共查询到20条相似文献,搜索用时 15 毫秒
1.
T A Le?nsoo V A Nikolaev S L Grokhovski? A N Surovaia N Iu Sidorova S A Strel'tsov A S Zasedatelev A L Zhuze G V Gurski? 《Molekuliarnaia biologiia》1989,23(6):1616-1637
In the present communication design, synthesis and DNA binding activities of three bis-netropsins and two netropsin analogs containing two N-propylpyrrolecarboxamide fragments linked covalently to peptides Gly-Gly-(analog I) and Val-Val-Val-Gly-Gly-(analog II) are reported. Each bis-netropsin consists of two netropsin-like fragments attached to peptides -Gly-Cys-Gly-NH2 (compound IIIa), H-Gly-Cys-Gly-Gly-Gly-(compound IV) or Gly-Cys-Sar-NH2 (compound IIIb) which are linked symmetrically via S-S bonds. Physico-chemical studies show that each bis-netropsin carries 6 AT-specific reaction centers and covers approximately 10 base pairs upon binding to poly(dA).poly(dT). This indicates that two netropsin-like fragments of the bis-netropsin molecule are implicated in specific interaction with DNA base pairs. The peptide fragments of bis-netropsins IIIa and IV form small beta-sheets containing two-GC-specific reaction centers. The DNase I cleavage patterns of bis-netropsin-DNA complexes visualized by high resolution gel electrophoresis show that the preferred binding sites for bis-netropsins IIIa and IV are identical and contain two runs of three or more AT pairs separated by two GC pairs. Specificity determinants of netropsin analog II binding in the beta-associated dimeric form are identical to those of bis-netropsin IIIa thereby indicating that there is a similarity in the structure of complexes formed by these ligands with DNA. In the monomeric form analog II exhibits binding specificity identical to that of analog I. Replacement of C-terminal glycine residues by sarcosines in the peptide fragments of bis-netropsin IIIa leads to a decrease in the affinity of ligand for DNA. 相似文献
2.
Anna N. Surovaya Gunther Burckhardt Sergei L. Grokhovsky Eckhard Birch-Hirschfeld Georgii V. Gursky Christoph Zimmer 《Journal of biomolecular structure & dynamics》2013,31(5):595-606
Abstract Pt-bis-netropsin is a synthetic sequence-specific DNA-binding ligand comprizing two netropsin-like fragments which are linked in a tail-to-tail manner via a cis-diammineplat-inum (II) residue. The CD studies and thermodynamic characterization of the DNA-binding properties exhibited by this compound reveal that it forms two types of complexes with poly[d(AT)]?poly[d(AT)] and DNA oligomers containing nucleotide sequences 5′-CC (TA)nCC-3′, with n = 4, 5 and 6. The first type corresponds to the binding of Pt-bis-netropsin in the extended conformation and is characterized by the saturating ratio of one bound Pt-bis-netropsin molecule per 9 AT-base pairs. The second type of the complex corresponds to the binding of Pt-bis-netropsin to DNA in the folded hairpin form. The binding approaches saturation level when one Pt-bis-netropsin molecule is bound per four or five AT-base pairs. The hairpin form of Pt-bis-netropsin complex is built on the basis of parallel side-by-side peptide motif which is inserted in the minor DNA groove. The CD spectral profiles reflecting the binding of Pt-bis-netropsin in the hairpin form are different from those observed for binding of another bis-netropsin with the sequence Lys-Gly-Py-Py-Gly-Gly-Gly-Py-Py-Dp, where Py is a N-propylpyrrole amino acid residue and Dp is a dimethylaminopropylamino residue. The hairpin form of this bis-netropsin is formed on the basis of antiparallel side- by-side peptide motif. The CD spectra obtained for complexes of this polyamide in the hairpin form with poly[dAT)]?poly[d(AT)] exhibit positive CD band with a peak at 325 nm, whereas the CD spectral profiles for the second complex of Pt-bis-Nt with poly[d(AT)] ?poly[d(AT)] and short DNA oligomers have two intense positive CD bands near 290 nm and 328 nm. This reflects the fact that two bis-netropsins use different structural motifs on binding to DNA in the hairpin form. 相似文献
3.
Alternative heterocycles for DNA recognition: a 3-pyrazole/pyrrole pair specifies for G.C base pairs
Synthetic ligands comprising three aromatic amino acids, pyrrole (Py), imidazole (Im), and hydroxypyrrole (Hp), specifically recognize predetermined sequences as side-by-side pairs in the minor groove of DNA. To expand the repertoire of aromatic rings that may be utilized for minor groove recognition, three five-membered heterocyclic rings, 3-pyrazolecarboxylic acid (3-Pz), 4-pyrazolecarboxylic acid (4-Pz), and furan-2-carboxylic acid (Fr), were examined at the N-terminus of eight-ring hairpin polyamide ligands. The DNA binding properties of 3-Pz, 4-Pz, and Fr each paired with Py were studied by quantitative DNase I footprinting titrations on a 283 bp DNA restriction fragment containing four 6-bp binding sites 5'-ATNCCTAA-3' (N = G, C, A, or T; 6-bp polyamide binding site is underlined). The pair 3-Pz/Py has increased binding affinity and sequence specificity for G.C bp compared with Im/Py. 相似文献
4.
The DNA binding selectivity of three ligands of a series of antitumor agents of bisquaternary ammonium heterocycles has been investigated by means of CD spectroscopy and melting measurements. From the spectroscopic results and binding data it is concluded that the agents SN-6132, SN-6131 and SN-6113 have relatively high affinity to AT base pair sequences whereas the binding to GC pairs is very low. The binding selectivity to AT base pair sequences decreases in the order netropsin > SN-6132 > SN-6113 > SN-6131. Poly(dA).poly(dT) has the highest binding preference for SN-6132 relative to that of SN-6131. The different binding behavior of the ligands is related to their distinct changes in the chemical structure and to the DNA minor groove properties which determines the adaptability of the ligands in the groove. 相似文献
5.
N Iu Sidorova V A Nikolaev A N Surovaia A L Zhuze G V Gurski? 《Molekuliarnaia biologiia》1991,25(3):706-717
Cystine peptide dimer (Lys-Gly-Val-Cys-Val-N2H2Dns)2 with S-S bridge was synthesized and its interactions with DNA and synthetic polynucleotides have been studied by optical spectroscopy methods. By recording fluorescent titration curves we have shown that the affinity of the peptide to different synthetic polynucleotides decreases in the order: poly(dG).poly(dC) greater than poly(dA).poly(dT) greater than poly(dGC).poly(dGC). The stability of complexes to increasing concentrations of NaCl diminishes in the same order. The association constant is about 20-fold greater for peptide binding to poly(dG).poly(dC) than to poly(dA).poly(dT). By using circular dichroism and fluorescence measurements we have shown that the peptide competes for the binding sites on DNA with two minor-groove binding antibiotics--distamycin A and sybiromycin. These results have suggested that the peptide also binds in the DNA minor groove. Investigation of the interactions between such peptides and DNA may be useful for constructing ligands with combined specificity to DNA. 相似文献
6.
DNA sequence preferences of several AT-selective minor groove binding ligands. 总被引:6,自引:5,他引:1 下载免费PDF全文
We have examined the interaction of distamycin, netropsin, Hoechst 33258 and berenil, which are AT-selective minor groove-binding ligands, with synthetic DNA fragments containing different arrangements of AT base pairs by DNase I footprinting. For fragments which contain multiple blocks of (A/T)4 quantitative DNase I footprinting reveals that AATT and AAAA are much better binding sites than TTAA and TATA. Hoechst 33258 shows that greatest discrimination between these sites with a 50-fold difference in affinity between AATT and TATA. Alone amongst these ligands, Hoechst 33258 binds to AATT better than AAAA. These differences in binding to the various AT-tracts are interpreted in terms of variations in DNA minor groove width and suggest that TpA steps within an AT-tract decrease the affinity of these ligands. The behaviour of each site also depends on the flanking sequences; adjacent pyrimidine-purine steps cause a decrease in affinity. The precise ranking order for the various binding sites is not the same for each ligand. 相似文献
7.
Derrick Watkins Gerald B. Koudelka Loren Dean Williams 《Journal of molecular biology》2010,396(4):1145-1279
The binding of proteins to specific sequences of DNA is an important feature of virtually all DNA transactions. Proteins recognize specific DNA sequences using both direct readout (sensing types and positions of DNA functional groups) and indirect readout (sensing DNA conformation and deformability). Previously we showed that the P22 c2 repressor N-terminal domain (P22R NTD) forces the central non-contacted 5'-ATAT-3' sequence of the DNA operator into the B′ state, a state known to affect DNA hydration, rigidity and bending. Usually the B′ state, with a narrow minor groove and a spine of hydration, is reserved for A-tract DNA (TpA steps disrupt A-tracts). Here, we have co-crystallized P22R NTD with an operator containing a central 5′-ACGT-3′ sequence in the non-contacted region. C·G base pairs have not previously been observed in the B′ state and are thought to prevent it. However, P22R NTD induces a narrow minor groove and a spine of hydration to 5'-ACGT-3'. We observe that C·G base pairs have distinctive destabilizing and disordering effects on the spine of hydration. It appears that the reduced stability of the spine results in a higher energy cost for the B to B′ transition. The differential effect of DNA sequence on the barrier to this transition allows the protein to sense the non-contacted DNA sequence. 相似文献
8.
Hairpin polyamides selectively recognize predetermined DNA sequences with affinities comparable to naturally occurring proteins. Internal side-by-side pairs of unsymmetrical aromatic rings within the minor groove of DNA distinguish each of the four Watson-Crick base pairs. In contrast, N-terminal ring pairs exhibit less specificity, with the exception of Im/Py targeting G.C base pairs. In an effort to explore the sequence specificity of new ring pairs, a series of hairpin polyamides containing 3-substituted-thiophene-2-carboxamide residues at the N-terminus was synthesized. An N-terminal 3-methoxy (or 3-chloro) thiophene residue paired opposite Py displayed 6- (and 3-) fold selectivity for T.A relative to A.T base pair, while disfavoring G,C base pairs by >200-fold. Our data suggests shape selective recognition with projection of the 3-thiophene substituent (methoxy or chloro) to the floor of the minor groove. 相似文献
9.
S L Grokhovski? A N Surovaia N Iu Sidorova H Votavova J Sponar 《Molekuliarnaia biologiia》1988,22(5):1315-1334
In the present communication, design, synthesis and DNA binding activities of the following two peptides are reported: Dns-Gly-Ala-Gln-Lys-Leu-Ala-Cly-Lys-Val-Gly-Thr-Lys-Val-Lys-Val-Gl y-Thr-Lys-Thr - Val-OH (I) and [(H-Ala-Lys-Leu-Ala-Thr-Lys-Ala-Gly-Val-Lys-Gln-Gln-Ser-Ile-Gln-Leu-Ile- Thr- Ala-Aca-Lys-Aca)2Lys-Aca]2Lys-Val-OH (II), where Aca = NH(CH2)5CO--; Dns is a residue of 5-dimethylaminonaphtalene-1-sulfonic acid. Peptide I contains a large fraction (ca.30%) of valyl and threonyl residues, which possess a high potential for beta structure formation. Peptide II contains four repeats of the amino acid sequence present in the presumed DNA binding helix-turn-helix unit of 434 Cro repressor. These four domains are linked in such a way that two domains can interact with two halves a 14 base pair long operator site on DNA. From CD studies we have found that peptide I is in a random coil conformation in the aqueous solution in the presence of 20% trifluoroethanol. By contrast, amino acid residues of peptide II assume alpha helical, beta and random coiled conformations under the same conditions. A change in the secondary structure of the two peptides upon binding to DNA is observed. The difference CD spectra obtained by subtracting the spectra of free DNA from the spectra of peptide I--DNA complexes gives rise to a beta-like pattern. The difference CD spectra obtained for complexes of peptide II with various natural and synthetic DNAs suggest that alpha-beta-transition takes place in the presumed helix-turn-helix repeat units of peptide II upon binding to DNA. Peptide I binds more strongly to poly(dG).poly(dC) than to poly(dA).poly(dT) and poly[d(GC)].poly[d(GC)]. The binding takes place in the minor DNA groove because minor groove binding antibiotic sibiromycin can displace peptide I from a complex with poly(dG).poly(dC). Analysis of footprinting diagramms shows that peptide I specifically protects phosphodiester bonds within operator sites OR1 and OR2 of phage lambda from nuclease cleavage. By contrast, peptide II does not react specifically with operators OR1, OR2 and OR3 of phage 434 although it forms very tight complexes with DNA which are stable in the presence of 1M NH4F. 相似文献
10.
Zhi-Ren Liu Karl H. Hecker Randolph L. Rill 《Journal of biomolecular structure & dynamics》2013,31(3):331-339
Abstract Alkylamine-substituted naphthalene imides and diimides bind DNA by intercalation and have applications as anticancer agents. The unique structures of these imides in which two adjacent carbonyl groups lie coplanar to an extended aromatic ring system allow the possibility of sequence-selective interactions between the intercalated chromophore and guanine amino groups situated in the DNA minor groove. The binding affinities of N-[3- (dimethylamino)propyl amine]-1,8-naphthalenedicarboxylic imide (N-DMPrNI) and N, N′- bis[3,3′-(dimethylamino)propylamine]-naphthalene-1,4,5,8-tetracarboxylic diimide (N- BDMPrNDI) for natural DNAs of differing base composition were determined spectroscopically and by equilibrium dialysis. In agreement with the above proposition, binding studies indicated that both the naphthalene imide and diimide strongly prefer to intercalate into steps containing at least one G:C base pair. The dependencies of association constants on DNA base composition are consistent with a requirement for one G:C pair in the binding site of the monoimide, and two G:C pairs in binding sites of the diimide. These selectivities are comparable to or exceed that of actinomycin D, a classic G:C-selective drug. Protection footprinting with DNase I confirmed that the naphthalene monoimide (N-DMPrNI) prefers to bind adjacent to G:C base pairs, with a most consistent preference for “mixed” steps containing both a G:C and an A:T pair, excepting GA:TC. Several 5-CG-3′ steps were also good binding sites as indicated by nuclease protection, but few GC:GC or GG:CC steps were protected. The naphthalene diimide inhibited DNase I digestion, but did not yield a footprint. The base recognition ability and versatile chemistry make naphthalene imides and diimides attractive building blocks for design of highly sequence-specific, DNA-directed drug candidates including conjugated oligonucleotides or oligopeptides. 相似文献
11.
Minor groove hydration of DNA in aqueous solution: sequence-dependent next neighbor effect of the hydration lifetimes in d(TTAA)2 segments measured by NMR spectroscopy. 下载免费PDF全文
The hydration in the minor groove of double stranded DNA fragments containing the sequences 5'-dTTAAT, 5'-dTTAAC, 5'-dTTAAA and 5'-dTTAAG was investigated by studying the decanucleotide duplex d(GCATTAATGC)2 and the singly cross-linked decameric duplexes 5'-d(GCATTAACGC)-3'-linker-5'-d(GCGTTAATGC)-3' and 5'-d(GCCTTAAAGC)-3'-linker-5'-d(GCTTTAAGGC)-3' by NMR spectroscopy. The linker employed consisted of six ethyleneglycol units. The hydration water was detected by NOEs between water and DNA protons in NOESY and ROESY spectra. NOE-NOESY and ROE-NOESY experiments were used to filter out intense exchange cross-peaks and to observe water-DNA NOEs with sugar 1' protons. Positive NOESY cross-peaks corresponding to residence times longer than approximately 0.5 ns were observed for 2H resonances of the central adenine residues in the duplex containing the sequences 5'-dTTAAT and 5'-dTTAAC, but not in the duplex containing the sequences 5'-dTTAAA and 5'-dTTAAG. In all nucleotide sequences studied here, the hydration water in the minor groove is significantly more mobile at both ends of the AT-rich inner segments, as indicated by very weak or negative water-A 2H NOESY cross-peaks. No positive NOESY cross-peaks were detected with the G 1'H and C 1'H resonances, indicating that the minor groove hydration water near GC base pairs is kinetically less restrained than for AT-rich DNA segments. Kinetically stabilized minor groove hydration water was manifested by positive NOESY cross-peaks with both A 2H and 1'H signals of the 5'-dTTAA segment in d(GCATTAATGC)2. More rigid hydration water was detected near T4 in d(GCATTAATGC)2 as compared with 5'-d(GCATTAACGC)-3'-linker-5'-d(GCGTTAATGC)-3', although the sequences differ only in a single base pair. This illustrates the high sensitivity of water-DNA NOEs towards small conformational differences. 相似文献
12.
Optical methods, such as fluorescence, circular dichroism and linear flow dichroism, were used to study the binding to DNA of four symmetrical cyanine dyes, each consisting of two identical quinoline, benzthiazole, indole, or benzoxazole fragments connected by a trimethine bridge. The ligands were shown to form a monomer type complex into the DNA minor groove. The complex of quinoline-containing ligand with calf thymus DNA appeared to be the most resistant to ionic strength, and it did not dissociate completely even in 1 M NaCl. Binding of cyanine dyes to DNA could also be characterized by possibility to form ligand dimers into the DNA minor groove, by slight preference of binding to AT pairs, as well as by possible intercalation between base pairs of poly(dG)-poly(dC). The correlation found between the binding constants to DNA and the extent of cyanine dyes hydrophobicity estimated as the n-octanol/water partition coefficient is indicative of a significant role of hydrophobic interactions for the ligand binding into the DNA minor groove. 相似文献
13.
Y Y. Vengerov T E. Semenov A. N. Surovaya N. Yu. Sidorova S. A. Streltsov A. A. Khorlin 《Journal of biomolecular structure & dynamics》2013,31(2):311-330
Abstract Binding to DNA of two synthetic peptides, Val-Thr-Thr-Val-Val-NH-NH-Dns and Thr-Val- Thr-Lys-Val-Gly-Thr-Lsy-Val-Gly-Thr-Val-Val-NH-NH-Dns (where Dns is a residue of 5- dimethylaminonaphthalene-l-sulfonic acid), has been studied by circular dichroism, electron microscopy and fluorescence methods. It has been found that these two peptides can self- associate in aqueous solution as follows from the fact that concentration-dependent changes are observed in the UV absorbance and fluorescence spectra. The two peptides can bind to DNA both in self-associated and monomeric forms. The pentapeptide in the β-associated form binds more strongly to poly(dG) · poly(dC) than to poly[d(A-C)] · poly[d(G-T)] and poly(dA) · poly(dT) whereas the tridecapeptide exhibits an opposite order of preferences binding more strongly to poly[d(A-C)] · poly[d(G-T)] and poly(dA) · poly(dT) than to poly(dG) · poly(dC). Binding is a cooperative process which is accompanied by the DNA compaction at peptide/DNA base pair ratios greater than l. At the initial stage of the compaction process, the coalescence of DNA segments covered by bound peptide molecules leads to the formation of DNA loops stabilized by the interaction between peptide molecules bound to different DNA segments. Further increase in the peptide/DNA ratio leads to the formation of rod-like structures each consisting of two or more double-stranded DNA segments. The final stage of the compaction process involves folding of fibrillar macromolecular complexes into a globular structure containing only one DNA molecule. 相似文献
14.
We have applied molecular docking methods to systems containing nucleic acids as targets and biologically active substances as ligands. The complexes of DNA fragments and actinocin derivatives with different lengths of aminoalkyl side chains were obtained by molecular docking. It was observed that actinocin derivatives could form energetically favourable complexes with DNA both as intercalators and minor groove binders. It was shown that small changes in the binding energy (~1?kcal/mol) could result in complexes with substantially different structure. The complexes of actinocin derivatives and DNA fragments were stabilized by hydrogen bonding upon intercalation and minor groove binding. It was found that the change of solvent-accessible surface area upon binding of the actinocin derivative to DNA linear increased with the growth of methylene groups' number in ligand side chains. The solvation energy change upon binding of actinocin derivatives to DNA calculated by the WSAS method was favourable in the case of small uncharged ligands and unfavourable for positively charged ligands. 相似文献
15.
16.
M.Y. Zhitnikova A.V. Shestopalova 《Journal of biomolecular structure & dynamics》2017,35(15):3384-3397
The structural adjustments of the sugar-phosphate DNA backbone (switching of the γ angle (O5′–C5′–C4′–C3′) from canonical to alternative conformations and/or C2′-endo → C3′-endo transition of deoxyribose) lead to the sequence-specific changes in accessible surface area of both polar and non-polar atoms of the grooves and the polar/hydrophobic profile of the latter ones. The distribution of the minor groove electrostatic potential is likely to be changing as a result of such conformational rearrangements in sugar-phosphate DNA backbone. Our analysis of the crystal structures of the short free DNA fragments and calculation of their electrostatic potentials allowed us to determine: (1) the number of classical and alternative γ angle conformations in the free B-DNA; (2) changes in the minor groove electrostatic potential, depending on the conformation of the sugar-phosphate DNA backbone; (3) the effect of the DNA sequence on the minor groove electrostatic potential. We have demonstrated that the structural adjustments of the DNA double helix (the conformations of the sugar-phosphate backbone and the minor groove dimensions) induce changes in the distribution of the minor groove electrostatic potential and are sequence-specific. Therefore, these features of the minor groove sizes and distribution of minor groove electrostatic potential can be used as a signal for recognition of the target DNA sequence by protein in the implementation of the indirect readout mechanism. 相似文献
17.
L. Kittler B. C. Baguley G. Lber M. J. Waring 《Journal of molecular recognition : JMR》1999,12(2):121-130
A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the Ka‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd. 相似文献
18.
Tawar U Jain AK Chandra R Singh Y Dwarakanath BS Chaudhury NK Good L Tandon V 《Biochemistry》2003,42(45):13339-13346
DNA minor groove ligands provide a paradigm for double-stranded DNA recognition, where common structural motifs provide a crescent shape that matches the helix turn. Since minor groove ligands are useful in medicine, new ligands with improved binding properties based on the structural information about DNA-ligand complexes could be useful in developing new drugs. Here, two new synthetic analogues of AT specific Hoechst 33258 5-(4-methylpiperazin-1-yl)-2-[2'-(3,4-dimethoxyphenyl)-5'-benzimidazolyl] benzimidazole (DMA) and 5-(4-methylpiperazin-1-yl)-2-[2'[2'-(4-hydroxy-3-methoxyphenyl)-5' '-benzimidazolyl]-5'-benzimidazolyl] benzimidazole (TBZ) were evaluated for their DNA binding properties. Both analogues are bisubstituted on the phenyl ring. DMA contains two ortho positioned methoxy groups, and TBZ contains a phenolic group at C-4 and a methoxy group at C-3. Fluorescence yield upon DNA binding increased 100-fold for TBZ and 16-fold for DMA. Like the parent compound, the new ligands showed low affinity to GC-rich (K approximately 4 x 10(7) M(-1)) relative to AT-rich sequences (K approximately 5 x 10(8) M(-1)), and fluorescence lifetime and anisotropy studies suggest two distinct DNA-ligand complexes. Binding studies indicate expanded sequence recognition for TBZ (8-10 AT base pairs) and tighter binding (DeltaT(m) of 23 degrees C for d (GA(5)T(5)C). Finally, EMSA and equilibrium binding titration studies indicate that TBZ preferentially binds highly hydrated duplex domains with altered A-tract conformations d (GA(4)T(4)C)(2) (K= 3.55 x 10(9) M(-1)) and alters its structure over d (GT(4)A(4)C)(2) (K = 3.3 x 10(8) M(-1)) sequences. Altered DNA structure and higher fluorescence output for the bound fluorophore are consistent with adaptive binding and a constrained final complex. Therefore, the new ligands provide increased sequence and structure selective recognition and enhanced fluorescence upon minor groove binding, features that can be useful for further development as probes for chromatin structure stability. 相似文献
19.
The mobility shift assay was used to study the competition of the minor groove binder distamycin A with either an Antennapedia homeodomain (Antp HD) peptide or derivatives of a fushi tarazu homeodomain (ftz HD) peptide for their AT-rich DNA binding site. The results show that distamycin and the homeodomain peptides compete under the conditions: (i) preincubation of DNA with distamycin and subsequent addition of HD peptide; (ii) simultaneous incubation of DNA with distamycin and HD peptide; and (iii) preincubation of DNA with HD peptide and subsequent addition of distamycin. There is also competition when using a peptide which lacks the N-terminal arm of ftz HD that is involved in contacts in the minor groove. It is proposed that the protein's binding affinity is diminished by distamycin-induced conformational changes of the DNA. The feasibility of the propagation of conformational changes upon binding in the minor groove is also shown for the inhibition of restriction endonucleases differing in the AT content of their recognition site and of their flanking DNA sequences. Thus, it is demonstrated that minor groove binders can compete with the binding of proteins in the major groove, providing an experimental indication for the influence of biological activities exerted by DNA ligands binding in the minor groove. 相似文献
20.
The hydration shell of several conformations of the polynucleotides poly(dA).poly(dT), poly(dA).poly(dU), and poly(dA-dI).poly(dT-dC) has been simulated using the Monte Carlo method (Metropolis sampling). Calculations have shown that the structure of the hydration shell of the minor groove greatly depends on its width. In conformations with a narrowed minor groove, the first layer of the hydration shell of this groove has only one molecule per nucleotide pair that forms H bonds with purine N3 of one pair and pyrimidine O2 of the next pair. The second layer of the hydration shell of such conformations contains molecules that form H bonds between two adjacent molecules of the first layer. The probability of formation of hydration spine is about 20% while the bridges of the first layer are formed with a probability of about 70%. In the first layer of the minor groove of the B-DNA conformation with wide minor groove there are approximately two water molecules per base pair that form H bonds with purine N3 or pyrimidine O2 and with the sugar ring oxygen of the adjacent nucleotide. The probability of simultaneous H bonding of a water molecule with N3 (or O2) and O of sugar ring is about 30%. The results of simulation suggest that hydration spine proposed for the narrowed minor groove of oligonucleotide crystals [H. R. Drew, and R. E. Dickerson (1981) Journal of Molecular Biology, Vol. 151, pp. 535-556] can be formed in fibers of poly(dA).poly(dT), poly(dA).poly(dU), and poly(dA-dI).poly(dT-dC) as well as in DNA fragments of these sequences in solution.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献