Structure and conformation of the duplex consensus acceptor exon:intron junction d[(CpTpApCpApGpGpT). (ApCpCpTpGpTpApG)] deduced from high-field 1H-NMR of non-exchangeable and imino protons

The complementary consensus acceptor exon:intron junction d(ApCpCpTpGpTpApG) has been synthesized by a modified phosphotriester method. The non self-complementary octamer exists in the random coil form in aqueous buffer at 20 degrees C as evidenced by temperature variable 1H-NMR and NOE measurements. The non-exchangeable proton assignments were secured using a combination of techniques including two-dimensional COSY, NOESY and 1H-1H-INADEQUATE. The octamer was annealed with the primary consensus sequence d(CpTpApCpApGpGpT). Confirmation of complete duplex formation was confirmed by detection and assignment of imino protons in D2O:H2O mixtures. Assignment of the non-exchangeable proton signals in the duplex consensus junction was then secured by a combination of two-dimensional COSY correlations, NOESY and NOE experiments. Determination of individual vicinal coupling constants in the component deoxyribose moieties permitted deduction of the population of S conformations in this sequence. It is concluded that the consensus acceptor junction exists in solution in a conformation belonging to the B family, and that the bases are oriented anti. In addition the deoxyribose moieties in the 5' regions exist predominantly in the S form (2'endo-3'exo) whereas those residues on or adjacent to the junction on the primary strand show more N character (2'exo-3'endo). The contiguous bases A5-G6 (adjacent to the junction) and A15-G16 are stacked more closely than the other neighbor bases in this duplex sequence. These subtle structural and conformational differences in the exon:intron junction may serve as recognition signals for these critical sites in the genome.     

1H and 31P-NMR Assignments of the Non-exchangeable Protons of the Consensus Acceptor Exon: Intron Junction d(CpTpApCpApGpGpT)

Abstract

The consensus acceptor exon: intron junction d(CpTpApCpApGpGpT) has been synthesized by a modified phosphotriester method. The non-self complementary octamer exists in the single strand form in aqueous buffer at 20°C as evidenced by temperature variable ¹H-NMR and NOE measurements. The non-exchangeable proton assignments were secured using a combination of techniques including two-dimensional COSY, NOESY and the double quantum technique ¹H-¹H-INADEQUATE as well as inversion recovery T1 experiments. The new technique of ³¹P-¹H shift correlation is particularly valuable in removing certain ambiguities in the sugar proton assignments. Characteristic chemical shifts for the base protons which are determined by their immediate molecular environments are also useful in assignments. The consensus acceptor exon: intron junction adopts a random coil conformation in solution under the experimental conditions employed.     

1H and 31P-NMR assignments of the non-exchangeable protons of the consensus acceptor exon:intron junction d(CpTpApCpApGpGpT)

The consensus acceptor exon:intron junction d(CpTpApCpApGpGpT) has been synthesized by a modified phosphotriester method. The non-self complementary octamer exists in the single strand form in aqueous buffer at 20 degrees C as evidenced by temperature variable 1H-NMR and NOE measurements. The non-exchangeable proton assignments were secured using a combination of techniques including two-dimensional COSY, NOESY and the double quantum technique 1H-1H-INADEQUATE as well as inversion recovery T1 experiments. The new technique of 31P-1H shift correlation is particularly valuable in removing certain ambiguities in the sugar proton assignments. Characteristic chemical shifts for the base protons which are determined by their immediate molecular environments are also useful in assignments. The consensus acceptor exon:intron junction adopts a random coil conformation in solution under the experimental conditions employed.     

1H-NMR Assignments of the Non-exchangeable Protons of the Consensus Donor Exon:Intron Junction d(CpApGpGpTpApApGpT)

Abstract

The consensus donor exon:intron junction d(CpApGpGpTpApApGpT) has been synthesized by a modified phosphotriester method. The non-self-complementary nonamer has, in principle, only two G,C or four A,T points of self-recognition. The inference that it exists in the single strand form at 20°C was confirmed by temperature variable ¹H-NMR and NOE measurements. The proton assignments were secured using two-dimensional COSY which provided intra-nucleotide correlations, then NOE difference measurements as well as inversion recovery T₁ experiments. Systematic procedures were developed for the assignment of the individual bases and their component protons based on the effects of molecular environment on chemical shifts. These latter procedures should be useful for the assignment of other random-coil single strand oligodeoxyribonucleotides.     

Sequence Specific Molecular Recognition and Binding of a Monocationic Bis-Imidazole Lexitropsin to the Decadeoxyribonucleotide d-[(GATCCGTATG) (CATACGGATC)]: Structural and Dynamic Aspects of Intermolecular Exchange Studied by 1H-NMR

Abstract

The non-exchangeable and imino proton NMR resonances of the non self-complementary decadeoxyribonucleotide d-[(GATCCGTATG) · (GATACGGATC)] as well as those of the 1:1 complex of the monocatonic bis-imidazole lexitropsin 1 to this sequence have been assigned by using a combination of NOE difference, COSY and NOESY techniques. Confirmation of complete annealing of the two non self-complementary decamer strands to give the duplex decadeoxyribonucleotide is obtained by the detection of ten imino protons. It is established that the sugar-base orientations of all the bases in the duplex decamer are anti. From NOE studies, it is concluded that the duplex oligomer is right-handed and adopts a conformation in solution that belongs to the B family. A population analysis reveals that the sugar moieties exist predominantly in the S-form (2′-endo-3′-exo). Addition of 1 to the DNA solution leads to doubling of the resonances for CH6(4,5), GH8(6), TH6(7) and T-CH₃(7). The base, anomeric H1′ and imino proton signals for the base sequence 5′-CCGT undergo the most marked drug-induced chemical shift changes. These results provide evidence that the lexitropsin is bound to the sequence 5′-CCGT in the minor groove of the DNA NOE measurements between the amide protons (NH1 and NH4) and the imino proton (IV and V) signals confirmed the location and orientation of 1 in the 1:1 complex, with the amino terminus oriented to C(4). The specific binding of 1 to the sequence 5′-CCGT-3′ deduced in this study is in agreement with the footprinting data obtained using the Hind III/Nci I fragment from pBR322 DNA [Kissinger et al. 1987 (13)]. Intramolecular NOEs observed between H4 and H9 of the lexitropsin suggest that the molecule is not planar, but subjected to propeller twisting, in both the free and bound forms. Furthermore, NOE measurements permit assignment of the DNA duplex in the 1:1 complex to the B-form, which is similar to that of the free DNA The [(T₇A₈T₉)· (A₁₂T₁₃A₁₄)] segment of the DNA shows better stacking, by propeller twisting, compared to the rest of the molecule in the free as well as the complex forms. The intermolecular rate of exchange of 1 between the equivalent 5′-CCGT sites, at a concentration of 12 mM, is estimated to be ～88s^?1 at 308°K with ΔG≠ of 63±5 K.J mol^?1.     

A Renaissance Man: In Memoriam of Jon Widom (1955–2011)

Abstract

Assignment of the ¹H and ³¹P resonances of a decamer DNA duplex, d(CGCTTAAGCG)₂ was determined by two-dimensional COSY, NOESY and ¹H- ³¹P Pure Absorption phase Constant time (PAC) heteronuclear correlation spectroscopy. The solution structure of the decamer was calculated by an iterative hybrid relaxation matrix method combined with NOESY-distance restrained molecular dynamics. The distances from the 2D NOESY spectra were calculated from the relaxation rate matrix which were evaluated from a hybrid NOESY volume matrix comprising elements from the experiment and those calculated from an initial structure. The hybrid matrix-derived distances were then used in a restrained molecular dynamics procedure to obtain a new structure that better approximates the NOESY spectra. The resulting partially refined structure was then used to calculate an improved theoretical NOESY volume matrix which is once again merged with the experimental matrix until refinement is complete. J_H3′-P coupling constants for each of the phosphates of the decamer were obtained from ¹H-³¹P J-resolved selective proton flip 2D spectra. By using a modified Karplus relationship the C4′-C3′-03′-P torsional angles (?) were obtained. Comparison of the ³¹P chemical shifts and J_H3′-P coupling constants of this sequence has allowed a greater insight into the various factors responsible for ³¹P chemical shift variations in oligonucleotides. It also provides an important probe of the sequence-dependent structural variation of the deoxyribose phosphate backbone of DNA in solution. These correlations are consistent with the hypothesis that changes in local helical structure perturb the deoxyribose phosphate backbone. The variation of the ³¹P chemical shift, and the degree of this variation from one base step to the next is proposed as a potential probe of local helical conformation within the DNA double helix. The pattern of calculated ? and ζ torsional angles from the restrained molecular dynamics refinement agrees quite well with the measured J_H3′-P coupling constants. Thus, the local helical parameters determine the length of the phosphodiester backbone which in turn constrains the phosphate in various allowed conformations.     

Sequence-dependent conformations of DNA duplexes: the TATA segment of the d(G-G-T-A-T-A-C-C) duplex in aqueous solution

The base and sugar protons of the d(G-G-T-A-T-A-C-C) duplex have been assigned from two-dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) measurements in D₂O solution at 25°C. The nucleic acid protons have been assigned from NOEs between protons on adjacent bases on the same and partner strands, as well as from NOEs between the base protons and their own and 5′-flanking H1′, H2′, H2″, H3′, and H4′ sugar protons. These assignments are confirmed from coupling constant and NOE connectivities within the sugar protons of a given residue. Several of these NOEs exhibit directionality and demonstrate that the d(G-G-T-A-T-A-C-C) duplex is a right-handed helix. The relative magnitude of the NOEs between the base protons and the sugar H2′ protons of its own and 5′-flanking sugar demonstrate that the TATA segment of the d(G-G-T-A-T-A-C-C) duplex adopts a B-DNA type helix geometry in solution, in contrast to the previous observation of a A-type helix for the same octanucleotide duplex in the crystalline state.     

1H-NMR assignments of the non-exchangeable protons of the consensus donor exon:intron junctioń d(CpApGpGpTpApApGpT)

The consensus donor exon:intron junction d(CpApGpGpTpApApGpT) has been synthesized by a modified phosphotriester method. The non-self-complementary nonamer has, in principle, only two G,C or four A,T points of self-recognition. The inference that it exists in the single strand form at 20 degrees C was confirmed by temperature variable 1H-NMR and NOE measurements. The proton assignments were secured using two-dimensional COSY which provided intra-nucleotide correlations, then NOE difference measurements as well as inversion recovery T1 experiments. Systematic procedures were developed for the assignment of the individual bases and their component protons based on the effects of molecular environment on chemical shifts. These latter procedures should be useful for the assignment of other random-coil single strand oligodeoxyribonucleotides.     

Conformational Analysis of a Hybrid DNA-RNA Double Helical Oligonucleotide in Aqueous Solution: d(CG)r(CG)d(CG) Studied by 1D- and 2D-1H NMR Spectroscopy

Abstract

The double helical structure of the self-complementary DNA-RNA-DNA hybrid d(CG)r(CG) d(CG) was studied in solution by 500 MHz ¹H-NMR spectroscopy. The non-exchangeable base protons and the (deoxy)ribose H1′, H2′ and H2″ protons were unambiguously assigned using 2D-J-correlated (COSY) and 2D-NOE (NOESY) spectroscopy techniques. A general strategy for the sequential assignment of ¹H-NMR spectra of (double) helical DNA and RNA fragments by means of 2D-NMR methods is presented.

Conformational analysis of the sugar rings of d(CG)r(CG)d(CG) at 300 K shows that the central ribonucleotide part of the helix adopts an A-type double helical conformation. The 5′- and 3′-terminal deoxyribose base pairs, however, take up the normal DNA-type conformation. The A-to-B transition in this molecule involves only one (deoxyribose) base pair. It is shown that this A-to-B conformational transition can only be accomodated by two specific sugar pucker combinations for the junction base pair, i.e. N·S (C3′-endo-C2′-endo, 60%, where the pucker given first is that assigned to the junction nucleotide residue of the strand running 5′ → 3′ from A-RNA to B-DNA) and S·S (C2′-endo-C2′-endo, 40%).     

Molecular dynamics simulations of xDNA

xDNA is a modified DNA, which contains natural as well as expanded bases. Expanded bases are generated by the addition of a benzene spacer to the natural bases. A set of AMBER force‐field parameters were derived for the expanded bases and the structural dynamics of the xDNA decamer ( xT5 ′ G xT A xC xG C xA xG T3′ ) · ( xA5′ C T xG C G xT A xC A3′) was explored using a 22 ns molecular dynamics simulation in explicit solvent. During the simulation, the duplex retained its Watson‐Crick base‐pairing and double helical structure, with deviations from the starting B‐form geometry towards A‐form; the deviations are mainly in the backbone torsion angles and in the helical parameters. The sugar pucker of the residues were distributed among a variety of modes; C2′ endo, C1′ exo, O4′ endo, C4′ exo, C2′ exo, and C3′ endo. The enhanced stacking interactions on account of the modification in the bases could help to retain the duplex nature of the helix with minor deviations from the ideal geometry. In our simulation, the xDNA showed a reduced minor groove width and an enlarged major groove width in comparison with the NMR structure. Both the grooves are larger than that of standard B‐DNA, but major groove width is larger than that of A‐DNA with almost equal minor groove width. The enlarged groove widths and the possibility of additional hydration in the grooves makes xDNA a potential molecule for various applications. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 351–360, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

An NMR study of the covalent and noncovalent interactions of CC-1065 and DNA

The binding of the antitumor drug CC-1065 has been studied with nuclear magnetic resonance (NMR) spectroscopy. This study involves two parts, the elucidation of the covalent binding site of the drug to DNA and a detailed investigation of the noncovalent interactions of CC-1065 with a DNA fragment through analysis of 2D NOE (NOESY) experiments. A CC-1065-DNA adduct was prepared, and an adenine adduct was released upon heating. NMR (1H and 13C) analysis of the adduct shows that the drug binds to N3 of adenine by reaction of its cyclopropyl group. The reaction pathway and product formed were determined by analysis of the 13C DEPT spectra. An octamer duplex, d(CGATTAGC.GCTAATCG), was synthesized and used in the interaction study of CC-1065 and the oligomer. The duplex and the drug-octamer complex were both analyzed by 2D spectroscopy (COSY, NOESY). The relative intensity of the NOEs observed between the drug (CC-1065) and the octamer duplex shows conclusively that the drug is located in the minor groove, covalently attached to N3 of adenine 6 and positioned from the 3'----5' end in relation to strand A [d(CGATTA6GC)]. A mechanism for drug binding and stabilization can be inferred from the NOE data and model-building studies.     

Complete assignment of signals in 1D and 2D H-NMR spectra of a 17-member oligonucleotide, a model symmetrical analog of lambda operators

A synthetic analog of lambda phage operators, a symmetric duplex of oligonucleotides, was studied by 1H NMR at 400 MHz. Signals in the spectrum of imino protons of the duplex in H2O were assigned based on the results of NOE experiments and temperature dependences. Resonance assignment of the non-exchangeable protons of bases and deoxyribose was performed by analysing the NOESY spectrum obtained in the single experiment. The results indicate that the major part of the duplex has a conformation similar to the B-form of DNA, and the region of the central non-complementary base pair exhibits deviations from the regular structure.     

The nature of stabilization of the tandem DNA duplex pTGGAGCTG · (pCAGC+(Phn-NH-(CH2)3-NH)pTCCA) basing on the UV, CD, and two-dimensional NMR spectroscopy data

The properties and the three-dimensional structure of the tandem DNA duplex pTGGAGCTG·(pCAGC+(PhnL)pTCCA) in aqueous solution, where L is an amino linker and Phn is anN-(2-hydroxyethyl)phenazinium residue, were studied spectrophotometrically and by two-dimensional¹H NMR spectroscopy (COSY and NOESY). When a tandem complex involving a Phn residue-bearing oligonucleotide is formed, the dye aromatic system intercalates into the double helix at the nick site and takes part in two stacking interactions: a strong one (3.5–4 Å) with the T⁵-A¹² base pair of its own duplex moiety and a weak one (4–5 Å) with the C⁴-G¹³ pair of the adjoining duplex (mainly with the C⁴ base). This arrangement of the dye residue, providing a cross-interaction of the phenazinium moiety with the base pairs of the adjacent duplex structures, results in the stabilization of the whole tandem complex.     

alpha-DNA-V. Parallel annealing, handedness and conformation of the duplex of the unnatural alpha-hexadeoxyribonucleotide alpha-[d(CpApTpGpCpG)] with its beta-complement beta-[d(GpTpApCpGpC)] deduced from high field 1H-NMR.

The beta-complementary hexamer, beta-d[GTACGC], to the alpha-sequence, alpha-d[CATGCG], was synthesized by the phosphotriester method. The non-exchangeable proton assignments were obtained using 1D- and 2D-NMR techniques, including NOE, COSY and NOESY. The beta-strand exists as a random coil at 21 degrees C; however, at 4 degrees C, it forms an antiparallel self-recognition duplex annealing at positions 1-4. The beta-strand was annealed to the alpha-strand, and confirmation of complete annealing was obtained by detection and assignment of the six base pair imino protons in H2O/D2O solution at 21 degrees C. 1D-NOE experiments of the alpha, beta duplex d[alpha-(CATGCG) X beta-(GTACGC)] reveal that (i) it exists in aqueous solution in a conformation that belongs to the B family, (ii) it is 70 +/- 10% right-handed, (iii) the sugar-base orientations of the beta-strand are anti, and the deoxyribose units exist predominantly in the 2'-endo-3'-exo conformation. NOE measurements of the imino proton signals in the alpha, beta duplex reveal that the duplex exhibits parallel polarity.     

The Effect of Crystal Packing on Oligonucleotide Double Helix Structure

Abstract

Complexes formed between Actinomycin D (ActD) and the tetranucleotides d(AGCT)2 and d(CGCG)₂ were studied in detail by one and two-dimensional ¹H and ³¹P NMR. The ³¹P two dimensional chemical exchange experiment, at room temperature on saturated complexes (1:1), showed unambiguously that the asymmetrical phenoxazone ring binds to the unique GC site under the two possible orientations in the d(AGCT)₂ tetranucleotide but adopts a single orientation in the d(CGCG)₂ tetranucleotide. For the d(CGCG)₂: Act D saturated complex, complete assignments of all protons and phosphorus signals of the two-nucleotide strands, as well as of the two cyclic pentapeptide chains has allowed us to study in details the conformational features of the complex from NOE and coupling constants analysis. The tetranucleotide remains in a right-handed duplex, but the sugar puckers are modified for residues at the intercalation site. A uniform C_2′ endo pucker is observed for residues on the strand facing the quinoid side of the phenoxazone ring while a C_2′ endo-C_3′ endo equilibrium about 60% of C_2′ endo is proposed for the two residues on the strand facing the benzenoid side of the phenoxazone ring. In contrast to previous studies on ActD-DNA interactions, we have been able to measure the ³J phosphorus-proton coupling constants at the intercalation site but also adjacent to it, showing that ³¹P chemical shifts are not simply related to the backbone conformation. Molecular mechanics calculations, using empirical distances deduced from NOE effects as restrained distances during minimizations, led to a model differing mainly from those previously published by orientation of the N methyl groups of both N-Methyl-Valines.     

Structure and Conformation of the Branch Core Triribonucleotide Containing 2′-5′ and 3′-5′ Phosphodiester Linkages (A2′p5′G 3′p5′C) in Solution,Essential for Yeast mRNA Splicing,Deduced from 1H-NMR

Abstract

The non-exchangeable ¹H-NMR signals of the branch core trinucleotide of the lariat branch site (A^2′p5′G _3′p5′C), 1) and its derivatives 2 and 3 are completely assigned using one- and two- dimensional NMR techniques including NOE, COSY, NOESY, ¹H-¹HINADEQUATE and 2D-J-resolved spectroscopy. From the vicinal coupling constants in the individual ribose rings, NOE data and T₁ measurements, the following properties of the trimers are deduced.(i)The unique stacking behavior of the trimers is S^1′N _3′N, and the sugar rings exist predominantly in the N-conformation (3′-endo-2′-exo).(ii)The sugar-base orientations appear to be anti.(iii) The branched trimers exist in solution as single-stranded right-handed conformations resembling A-RNA with stacking between the adenine and guanine residues in aqueous solution at 21°C and pH 7.2.(iv) The calculated values for the torsion angles ε^t andγ⁺ for the trimers are 201–203° and 71–86%, respectively, while the percent β¹ values are higher for the guanine (87–92%) than the cytosine residues (73–77%). The computer generated depiction of the triribonucleotide 1 is also shown. These subtle structural features may act as recognition signals for this critical lariat branch site which is essential for the second step in yeast mRNA splicing.     

OR3 operator of bacteriophage λ in a 23 base-pair DNA fragment: Sequence-specific 1H NMR assignments for the non-labile protons and comparison with the isolated 17 base-pair operator

Sequence-specific ¹H NMR assignments are presented for a non-selfcomplementary 23-base-pair DNA duplex of molecular weight 15,000 daltons, containing the O_R3 repressor binding site of bacteriophage as the central core. The NMR techniques used were mainly phase-sensitive two-dimensional NOE and 2Q spectroscopy, the latter to overcome overlap problems within the spectral region of the deoxyribose spin-systems. Direct sequential NOE connectivities are observed between adenine 2H and deoxyribose 1 protons. We propose the use of these connectivities as a check of the assignments of C1 and A2 protons, which have independently been derived via other assignment pathways.Abbreviation COSY 2-dimensional correlated spectroscopy - NOESY 2-dimensional nuclear-Overhauser-enhancement spectroscopy - RELAYED-COSY 2-dimensional relayed coherence transfer spectroscopy - 2Q two-quantum - ppm parts per million - 23-bp DNA d-(ATCTATCACCGCAAGGGATAAAT) · d-(ATTTATCCCTTGCGGTGATAGAT) - 17-bp DNA (O_R3) d-(TATCACCGCAAGGGATA) · d-(TATCCCTTGCGGTGATA) - d_i(X;Y) intra-residue distance between protons X and Y - d_s(X;Y) sequential distance between protons X and Y located in sequentially neighbouring nucleotides, where the direction from X to Y is always from 5 to 3     

Ab-inito Quantum Mechanical Calculations of NMR Chemical Shifts in Nucleic Acids Constituents II Conformational Dependence of the lH and 13C Chemical Shifts in the Ribose

Abstract

The magnetic shielding constant of the different ¹³C and ¹³H nuclei of a deoxyribose are calculated for the C2′ endo and C3′ endo puckerings of the furanose ring as a function of the conformation about the C4′C5′ bond. For the carbons the calculated variations are of several ppm, the C3′ endo puckering corresponding in most cases to a larger shielding than the C2′ endo one. For the protons the calculated variations of chemical shifts are all smaller than 1.3 ppm, that is of the order of magnitude of the variation of the geometrical shielding produced on these protons by the other units of a DNA double helix, with a change of the overall structure of the helix. The computations carried out on the deoxyribose ?3′ and 5′ phosphates for several conformations of the phosphate group tend to show that the changes of conformation of the charged group of atoms produce chemical shift variations smaller than the two conformational parameters of the deoxyribose itself. The calculations carried out for a ribose do give the general features of the differences between the carbon and proton spectra of deoxynucleosides and nucleosides.

The comparison of the measured and calculated phosphorylation shifts tend to show that the counterion contributes significantly, for some nuclei of the deoxyribose, to the shifts measured. The calculated magnitude of this polarization effect on carbon shifts suggests a tentative qualitative interpretation of carbon spectra of the ribose part of DNA double helices.