhimurium and a further three in other enterobacterial species (Yersinia pseudotuberculosis, Klebsiella pneumoniae and Vibrio cholerae). ERIC sequences are 126 bp long and appear to be restricted to transcribed regions of the genome, either in intergenic regions of polycistronic operons or in untranslated regions upstream or downstream of open reading frames. ERIC sequences are highly conserved at the nucleotide sequence level but their chromosomal locations differ between species. Several features of ERIC sequences resemble those of REP sequences (Stern et al., 1984) although the nucleotide sequence is entirely different. The question of whether ERICs have a specific function, or represent a form of 'selfish' DNA, is discussed.     

Deletion of a repetitive extragenic palindromic (REP) sequence downstream from the structural gene of Escherichia coli glutamate dehydrogenase affects the stability of its mRNA

A deletion that removes one repetitive extragenic palindromic sequence downstream of the structural gene of Escherichia coli glutamate dehydrogenase, reduces twofold the half-life of gdhA mRNA.     

Notes The ribonucleoside diphosphate reductase gene (nrdA) of Escherichia coli carries a repetitive extragenic palindromic (REP) sequence in its 3''structural terminus

A computer search for repeated sequences led us to identify five REP (repetitive extragenic palindromic) sequences in the 3'-terminal region of the Escherichia coli ribonucleoside diphosphate reductase gene (nrdA). These REP sequences are located within a putative duplicated DNA region, the first of them being part of the carboxy-terminal coding region of the nrdA gene. This is the first report of a REP sequence within a structural gene and also the first example of a REP sequence apparently generated by DNA duplication.     

Use of 16S-23S rRNA intergenic spacer region PCR and repetitive extragenic palindromic PCR analyses of Escherichia coli isolates to identify nonpoint fecal sources

Despite efforts to minimize fecal input into waterways, this kind of pollution continues to be a problem due to an inability to reliably identify nonpoint sources. Our objective was to find candidate source-specific Escherichia coli fingerprints as potential genotypic markers for raw sewage, horses, dogs, gulls, and cows. We evaluated 16S-23S rRNA intergenic spacer region (ISR)-PCR and repetitive extragenic palindromic (rep)-PCR analyses of E. coli isolates as tools to identify nonpoint fecal sources. The BOXA1R primer was used for rep-PCR analysis. A total of 267 E. coli isolates from different fecal sources were typed with both techniques. E. coli was found to be highly diverse. Only two candidate source-specific E. coli fingerprints, one for cow and one for raw sewage, were identified out of 87 ISR fingerprints. Similarly, there was only one candidate source-specific E. coli fingerprint for horse out of 59 BOX fingerprints. Jackknife analysis resulted in an average rate of correct classification (ARCC) of 83% for BOX-PCR analysis and 67% for ISR-PCR analysis for the five source categories of this study. When nonhuman sources were pooled so that each isolate was classified as animal or human derived (raw sewage), ARCCs of 82% for BOX-PCR analysis and 72% for ISR-PCR analysis were obtained. Critical factors affecting the utility of these methods, namely sample size and fingerprint stability, were also assessed. Chao1 estimation showed that generally 32 isolates per fecal source individual were sufficient to characterize the richness of the E. coli population of that source. The results of a fingerprint stability experiment indicated that BOX and ISR fingerprints were stable in natural waters at 4, 12, and 28 degrees C for 150 days. In conclusion, 16S-23S rRNA ISR-PCR and rep-PCR analyses of E. coli isolates have the potential to identify nonpoint fecal sources. A fairly small number of isolates was needed to find candidate source-specific E. coli fingerprints that were stable under the simulated environmental conditions.     

A family of repetitive palindromic sequences found in Neurospora mitochondrial DNA is also found in a mitochondrial plasmid DNA

Neurospora mtDNA contains a repetitive, 18 nucleotide palindromic sequence (5'-CCCTGCAGTACTGCAGGG-3') that contains two closely spaced PstI sites (CTGCAG) in the arms of the palindrome (Yin, S., Heckman, J., and RajBhandary, U. L. (1981) Cell 26, 325-332). In the present study, DNA sequence analysis was carried out to determine whether PstI palindromes are present in an apparently distinct genetic element, the 3.6-kilobase mitochondrial plasmid from Neurospora crassa strain Mauriceville-1c (FGSC 2225). The plasmid contains a cluster of closely spaced PstI sites extending over a 0.4-kilobase region (Collins, R. A., Stohl, L. L., Cole, M. D., and Lambowitz, A. M. (1981) Cell 24, 443-452). The DNA sequence shows that the cluster consists of eight PstI sites organized in five palindromic elements. Two of the elements are identical with the canonical sequence found in mtDNA, whereas the remaining three elements differ from the canonical sequence by a few nucleotides. The occurrence of the PstI palindromes in two otherwise unrelated DNA species is consistent with the hypothesis that they are related to mobile DNA sequences that either propagate or were once capable of propagating within mitochondria.     

Use of repetitive (repetitive extragenic palindromic and enterobacterial repetitive intergeneric consensus) sequences and the polymerase chain reaction to fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria.

The distribution of dispersed repetitive DNA (repetitive extragenic palindromic [REP] and enterobacterial repetitive intergenic consensus [ERIC]) sequences in the genomes of a number of gram-negative soil bacteria was examined by using conserved primers corresponding to REP and ERIC sequences and the polymerase chain reaction (PCR). The patterns of the resulting PCR products were analyzed on agarose gels and found to be highly specific for each strain. The REP and ERIC PCR patterns of a series of Rhizobium meliloti isolates, previously ordered in a phylogenetic tree based on allelic variations at 14 enzyme loci (B. D. Eardly, L. A. Materon, N. H. Smith, D. A. Johnson, M. D. Rumbaugh, and R. K. Selander, Appl. Environ. Microbiol. 56:187-194), were determined. Isolates which had been postulated to be closely related by multilocus enzyme electrophoresis also revealed similar REP and ERIC PCR patterns, suggesting that the REP and ERIC PCR method is useful for the identification and classification of bacterial strains.     

Mapping of insertion element IS30 in the Escherichia coli K12 chromosome

Summary We identified seven phage clones containing the insertion element IS30 in a phage library mini-set, which includes 476 clones carrying chromosomal segments that cover almost the entire chromosome ofEscherichia coli K12 W3110 (Kohara et al. 1987). We could assign locations and orientations to four copies of IS30 (namedis30A tois30D) on the W3110 chromosome by restriction analysis of phage DNAs containing them. These IS30s were present at the same locations in chromosomes of both W3110 and anotherE. coli K12 strain JE5519, and thus are assumed to be present in otherE. coli K12 derivatives, including early isolates. Among the IS30 copies found, one (is30B) contained a large deletion and possessed only a 181 by stretch of the right terminal region of IS30.EMBL Accession Number: The EMBL accession number of the sequence reported in this paper is X17345     

A new family of dispersed,highly repetitive sequences in bovine genome

A new family of highly repetitive sequences which are dispersed in bovine genome is described. The members of the family are visible on agarose or polyacrylamide gels as a diffused band about 510 bp in length arising after digestion with PstI restriction nuclease. This family of fragments comprises the 160 bp bovine Bsu family and is linked with bovine Alu-like sequences.     

Identification of the Chi site of Haemophilus influenzae as several sequences related to the Escherichia coli Chi site

The Escherichia coli Chi site 5'-GCTGGTGG-3' modulates the activity of the powerful dsDNA exonuclease and helicase RecBCD. Genome sequence analyses revealed that Chi is frequent on the chromosome and oriented with respect to replication on the E . coli genome. Chi is also present much more frequently than predicted statistically for a random 8-mer sequence. Although it is assumed that Chi is ubiquitous, there is virtually no proof that its features are conserved in other microorganisms. We therefore identified and analysed the Chi sequence of an organism for which the full genome sequence was available, Haemophilus influenzae . The biological test we used is based on our finding that rolling circle plasmids provide a specific substrate for RecBCD analogues in different microorganisms. Unexpectedly, several related sequences, corresponding to 5'-GNTGGTGG-3' and 5'-G(G/C)TGGAGG-3', showed Chi activity. As in E . coli , the H . influenzae Chi sites are frequent on the genome, which is in keeping with the need for frequent Chi sites for dsDNA break repair of chromosomal DNA. Although statistically over-represented, this feature is less marked than that of the E . coli Chi site. In contrast to E . coli , the H . influenzae Chi motifs are only slightly oriented with respect to the replication strand. Thus, although Chi appears to have a highly conserved biological role in attenuating exonuclease activity, its sequence characteristics and statistical representation on the genome may differ according to the particular features of the host.     

Identification of a novel genetic element in Escherichia coli K-12.

Induction of the SOS repair processes of Escherichia coli K-12 caused a 14.4-kilobase species of circular deoxyribonucleic acid, called element e14, to be excised from the chromosome. To aid further characterization of this species, an 11.6-kilobase segment of e14 was inserted into the HindIII site of plasmid pBR313. To map e14 on the E. coli K-12 chromosome, the recombinant plasmid, pAG2, was used to transform a polA recipient, an event which required integration of pAG2 into the recipient chromosome. This recombinational event was dependent upon the region of homology between the incoming plasmid and the chromosome, as no transformants were scored when either a strain cured of the element was the recipient or pBR313 was the transforming deoxyribonucleic acid. Using these transformants, we have shown that e14 maps between the purB and pyrC loci near min 25. Several strains of E. coli K-12 were found to contain e14; however, one strain, Ymel trpA36, did not. In addition, e14 was found to be absent in both E. coli B/5 and E. coli C. The approach to mapping developed for this work could be used to map other fragments of E. coli deoxyribonucleic acid which have no known phenotype.     

A new family of repetitive nucleotide sequences is restricted to the genus Zea

We have isolated a new family of moderately repetitive nucleotide sequences (about 2500 copies per haploid genome) specific to the genus Zea and absent in other graminaceous species. These sequences are interspersed in the genome and they show the same genomic organization pattern and similar copy number in all the Zea species examined. These two facts, consistency in the copy number and the same organization pattern, would indicate on the one hand that these sequences were amplified before the divergence of Zea species, and on the other hand that maize and all the teosintes could be considered as the same evolutionary population. Independent clones corresponding to the repetitive sequences have been isolated and sequenced from a genomic library of the teosinte, Zea diploperennis. The repeats, flanked by HaeIII sites, are more than 70% G + C-rich, on average 253 bp long and show 78% similarity to each other. These repetitive sequences are in a highly methylated-C context and they present some features resembling those of coding sequences, such as high CpG and low TpA content, and similar codon usage to maize genes in one of the reading frames. Moreover, the repetitive probe hybridizes with RNA extracted from different tissues of maize and from teosinte, indicating that these repeats or similar ones are present in transcribed sequences.     

A new family of repetitive, retroposon-like sequences in the genome of the rainbow trout

We have identified a new family of interspersed, moderately repetitive DNA elements, termed the RSg-1 family, in the genome of the rainbow trout. Two of the elements examined here are situated upstream of sequences which code for trout nuclear proteins; a protamine gene (p101) and the clustered histone H4 gene. Sequence comparison of various RSg-1 elements indicated a high degree of nucleotide sequence homology between different members of the family. These repetitive elements exhibit well defined 3' ends which contain poly(A) segments preceded by the consensus polyadenylation signal AATAAA. Sequences flanking the 3' end of the poly(A) tract also conform to a consensus sequence. A similar sequence is also found flanking the 5' terminus of the element in the protamine clone p101, and thus may represent a target-site duplication generated upon insertion of the element into the genome. These characteristics, together with the heterogeneous nature of the 5' ends of the elements, are reminiscent of processed pseudogenes and retroposons such as the mammalian L1 family of interspersed repetitive elements.