Ab-initio quantum mechanical calculations of NMR chemical shifts in nucleic acid constituents. I. The Watson-Crick base pairs

The magnetic shielding constants of the different nuclei of the four nucleic acid bases adenine, uracile, guanine and cytosine are calculated by a non empirical method using a minimal basis set and compared to the available corresponding experimental data. The same calculations carried out for AU and GC pairs give not only the values of the chemical shift variations due to the formation of the pairs but also the relative importance of the three different contributions (geometric, polarization and charge transfer plus exchange) to the total value of delta delta. Their analysis shows the importance of the polarization term. The magnitude of the charge transfer plus exchange term which is obtained for the nuclei belonging to the hydrogen bonding sites indicates that the hydrogen bond length is the major factor in the determination of the magnetic shielding constants of these atoms. On the other hand it appears that the pairing of the bases has a negligible effect on the "geometric" magnetic shielding due to the bases.     

Ab-initio quantum mechanical calculations of NMR chemical shifts in nucleic acids constituents. III. Chemical shift variations due to base stacking

Ab inito computations of the different contributions to chemical shift variations due to intra and interstrand stacking are reported for the GC, CG, AT and TA sequences of a B DNA helix. The results obtained for the non hydrogen atoms of the GC stacks show that the chemical shift variations are mainly due to the polarization contribution, the term which decreases slowly with the intermolecular distance. Because of the weaker polarity of adenine and thymine the geometric and polarization contributions are of closer absolute magnitude for the non hydrogen atoms of the intrastrand stacks but the polarization term is the determining contribution in the corresponding interstrand stacks. For the protons which undergo smaller shifts due to the polarization (or electric field effects) the role of the geometric contribution is more important and is even the leading one for the hydrogens of cytosine and thymine in the case of intrastrand stacking. The charge transfer plus exchange term has a non negligeable value for a limited number of cases corresponding to the shortest intermolecular interatomic distances. These results are discussed in relation with the qualitative differences observed between the proton and carbon spectra of dinucleotides and B-DNA duplexes.     

Post Hartree-Fock Studies of the Canonical Watson-Crick DNA Base Pairs: Molecular Structure and the Nature of Stability

Abstract

Gas-phase gradient optimization was carried out on the canonical Watson-Crick DNA base pairs using the second-order Møller-Plesset perturbation method at the 6–31G(d) and 6- 31G(d,p) basis sets. It is detected that full geometry optimization at the MP2 level leads to an intrinsically nonplanar propeller-twisted and buckled geometry of G-C and A-T base pairs; while HF and DFT methods predict perfect planar or almost planar geometry of the base pairs. Supposedly the nonplanarity of the pairs is caused by pyramidalization of the amino nitrogen atoms, which is underestimated by the HF and DFT methods. This justifies the importance of geometry optimization at the MP2 level for obtaining reliable prediction of the charge distribution, molecular dipole moments and geometrical structure of the base pairs. The Morokuma-Kitaura and the Reduced Variational Space methods of the decomposition for molecular HF interaction energies were used for investigation of the hydrogen bonding in the Watson-Crick base pairs. It is shown that the HF stability of the hydrogen-bonded DNA base pairs originates mainly from electrostatic interactions. At the same time, the calculated magnitude of the second order intramolecular correlation correction to the Coulomb energy showed that electron correlation reduces the contribution of the electrostatic term to the attractive interaction for the A-T and G-C base pairs. Polarization, charge transfer and dispersion interactions also make considerable contribution to the attraction energy of bases.     

Hydrogen Bond Equilibrium Constants of Some Unusual Nucleotide Base Pairs

Abstract

Approximate hydrogen bond association constants were determined for base pairs formed by an adenine derivative and a number of unusual pyrimidine bases. A series is found in which the H-bond strength in the base-pairs varies. In certain cases the H-bond equilibrium constant is larger than in the adenine-thymine pair. Inosine derivatives seem to have a non-negligible chance of replacing guanosine in the guanosine-cytosine pair. Infrared, near-infrared (overtone) and NMR spectra were used to determine the equilibrium constants.     

Probing the nature of hydrogen bonds in DNA base pairs

Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler–London, polarization, electron-transfer and dispersion-energy terms, where the Heitler–London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson–Crick adenine–thymine (AT), guanine–cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (−25.4 kcal mol⁻¹ at the MP2/6-31G** level) twice that of the AT (−12.4 kcal mol⁻¹) and H-AT (−12.8 kcal mol⁻¹) pairs, compared with three conventional N-H···O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the π-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that π-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology “resonance-assisted hydrogen bonding (RHAB)” may be replaced with “resonance-assisted binding” which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds. Figure Electron density difference (EDD) maps for the GC pair: a shows the polarization effect (isodensity 1.2×10⁻³ a.u.); b shows the charge transfer effect (isodensity 2×10⁻⁴ a.u.) Dedicated to Professor Paul von Ragué Schleyer on the occasion of his 75th birthday     

Alteration of the groove width of DNA induced by the multimodal hydrogen bonding of denaturants with DNA bases in its grooves affects their stability

BackgroundDenaturants, namely, urea and guanidinium chloride (GdmCl) affect the stability as well as structure of DNA. Critical assessment of the role of hydrogen bonding of these denaturants with the different regions of DNA is essential in terms of its stability and structural aspect. However, the understanding of the mechanistic aspects of structural change of DNA induced by the denaturants is not yet well understood.MethodsIn this study, various spectroscopic along with molecular dynamics (MD) simulation techniques were employed to understand the role of hydrogen bonding of these denaturants with DNA bases in their stability and structural change.Results and conclusionIt has been found that both, GdmCl and urea intrude into groove region of DNA by striping surrounding water. The hydrogen bonding pattern of Gdm⁺ and urea with DNA bases in its groove region is multimodal and distinctly different from each other. The interaction of GdmCl with DNA is stabilized by electrostatic interaction whereas electrostatic and Lennard-Jones interactions both contribute for urea. Gdm⁺ forms direct hydrogen bond with the bases in the minor groove of DNA whereas direct and water assisted hydrogen bond takes place with urea. The hydrogen bond formed between Gdm⁺ with bases in the groove region of DNA is stronger than urea due to strong electrostatic interaction along with less self-aggregation of Gdm⁺ than urea. The distinct hydrogen bonding capability of Gdm⁺ and urea with DNA bases in its groove region affects its width differently. The interaction of Gdm⁺ decreases the width of the minor and major groove which probably increases the strength of hydrogen bond between the Watson-Crick base pairs of DNA leading to its stability. In contrast, the interaction of urea does not affect much to the width of the grooves except the marginal increase in the minor groove width which probably decreases the strength of hydrogen bond between Watson Crick base pairs leading to the destabilization of DNA.General significanceOur study clearly depicts the role of hydrogen bonding between DNA bases and denaturants in their stability and structural change which can be used further for designing of the guanidinium based drug molecules.     

Ab-inito Quantum Mechanical Calculations of NMR Chemical Shifts in Nucleic Acids Constituents II Conformational Dependence of the lH and 13C Chemical Shifts in the Ribose

Abstract

The magnetic shielding constant of the different ¹³C and ¹³H nuclei of a deoxyribose are calculated for the C2′ endo and C3′ endo puckerings of the furanose ring as a function of the conformation about the C4′C5′ bond. For the carbons the calculated variations are of several ppm, the C3′ endo puckering corresponding in most cases to a larger shielding than the C2′ endo one. For the protons the calculated variations of chemical shifts are all smaller than 1.3 ppm, that is of the order of magnitude of the variation of the geometrical shielding produced on these protons by the other units of a DNA double helix, with a change of the overall structure of the helix. The computations carried out on the deoxyribose ?3′ and 5′ phosphates for several conformations of the phosphate group tend to show that the changes of conformation of the charged group of atoms produce chemical shift variations smaller than the two conformational parameters of the deoxyribose itself. The calculations carried out for a ribose do give the general features of the differences between the carbon and proton spectra of deoxynucleosides and nucleosides.

The comparison of the measured and calculated phosphorylation shifts tend to show that the counterion contributes significantly, for some nuclei of the deoxyribose, to the shifts measured. The calculated magnitude of this polarization effect on carbon shifts suggests a tentative qualitative interpretation of carbon spectra of the ribose part of DNA double helices.     

Effect of Flanking Residues on CA and AA Dinucleotides: Some Rationale

Abstract

Effect of flanking base pairs on CA and AA dinluceotide step-geometry has been studied using molecular dynamics method. Sixteen dodecameric sequences are constructed for each doublet with all possible bases at their 5′ and 3′ positions along with their complementary sequences. Structural parameter, formation of Extra Watson Crick bifurcated hydrogen bonds along or across the strands and effect of sodium ions are studied for these sequences. It is found that geometry of CA doublet step is perturbed by the neighboring base pairs, which might be due to inherent flexibility of the step. Flexible character of CA step is reflected in its low bifurcated hydrogen bond formation capability and lower preference of sodium ions to enter in minor or major grooves. AA step on the other hand is quite rigid according to different structural parameters and respond much less to environmental changes due to formation of strong Extra Watson-Crick hydrogen bonds.     

Quantum Chemical Studies of Structures and Binding in Noncanonical RNA Base pairs: The Trans Watson-Crick:Watson-Crick Family

Abstract

The trans Watson-Crick/Watson-Crick family of base pairs represent a geometric class that play important structural and possible functional roles in the ribosome, tRNA, and other functional RNA molecules. They nucleate base triplets and quartets, participate as loop closing terminal base pairs in hair pin motifs and are also responsible for several tertiary interactions that enable sequentially distant regions to interact with each other in RNA molecules. Eleven representative examples spanning nine systems belonging to this geometric family of RNA base pairs, having widely different occurrence statistics in the PDB database, were studied at the HF/6–31G (d, p) level using Morokuma decomposition, Atoms in Molecules as well as Natural Bond Orbital methods in the optimized gas phase geometries and in their crystal structure geometries, respectively. The BSSE and deformation energy corrected interaction energy values for the optimized geometries are compared with the corresponding values in the crystal geometries of the base pairs. For non protonated base pairs in their optimized geometry, these values ranged from ?8.19 kcal/mol to ?21.84 kcal/mol and compared favorably with those of canonical base pairs. The interaction energies of these base pairs, in their respective crystal geometries, were, however, lesser to varying extents and in one case, that of A:A W:W trans, it was actually found to be positive. The variation in RMSD between the two geometries was also large and ranged from 0.32–2.19 Å. Our analysis shows that the hydrogen bonding characteristics and interaction energies obtained, correlated with the nature and type of hydrogen bonds between base pairs; but the occurrence frequencies, interaction energies, and geometric variabilities were conspicuous by the absence of any apparent correlation. Instead, the nature of local interaction energy hyperspace of different base pairs as inferred from the degree of their respective geometric variability could be correlated with the identities of free and bound hydrogen bond donor/acceptor groups present in interacting bases in conjunction with their tertiary and neighboring group interaction potentials in the global context. It also suggests that the concept of isostericity alone may not always determine covariation potentials for base pairs, particularly for those which may be important for RNA dynamics. These considerations are more important than the absolute values of the interaction energies in their respective optimized geometries in rationalizing their occurrences in functional RNAs. They highlight the importance of revising some of the existing DNA based structure analysis approaches and may have significant implications for RNA structure and dynamics, especially in the context of structure prediction algorithms.     

Hydrogen Bond Equilibrium Constants for the Complexes of Benzotriazole and some Nucleoside Derivatives. A Near Infrared Study

Abstract

Approximate hydrogen bond association constants were determined by near infrared spectroscopy for pairs formed by benzotriazole and a number of nucleoside derivatives.

The molecule of benzotriazole forms, in chloroform, hydrogen bonds with inosine, uridine and adenosine derivatives.

The order of decreasing association constants for complexes formed by benzotriazole and uridine or inosine derivatives is the opposite of the one observed for pairs formed by adenosine and uridine or inosine derivatives.     

Polarization Force Fields for Peptides Implemented in ECEPP2 and MM2

Abstract

The empirical conformational energy program for peptides (ECEPP2) and molecular mechanics (MM2) have been used for the simulation of the For-Gly-NH₂ backbone. I propose two different methods for the calculation of the polarization energy term: the polarization procedure by non-interacting induced dipoles (NID) which assumes scalar isotropic point polarizabilities and the polarization scheme by interacting induced dipoles (ID) which calculates tensor effective anisotropic point polarizabilities (method of Applequist). I present a comparative study of ECEPP2 and MM2 + polarization. I discuss molecular mechanics results including the total energy differences, partitional analyses of the total steric energies and torsion dihedral angles. The γ global and the α, β and Δ local minima are stabilized by intramolecular hydrogen bonds. Although ECEPP2-based calculations rather under or over-estimate the relative energy of some local minima, the ID polarization energy term represents a significant correction to the total relative energy.     

A Molecular Dynamics Simulation of a Polyamine-Induced Conformational Change of DNA. A Possible Mechanism for the B to Z Transition

Abstract

A 75ps molecular dynamics simulation has been performed on a fully solvated complex of spermine with the B DNA decamer (dGdC)₅ · (dGdC)₅. The simulation indicates a possible mechanism by which polyamines might induce the formation of a left-handed helix, the B to Z transition. Spermine was initially located in the major groove, hydrogen bonded to the helix. During the simulation the ligand migrates deeper into the DNA, maintaining strong hydrogen bonding to the central guanine bases and destroying the Watson-Crick base pairing with their respective cytosines. Significant rotation of these and other cytosine bases was observed, in part due to interactions of the helix with the aminopropyl chains of spermine. An intermediate B_II conformation might be of importance in this process.     

Conformational Analysis of Canonical 2-Deoxyribonucleotides. 1. Pyrimidine Nucleotides

Abstract

The molecular structure and relative stability of north and south conformers of 2′-deoxyribonucleotides containing pyrimidine nucleic acid bases (2′-deoxythymidilic (pdT), 2′- deoxycytidilic (pdC) acids and their mono- and dianions) have been obtained and analyzed at the DFT/B3LYP level using the standard 6–31G(d) basis set. We have revealed that, when the nucleobase moiety is incorporated into the nucleotides, it maintains a nonplanar and nonrigid conformation due to out-of-plane deformation of the amino group and pyrimidine ring. It has been demonstrated that an increase of negative charge of the phosphate group results in increase of amino group pyramidalization, discrimination between conformers with syn and anti orientation of base with respect to sugar, strengthening of intramolecular C-H…O hydrogen bonds leading to deformation and fixation of geometry of nucleotides, and weakening of phosphodiester bond. These results allow to make suggestions about sources of twist and buckle deformations of base pairs, mechanisms of repaire of DNA via change of base orientation, and conditions for breakage of the P-O bonds during hydrolysis.     

Interaction of glucosamine with uracil and thymine: a computational study

Noncovalent interactions are ubiquitous and have been well recognized in chemistry, biology and material science. Yet, there are still recurring controversies over their natures, due to the wide range of noncovalent interaction terms. In this Essay, we employed the Valence Bond (VB) methods to address two types of interactions which recently have drawn intensive attention, i.e., the halogen bonding and the CH???HC dihydrogen bonding. The VB methods have the advantage of interpreting molecular structures and properties in the term of electron-localized Lewis (resonance) states (structures), which thereby shed specific light on the alteration of the bonding patterns. Due to the electron localization nature of Lewis states, it is possible to define individually and measure both polarization and charge transfer effects which have different physical origins. We demonstrated that both the ab initio VB method and the block-localized wavefunction (BLW) method can provide consistent pictures for halogen bonding systems, where strong Lewis bases NH₃, H₂O and NMe₃ partake as the halogen bond acceptors, and the halogen bond donors include dihalogen molecules and XNO₂ (X?=?Cl, Br, I). Based on the structural, spectral, and energetic changes, we confirm the remarkable roles of charge transfer in these halogen bonding complexes. Although the weak C-H???H-C interactions in alkane dimers and graphane sheets are thought to involve dispersion only, we show that this term embeds delicate yet important charge transfer, bond reorganization and polarization interactions.

     

Characterisation of hydrogen bonding networks in RNAs via magic angle spinning solid state NMR spectroscopy

It is demonstrated that the spatial proximity of ¹H nuclei in hydrogen bonded base-pairs in RNAs can be conveniently mapped via magic angle spinning solid state NMR experiments involving proton spin diffusion driven chemical shift correlation of low gamma nuclei such as the imino and amino nitrogens of nucleic acid bases. As different canonical and non-canonical base-pairing schemes encountered in nucleic acids are characterised by topologically different networks of proton dipolar couplings, different base-pairing schemes lead to characteristic cross-peak intensity patterns in such correlation spectra. The method was employed in a study of a 100 kDa RNA composed of 97 CUG repeats, or (CUG)₉₇ that has been implicated in the neuromuscular disease myotonic dystrophy. ¹⁵N–¹⁵N chemical shift correlation studies confirm the presence of Watson–Crick GC base pairs in (CUG)₉₇.     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane     

Post Hartree-Fock studies of the canonical Watson-Crick DNA base pairs: molecular structure and the nature of stability

Gas-phase gradient optimization was carried out on the canonical Watson-Crick DNA base pairs using the second-order M?ller-Plesset perturbation method at the 6-31G(d) and 6-31G(d,p) basis sets. It is detected that full geometry optimization at the MP2 level leads to an intrinsically nonplanar propeller-twisted and buckled geometry of G-C and A-T base pairs; while HF and DFT methods predict perfect planar or almost planar geometry of the base pairs. Supposedly the nonplanarity of the pairs is caused by pyramidalization of the amino nitrogen atoms, which is underestimated by the HF and DFT methods. This justifies the importance of geometry optimization at the MP2 level for obtaining reliable prediction of the charge distribution, molecular dipole moments and geometrical structure of the base pairs. The Morokuma-Kitaura and the Reduced Variational Space methods of the decomposition for molecular HF interaction energies were used for investigation of the hydrogen bonding in the Watson-Crick base pairs. It is shown that the HF stability of the hydrogen-bonded DNA base pairs originates mainly from electrostatic interactions. At the same time, the calculated magnitude of the second order intramolecular correlation correction to the Coulomb energy showed that electron correlation reduces the contribution of the electrostatic term to the attractive interaction for the A-T and G-C base pairs. Polarization, charge transfer and dispersion interactions also make considerable contribution to the attraction energy of bases.     

Synthesis,protonation constants and biological activity determination of amino acid–salicylaldehyde-derived Schiff bases

Schiff bases represent a class of molecules widely studied for their importance in organic and coordination chemistry. Despite the large amount of studies on the chemical and biological properties of the Schiff bases, the different experimental conditions prevent a useful comparison to search for a correlation structure–activity. Moreover, literature is lacking in comprehensive data on the spectroscopic characterization of these compounds. For this reason, six Schiff bases, derived from salicylaldehyde and natural amino acids were fully characterized by nuclear magnetic resonance and infrared spectroscopy, and their aqueous solution equilibria, antiproliferative activity and DNA-binding activity were examined. All experimental conditions were kept constants to achieve comparable information and useful insights about their structure–activity correlation. The synthesized compounds showed DNA binding constants in the 10¹–10² M⁻¹ range, depending on the substituent present in the amino acid side-chain, and resulted devoid of significant cytotoxic activity against the different human tumor cell lines showing IC50 values higher than 100 µM.

     

Effects of bidentate coordination on the molecular properties rapta-C based complex using theoretical approach

In this work several quantum properties including the NEDA and QTAIM are computed on three models of rapta-C complexes using DFT with hybrid functional and basis set with ECP and without ECP. Several interesting correlations within the observed properties and also with the reported experimental behaviors of these complexes including their biological activities are presented. The study shows that the stability of the two complexes with bidentate ligands is associated with their high hydrogen bonding stability and existence of stronger non-covalent metal-ligand bonds. The energy decomposition analysis indicated that inter-atomic interactions in the three forms of rapta-C complexes and their stability are governed by the charge transfer term with significant contributions from polarization and electrostatic terms. The higher stability of complex 1 and 2 over 3 comes from the lower exchange repulsion and higher polarization contributions to their stability which agrees perfectly with the experimental observation. Our results provide insight into the nature of intramolecular forces that influence the structural stability of the three complexes.     

Observation of H-bond mediated 3hJH2H3 coupling constants across Watson-Crick AU base pairs in RNA

^3hJ_H2H3trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly ¹⁵N-labeled RNA oligonucleotides using a new ^2hJ_NN-HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing ^2hJ_NNcouplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. ^3hJ_H2H3coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large ¹J_H3N3coupling constants in the indirect dimension of the two-dimensional experiment. The ^3hJ_H2H3scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of ^3hJ_H2H3coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the ^3hJ_H2H3coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the ^3hJ_H2H3coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids.