In search of a Hoogsteen base paired DNA duplex in aqueous solution

When the oligodeoxynucleotides d(A)6 and d(T)6 are mixed together in a 1:1 ratio (in 100 mM NaCl), the NH signals in the NMR spectrum gave a typical signature of Watson-Crick paired (WC) and Hoogsteen paired (H) AT base pairs. The observation indicates two schemes: Scheme I, WC and H duplexes in slow equilibrium, i.e., WC in equilibrium with H, Scheme II, the WC helix formed is unstable and that it disproportionates into a triple helix (TR) and free d(A)6. We show that (i) addition of extra d(A)6 does not change the helix composition, (ii) addition of a minor-groove specific drug Dst2 (a distamycin analogue) results in an exclusive WC helix-drug duplex, while it does not destabilize triple helix in a 1:2 mixture. In addition we have compared the melting profile, 31P NMR spectra, 1H NMR spectra and the salt dependence of the 1:1 mixture and that of a pure triple helix. All the data from the above experiments overwhelmingly favor Scheme I. However Scheme II cannot be categorically excluded. Based on 1D/2D NMR studies, we have characterized the structural properties of the Hoogsteen double helix in terms of nucleotide conformations. In addition, we computationally demonstrate that the relative stability of the WC over the H duplexes increases with increasing chain length.     

Atomic structures of excited state A–T Hoogsteen base pairs in duplex DNA by combining NMR relaxation dispersion,mutagenesis, and chemical shift calculations

NMR relaxation dispersion studies indicate that in canonical duplex DNA, Watson–Crick base pairs (bps) exist in dynamic equilibrium with short-lived low abundance excited state Hoogsteen bps. N1-methylated adenine (m¹A) and guanine (m¹G) are naturally occurring forms of damage that stabilize Hoogsteen bps in duplex DNA. NMR dynamic ensembles of DNA duplexes with m¹A–T Hoogsteen bps reveal significant changes in sugar pucker and backbone angles in and around the Hoogsteen bp, as well as kinking of the duplex towards the major groove. Whether these structural changes also occur upon forming excited state Hoogsteen bps in unmodified duplexes remains to be established because prior relaxation dispersion probes provided limited information regarding the sugar-backbone conformation. Here, we demonstrate measurements of C3′ and C4′ spin relaxation in the rotating frame (R1ρ) in uniformly ¹³C/¹⁵N labeled DNA as sensitive probes of the sugar-backbone conformation in DNA excited states. The chemical shifts, combined with structure-based predictions using an automated fragmentation quantum mechanics/molecular mechanics method, show that the dynamic ensemble of DNA duplexes containing m¹A–T Hoogsteen bps accurately model the excited state Hoogsteen conformation in two different sequence contexts. Formation of excited state A–T Hoogsteen bps is accompanied by changes in sugar-backbone conformation that allow the flipped syn adenine to form hydrogen-bonds with its partner thymine and this in turn results in overall kinking of the DNA toward the major groove. Results support the assignment of Hoogsteen bps as the excited state observed in canonical duplex DNA, provide an atomic view of DNA dynamics linked to formation of Hoogsteen bps, and lay the groundwork for a potentially general strategy for solving structures of nucleic acid excited states.     

Structural features and stability of an RNA triple helix in solution.

A 30 nt RNA with a sequence designed to form an intramolecular triple helix was analyzed by one-and two-dimensional NMR spectroscopy and UV absorption measurements. NMR data show that the RNA contains seven pyrimidine-purine-pyrimidine base triples stabilized by Watson-Crick and Hoogsteen interactions. The temperature dependence of the imino proton resonances, as well as UV absorption data, indicate that the triple helix is highly stable at acidic pH, melting in a single sharp transition centered at 62 degrees C at pH 4.3. The Watson-Crick and Hoogsteen pairings are disrupted simultaneously upon melting. The NMR data are consistent with a structural model where the Watson-Crick paired strands form an A-helix. Results of model building, guided by NMR data, suggest a possible hydrogen bond between the 2' hydroxyl proton of the Hoogsteen strand and a phosphate oxygen of the purine strand. The structural model is discussed in terms of its ability to account for some of the differences in stability reported for RNA and DNA triple helices and provides insight into features that are likely to be important in the design of RNA binding compounds.     

The role of molecular structure of sugar‐phosphate backbone and nucleic acid bases in the formation of single‐stranded and double‐stranded DNA structures

Our previous DFT computations of deoxydinucleoside monophosphate complexes with Na⁺‐ions (dDMPs) have demonstrated that the main characteristics of Watson‐Crick (WC) right‐handed duplex families are predefined in the local energy minima of dDMPs. In this work, we study the mechanisms of contribution of chemically monotonous sugar‐phosphate backbone and the bases into the double helix irregularity. Geometry optimization of sugar‐phosphate backbone produces energy minima matching the WC DNA conformations. Studying the conformational variability of dDMPs in response to sequence permutation, we found that simple replacement of bases in the previously fully optimized dDMPs, e.g. by constructing Pyr‐Pur from Pur‐Pyr, and Pur‐Pyr from Pyr‐Pur sequences, while retaining the backbone geometry, automatically produces the mutual base position characteristic of the target sequence. Based on that, we infer that the directionality and the preferable regions of the sugar‐phosphate torsions, combined with the difference of purines from pyrimidines in ring shape, determines the sequence dependence of the structure of WC DNA. No such sequence dependence exists in dDMPs corresponding to other DNA conformations (e.g., Z‐family and Hoogsteen duplexes). Unlike other duplexes, WC helix is unique by its ability to match the local energy minima of the free single strand to the preferable conformations of the duplex. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 640–650, 2014.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

The First Example of a Hoogsteen Basepaired DNA Duplex in Dynamic Equilibrium with a Watson-Crick Basepaired Duplex—A Structural (NMR), Kinetic and Thermodynamic Study

Abstract

A single-point substitution of the O4′ oxygen by a CH₂ group at the sugar residue of A ⁶ (i.e. 2′-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5′- d(C¹G²C³G⁴A⁵A⁶T⁷T⁸C⁹G¹⁰C¹¹G¹²)₂ ^?3, has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A ⁶:T⁷ Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)→←(1B): K_eq = k₁/k_-1 = 0.56±0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k₁ (298K) = 3.9± 0.8 sec^?1; δH°? = 164±14 kJ/mol;-TδS°? (298K) = ?92 kJ/mol giving a δG₂₉₈°? of 72 kJ/mol. Ea (k1) = 167±14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0±0.6 sec-1, δH°? = 153±13 kJ/mol;-TδS°? (298K) = ?82 kJ/mol giving a δG₂₉₈°? of 71 kJ/mol. Ea (k-1) = 155±13 kJ/mol]. A comparison of δG₂₉₈°? of the forward (k1) and backward (k-1) conversions, (1A)→←(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A ⁶:T⁷ Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A ⁶:T⁷ basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2′- deoxyaristeromycin moiety, A ⁶, as a result of substitution of the endocyclic 4′-oxygen in the natural sugar with a methylene group in A ⁶. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in α, σ and γ torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.     

Structure-Function Relationship of Three Triple-Helical Nucleic Acids

Abstract

The nucleic acid triplexes poly d(T)·poly d(A)·poly d(T), poly (U)·poly (A)·poly (U), and poly (I)·poly (A)·poly (I) display a sort of continuity between each other. However, their morphologies present their own individuality which, considering those of their parent duplexes, are quite unexpected. This comparison helps to understand triplex structure-function relationship. While helical parameters are functions of the sugar pucker, low values of WC and Hoogsteen base-pair propellers is commonplace for triplexes and the Hoogsteen base-pair geometry monitors the effects of the interstrand phosphates charge-charge repulsion.

Synopsis

The nucleic acid triplexes poly d(T)·poly d(A)·poly d(T), poly(U)·poly(A)·poly(U), and poly (I)·poly (A)·poly (I) present distinct morphologies. Considering those of their parent duplexes, they are also quite unexpected.     

Proton NMR studies of 5'-d-(TC)(3) (CT)(3) (AG)(3)-3'--a paperclip triplex: the structural relevance of turns

In this study, we present the results of structural analysis of an 18-mer DNA 5'-T(1)C(2)T(3)C(4)T(5)C(6)C(7)T(8)C(9)T(10)C(11)T(12)A(13)G(14)A(15)G(16)A(17)G(18)-3' by proton nuclear magnetic resonance (NMR) spectroscopy and molecular modeling. The NMR data are consistent with characteristics for triple helical structures of DNA: downfield shifting of resonance signals, typical for the H3(+) resonances of Hoogsteen-paired cytosines; pH dependence of these H3(+) resonance; and observed nuclear Overhauser effects consistent with Hoogsteen and Watson-Crick basepairing. A three-dimensional model for the triplex is developed based on data obtained from two-dimensional NMR studies and molecular modeling. We find that this DNA forms an intramolecular "paperclip" pyrimidine-purine-pyrimidine triple helix. The central triads resemble typical Hoogsteen and Watson-Crick basepairing. The triads at each end region can be viewed as hairpin turns stabilized by a third base. One of these turns is comprised of a hairpin turn in the Watson-Crick basepairing portion of the 18-mer with the third base coming from the Hoogsteen pairing strand. The other turn is comprised of two bases from the continuous pyrimidine portion of the 18-mer, stabilized by a hydrogen-bond from a purine. This "triad" has well defined structure as indicated by the number of nuclear Overhauser effects and is shown to play a critical role in stabilizing triplex formation of the internal triads.     

Self-organisation of an oligodeoxynucleotide containing the G- and C-rich stretches of the direct repeats of the human mitochondrial DNA

Stretches of cytosines and guanosines have been shown in vitro to adopt non-canonical structures known as i-motifs and G-quartets, respectively. When combined, such sequences are expected to either retain their structure or form duplexes or triple helices. All these structures may occur in vivo whenever the sequence criteria are met. Such stretches are present in the circular genome of human mitochondria, as two 10 nucleotide-long perfect tandem direct repeats (DR1 and DR2). The DR1 and DR2 repeats are G-rich on the heavy strand and C-rich on the light strand. Previous results suggested that during replication, transient formation of a parallel GGC triple helix between the neo-synthesised G-rich DR1 and the double-stranded homologous DR2 could be involved in a rearrangement process leading to genome instability. In order to get structural insights into the interaction between the two repeats, we have studied by nuclear magnetic resonance (NMR) the assembly properties of a 24-mer oligodeoxyribonucleotide in which the C- and G-rich segments of the DRs are covalently tethered by a TTTT linker. We show here that this 24-mer self-associates into a triplex-containing symmetrical tetramer. The core of the structure is composed of anti-parallel Watson-Crick (WC) base pairs. Two additional strands are hydrogen-bonded to the Hoogsteen side of the Gs, thus forming CGC(+) triple helices, with G-rich ends folding into G-quartets. These results suggest that such structures could occur when the two DRs are put to close proximity in a biological context.     

NMR structure of a parallel-stranded DNA duplex at atomic resolution

DNA dodecamers have been designed with two cytosines on each end and intervening A and T stretches, such that the oligomers have fully complementary A:T base pairs when aligned in the parallel orientation. Spectroscopic (UV, CD and IR), NMR and molecular dynamics studies have shown that oligomers having the sequences d(CCATAATTTACC) and d(CCTATTAAATCC) form a parallel-stranded duplex when dissolved at 1:1 stoichiometry in aqueous solution. This is due to the C:C⁺ clamps on either end and extensive mismatches in the antiparallel orientation. The structure is stable at neutral and acidic pH. At higher temperatures, the duplex melts into single strands in a highly cooperative fashion. All adenine, cytosine and thymine nucleotides adopt the anti conformation with respect to the glycosidic bond. The A:T base pairs form reverse Watson–Crick base pairs. The duplex shows base stacking and NOEs between the base protons T(H6)/A(H8) and the sugar protons (H1′/H2′/H2″) of the preceding nucleotide, as has been observed in antiparallel duplexes. However, no NOEs are observed between base protons H2/H6/H8 of sequential nucleotides, though such NOEs are observed between T(CH₃) and A(H8). A three-dimensional structure of the parallel-stranded duplex at atomic resolution has been obtained using molecular dynamics simulations under NMR constraints. The simulated structures have torsional angles very similar to those found in B-DNA duplexes, but the base stacking and helicoid parameters are significantly different.     

Comparison of the solution structures of intramolecular DNA triple helices containing adjacent and non-adjacent CG.C+ triplets.

The solution conformations of the intramolecular triple helices d(AGAAGA-X-TCTTCT-X-TC+TTC+T) and d(AAGGAA-X-TTCCTT-X-TTC+C+TT) (X = non-nucleotide linker) have been determined by NMR.1H NMR spectra in H2O showed that the third strand cytosine residues are fully paired with the guanine residues, each using two Hoogsteen hydrogen bonds. Determination of the13C chemical shifts of the cytosine C6 and C5 and their one-bond coupling constants (1 J CH) conclusively showed that the Hoogsteen cytosine residues are protonated at N3. The global conformations of the two molecules determined with >19 restraints per residue are very similar (RMSD = 0.96 A). However, some differences in local conformation and dynamics were observed for the central two base triplets of the two molecules. The C N3H were less labile in adjacent CG.C+triplets than in non-adjacent ones, indicating that the adjacent charge does not kinetically destabilize these triplets. The sugar conformations of the two adjacent cytosine residues were different and the 5'-residue was atypical of protonated cytosine. Hence, there are subtle effects of the interaction between two adjacent cytosine residues. The central two purines in each sequence showed non-standard backbone conformations, averaging between gamma approximately 60 degrees and gamma approximately 180 degrees. This may be related to the difference in the dependence of the thermodynamic stability on pH observed for these two sequences.     

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.     

A Single Carbocyclic Nucleotide Substitution in a 12mer DNA Gives a Hoogsteen Basepaired Duplex (Till 38°C) and a Hairpin (Till 65°C). A 600 MHz NMR Spectroscopic Study

Abstract

The impact of intramolecular stereoelectronic effects has been examined by comparison of the solution structures of natural oligo-DNA duplex, 5′(¹C²G³C⁴G⁵A⁶A⁷T⁸T⁹C¹⁰G¹¹C¹²G)₂ ³′, and its carbocyclic-nucleotide analogues in which the pentose sugar in 2′-dA residue is replaced with its carbocyclic counterpart (i.e. 2′-deoxyaristeromycin). Based on the NMR evidences, it has been shown, that 2′-deoxyaristeromycin analog exists in a dynamic equilibrium between the two forms of duplexes, one with W-C bp and the second with Hoogsteen bp in ca 1:1 ratio at lower temperature (below 35°C) and as hairpin at higher temperature (from ～40° – 60°C).     

Sequence and conformational effects on imino proton exchange in A.T- and A.U-containing DNA and RNA duplexes

¹H-nmr relaxation has been used to study the effect of sequence and conformation on imino proton exchange in adenine–thymine (A · T) and adenine–uracil (A · U) containing DNA and RNA duplexes. At low temperature, relaxation is caused by dipolar interactions between the imino and the adenine amino and AH2 protons, and at higher temperature, by exchange with the solvent protons. Although room temperature exchange rates vary between 3 and 12s^?1, the exchange activation energies (E_α) are insensitive to changes in the duplex sequence (alternating vs homopolymer duplexes), the conformation (B-form DNA vs A-form RNA), and the identity of the pyrimidine base (thymine vs uracil). The average value of the activation energy for the five duplexes studied, poly[d(A-T)], poly[d(A) · d(T)], poly[d(A-U)], Poly[d(A) · d(U)], and poly[r(A) · r(U)], was 16.8 ± 1.3 kcal/mol. In addition, we find that the average E_α for the A.T base pairs in a 43-base-pair restriction fragment is 16.4 ± 1.0 kcal/mol. This result is to be contrasted with the observation that the E_α of cytosine-containing duplexes depends on the sequence, conformation, and substituent groups on the purine and pyrimidine bases. Taken together, the data indicate that there is a common low-energy pathway for the escape of the thymine (uracil) imino protons from the double helix. The absolute values of the exchange rates in the simple sequence polymers are typically 3–10 times faster than in DNAs containing both A · T and G · C base pairs.     

Influence of substituents on conformational preferences of helix foldamers of γ‐dipeptides

Conformational preferences of 9‐ and 14‐helix foldamers have been studied for γ‐dipeptides of 2‐aminocyclohexylacetic acid (γAc₆a) residues such as Ac‐(γAc₆a)₂‐NHMe ( 1 ), Ac‐(C^α‐Et‐γAc₆a)₂‐NHMe ( 2 ), Ac‐(γAc₆a)₂‐NHBn ( 3 ), and Ac‐(C^α‐Et‐γAc₆a)₂‐NHBn ( 4 ) at the M06‐2X/cc‐pVTZ//M06‐2X/6‐31 + G(d) level of theory to explore the influence of substituents on their conformational preferences. In the gas phase, the 9‐helix foldamer H9 and 14‐helix foldamer H14‐z are found to be most preferred for dipeptides 2 and 4 , respectively, as for dipeptides 1 and 3 , which indicates no remarkable influence of the C^α‐ethyl substitution on conformational preferences. The benzyl substitution at the C‐terminal end lead H14‐z to be the most preferred conformer for dipeptides 3 and 4 , whereas it is H9 for dipeptides 1 and 2 , which can be ascribed to the favored C? H···π interactions between the cyclohexyl group of the first residue and the C‐terminal benzyl group. There are only marginal changes in backbone structures and the distances and angles of H‐bonds for all local minima by C^α‐ethyl and/or benzyl substitutions. Although vibrational frequencies and intensities of the dipeptide 4 calculated at both M06‐2X/6‐31 + G(d) and M05‐2X/6‐31 + G(d) levels of theory are consistent with observed results in the gas phase, H14‐z is predicted to be most preferred by ΔG only at the former level of theory. Hydration did not bring the significant changes in backbone structures of helix foldamers for both dipeptide 1 and 4 . It is expected that the different substitutions at the C‐terminal end lead to the different helix foldamers, which may increase the resistance of helical structures to proteolysis and provide the more surface to the helical structures suitable for molecular recognition. © 2014 Wiley Periodicals, Inc. Biopolymers 101: 1077–1087, 2014.     

NMR studies of triple-strand formation from the homopurine-homopyrimidine deoxyribonucleotides d(GA)4 and d(TC)4

The complexes formed by the homopurine and homopyrimidine deoxyribonucleotides d(GA)4 and d(TC)4 have been investigated by one- and two-dimensional 1H NMR. Under appropriate conditions [low pH, excess d(TC)4 strand] the oligonucleotides form a triplex containing one d(GA)4 and two d(TC)4 strands. The homopurine and one of the homopyrimidine strands are Watson-Crick base paired, and the second homopyrimidine strand is Hoogsteen base paired in the major groove to the d(GA)4 strand. Hoogsteen base pairing in GC base pairs requires hemiprotonation of C; we report direct observation of the C+ imino proton in these base pairs. Both homopyrimidine strands have C3'-endo sugar conformations, but the purine strand does not. The major triplex formed appears to have four TAT and three CGC+ triplets formed by binding of the second d(TC)4 strand parallel to the d(GA)4 strand with a 3' dangling end. In addition to the triplexes formed, at least one other heterocomplex is observed under some conditions.     

Bacterial collagen‐binding domain targets undertwisted regions of collagen

Clostridium histolyticum collagenase causes extensive degradation of collagen in connective tissue that results in gas gangrene. The C‐terminal collagen‐binding domain (CBD) of these enzymes is the minimal segment required to bind to a collagen fibril. CBD binds unidirectionally to the undertwisted C‐terminus of triple helical collagen. Here, we examine whether CBD could also target undertwisted regions even in the middle of the triple helix. Collageneous peptides with an additional undertwisted region were synthesized by introducing a Gly → Ala substitution [(POG)_xPOA(POG)_y]₃, where x + y = 9 and x > 3). ¹H–¹⁵N heteronuclear single quantum coherence nuclear magnetic resonance (HSQC NMR) titration studies with ¹⁵N‐labeled CBD demonstrated that the minicollagen binds to a 10 Å wide 25 Å long cleft. Six collagenous peptides each labeled with a nitroxide radical were then titrated with ¹⁵N‐labeled CBD. CBD binds to either the Gly → Ala substitution site or to the C‐terminus of each minicollagen. Small‐angle X‐ray scattering measurements revealed that CBD prefers to bind the Gly → Ala site to the C‐terminus. The HSQC NMR spectra of ¹⁵N‐labeled minicollagen and minicollagen with undertwisted regions were unaffected by the titration of unlabeled CBD. The results imply that CBD binds to the undertwisted region of the minicollagen but does not actively unwind the triple helix.     

i-motif solution structure and dynamics of the d(AACCCC) and d(CCCCAA) tetrahymena telomeric repeats

Using NMR methods, we have resolved the i-motif structures formed by d(AACCCC) and by d(CCCCAA), two versions of the DNA sequence repeated in the telomeric regions of the C-rich strand of tetrahymena chromosomes. Both oligonucleotides form fully symmetrical i-motif tetramers built by intercalation of two hemiprotonated duplexes containing four C•C⁺ pairs. The structures are extremely stable. In the tetramer of d(AACCCC), the outermost C•C⁺ pairs are formed by the cytidines of the 5′ ends of the cytidine tracts. A2 forms an A2•A2 (H6trans–N7) pair stacked to C3•C3⁺ and cross-strand stacked to A1. At 0°C, the lifetimes of the hemiprotonated pairs range from 1 ms for the outermost pair to ~1 h for the innermost pairs. The tetramer of d(CCCCAA) adopts two distinct intercalation topologies in slow conformational exchange. One, whose outermost C•C⁺ pairs are built by the cytidines of the 5′ end and the other by those of the 3′ end. In both topologies, the adenosine bases are fairly well stacked to the adjacent C•C⁺ pairs. They are not paired but form symmetrical pseudo-pairs with their H6cis amino proton and N1 nitrogen pointing towards each other.     

Effect of 5-Methylcytosine on the Structure and Stability of DNA. Formation of Triple-Stranded Concatenamers by Overlapping Oligonucleotides

Abstract

A triple helix can be formed upon binding of a pyrimidine oligonucleotide to the major groove of a homopurine-homopyrimidine (R·Y) double-stranded DNA target site. Here, we report that this reaction can be influenced by base methylation. The pyrimidine strand 5′- TmCTmCTmCTmCTTmCT (mY₁₂), whose cytosine residues are methylated at C5, does not bind the duplex 5′-AGAGAGAGAAGA·3′-TCTCTCTCTTCT (R₁₂·Y₁₂) to yield a 12-triad triplex, as would be expected from these DNA sequences. Rather, a complex of overlapping oligonucleotides, which we define concatenamer, is formed. The concatenamer is clearly evidenced by Polyacrylamide gel electrophoresis (PAGE) since it migrates with a smeared band of very low mobility. The stoichiometry of the concatenamer, determined by both UV mixing curves and electrophoresis, is surprisingly found to be (R₁₂· 2mY₁₂)_n, thus showing that the unmethylated Y₁₂ strand is excluded from the complex. Denaturation experiments performed by ultraviolet absorbance (UV) and differential scanning calorimetry (DSC) show that the concatenamers melt with a single and highly cooperative transition whose Tm strongly depends on pH. Overall, the data point to the conclusion that the concatenamers are in triple helix, where the methylated mY₁₂ strand is engaged in both Watson-Crick and Hoogsteen base pairings, thus displacing the Y₁₂ strand from the R₁₂·Y₁₂ duplex. A possible mechanism of concatenamer formation is proposed. The results presented in this paper show that 5-methylcytosine brings about a strong stabilizing effect on both double and triple DNA helices, and that pyrimidine oligonucleotides containing 5-methylcytosine can displace from R·Y duplexes the analogous non-methylated strand. The advantage of using methylated oligonucleotides in antisense technology is discussed.     

Control of Transmembrane Helix Dynamics by Interfacial Tryptophan Residues

Transmembrane protein domains often contain interfacial aromatic residues, which may play a role in the insertion and stability of membrane helices. Residues such as Trp or Tyr, therefore, are often found situated at the lipid-water interface. We have examined the extent to which the precise radial locations of interfacial Trp residues may influence peptide helix orientation and dynamics. To address these questions, we have modified the GW^5,19ALP23 (acetyl-GGALW⁵(LA)₆LW¹⁹LAGA-[ethanol]amide) model peptide framework to relocate the Trp residues. Peptide orientation and dynamics were analyzed by means of solid-state nuclear magnetic resonance (NMR) spectroscopy to monitor specific ²H- and ¹⁵N-labeled residues. GW^5,19ALP23 adopts a defined, tilted orientation within lipid bilayer membranes with minimal evidence of motional averaging of NMR observables, such as ²H quadrupolar or ¹⁵N-¹H dipolar splittings. Here, we examine how peptide dynamics are impacted by relocating the interfacial Trp (W) residues on both ends and opposing faces of the helix, for example by a 100° rotation on the helical wheel for positions 4 and 20. In contrast to GW^5,19ALP23, the modified GW^4,20ALP23 helix experiences more extensive motional averaging of the NMR observables in several lipid bilayers of different thickness. Individual and combined Gaussian analyses of the ²H and ¹⁵N NMR signals confirm that the extent of dynamic averaging, particularly rotational “slippage” about the helix axis, is strongly coupled to the radial distribution of the interfacial Trp residues as well as the bilayer thickness. Additional ²H labels on alanines A3 and A21 reveal partial fraying of the helix ends. Even within the context of partial unwinding, the locations of particular Trp residues around the helix axis are prominent factors for determining transmembrane helix orientation and dynamics within the lipid membrane environment.