Collagen structure: the Madras triple helix and the current scenario

This year marks the 50th anniversary of the coiled-coil triple helical structure of collagen, first proposed by Ramachandran's group from Madras. The structure is unique among the protein secondary structures in that it requires a very specific tripeptide sequence repeat, with glycine being mandatory at every third position and readily accommodates the imino acids proline/hydroxyproline, at the other two positions. The original structure was postulated to be stabilized by two interchain hydrogen bonds, per tripeptide. Subsequent modeling studies suggested that the triple helix is stabilized by one direct inter chain hydrogen bond as well as water mediated hydrogen bonds. The hydroxyproline residues were also implicated to play an important role in stabilizing the collagen fibres. Several high resolution crystal structures of oligopeptides related to collagen have been determined in the last ten years. Stability of synthetic mimics of collagen has also been extensively studied. These have confirmed the essential correctness of the coiled-coil triple helical structure of collagen, as well as the role of water and hydroxyproline residues, but also indicated additional sequence-dependent features. This review discusses some of these recent results and their implications for collagen fiber formation.     

A new approach to the thermodynamic role of imino acids in collagen. Solution of a thermodynamic paradox]

The dependence of denaturation transition thermodynamic parameters in various collagens from imino acid compositions has been analysed. Computational and experimental data suggest independence of the collagen molecule hydration on imino acid composition and sequence in the polypeptide chain. The continuous net of hydrogen bonds is interrupted, if imino acid residues occur in the sequence of amino acid residues, as follows from Monte Carlo computations, because the hydrogen of NH-group plays sufficient role in water shell formation for this conformation. As a consequence, entropy of denatured collagen-water system increases hand by hand with increasing imino acid content and therefore delta S increases. The increase of enthalpy of transition from imino acid content is determined by favorable Van der Waals interactions of pyrrolidine rings in native triple helical collagen structure. It was pointed out that proline role is determined by decreasing hydration in the single stranded polypeptide chain in Polyproline II conformation that leads to an increase of entropy of the polypeptide-water system. Thus, the collagen structure formation by imino acids is promoted in the water media due to single chain left-helical conformation being unfavorable for proline residues as well as due to the enthalpy nature of the triple helix stabilization.     

Collagen-based structures containing the peptoid residue N-isobutylglycine (Nleu): Synthesis and biophysical studies of Gly-Pro-Nleu sequences by circular dichroism,ultraviolet absorbance,and optical rotation

A peptoid residue N-isobutylglycine (Nleu) was introduced as a proline surrogate in collagen-like triple helical structures. A series of single chain and template-assembled collagen-based peptide-peptoid structures composed of Gly-Pro-Nleu sequences were prepared by solid-phase segment condensation methods. Both a synthetic route in solution and a solid phase method were employed to couple the KTA (cis,cis-1,3,5-trimethylcyclohexane-1,3,5-tricarboxylic acid, also known as the Kemp triacid) based template, KTA-(Gly-OH)₃, to peptide-peptoid chains. Biophysical studies using CD, uv absorbance, and optical rotation measurements demonstrated that these compounds form triple-helical structures when the chains are longer than critical lengths. Results from melting curve measurements indicated that the Gly-Pro-Nleu sequence is comparable to the Gly-Pro-Pro sequence in stabilizing a triple-helical conformation. The KTA-based template stabilized triple-helical structures as can be seen by the increased melting temperatures as compared to equivalent single chain molecules. In addition, the template reduced the minimum chain length necessary to form a triple helix from six to only three trimer repeats. © 1996 John Wiley & Sons, Inc.     

Hydroxyproline content determines the denaturation temperature of chick tendon collagen

A series of nine procollagen samples in which the hydroxyproline content varied from <1% to 44% of the total imino acids was prepared by incubating embryonic chick tendon cells with varying concentrations of α,α′-dipyridyl, an inhibitor of proline hydroxylase. The thermal stability of these procollagen preparations was then investigated by using pepsin digestion at different temperatures as an enzymatic probe of conformation. Using this technique, the denaturation temperature of the procollagen was found to be directly proportional to the hydroxyproline content. A denaturation temperature of 23.5 °C was found for the unhydroxylated procollagen and 37.9 °C for fully hydroxylated procollagen. These results suggest that hydroxyproline is crucial to the thermal stability of the collagen triple helix. They also imply that unhydroxylated molecules are not triple helical within the cell at 37 °C and that triple helix formation may be necessary for normal secretion.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Proline in alpha-helix: stability and conformation studied by dynamics simulation

Free-energy simulations have been used to estimate the change in the conformational stability of short polyalanine alpha-helices when one of the alanines is replaced by a proline residue. For substituting proline in the middle of the helix the change in free energy of folding (delta delta G degrees) was calculated as 14 kJ/mol (3.4 kcal/mol), in excellent agreement with the one available experimental value. The helix containing proline was found to be strongly kinked; the free energy for reducing the angle of the kink from 40 degrees to 15 degrees was calculated, and found to be small. A tendency to alternate hydrogen bonding schemes was observed in the proline-containing helix. These observations for the oligopeptide agree well with the observation of a range of kink angles (18-35 degrees) and variety of hydrogen bonding schemes, in the rare instances where proline occurs in helices in globular proteins. For substituting proline at the N-terminus of the helix the change in free energy of folding (delta delta G degrees) was calculated as -4 kJ/mol in the first helical position (N1) and +6 kJ/mol in the second helical position (N2). The observed frequent occurrence of proline in position N1 in alpha-helices in proteins therefore has its origin in stability differences of secondary structure. The conclusion reached here that proline may be a better helix former in position N1 than (even) alanine, and thus be a helix initiator may be testable experimentally by measurements of fraction helical conformation of individual residues in oligopeptides of appropriate sequence. The relevance of these results in regards to the frequent occurrence of proline-containing helices in certain membrane proteins is discussed.     

A triple-helical model for (Gly-Pro-Hyp)n with cis peptide units

Synthetic regular polytripeptides of the type (Gly-R₂-R₃) where R₂, R₃, or both, are imino acids have been widely studied as model compounds for collagen. One such polytripeptide is poly(Gly-Pro-Hyp), since triplets with this sequence constitute about 10% of collagen. Recently, a new model has been proposed for this polytripeptide in which one of the three peptide bonds in the tripeptide unit is in the cis conformation, and the γ-hydroxyl group of hydroxyproline forms a direct interchain hydrogen bond within the triple helix. We have confirmed this structure by model building using computer techniques, and the helical parameters obtained by us are close to the experimentally observed values. The model is also found to be comparable in stability with other models from energy considerations.     

The Structure of Triple Helical Poly(U)·Poly(A)·Poly(U) Studied by Raman Spectroscopy

Abstract

Using Raman spectroscopy, we examined the ribose-phosphate backbone conformation, the hydrogen bonding interactions, and the stacking of the bases of the poly(U)·poly(A) ·poly(U) triple helix. We compared the Raman spectra of poly(U)·poly(A)·poly(U) in H₂O and D₂O with those obtained for single-stranded poly(A) and poly(U) and for double-stranded poly(A)·poly(U). The presence of a Raman band at 863 cm^?1 indicated that the backbone conformations of the two poly(U) chains are different in the triple helix. The sugar conformation of the poly(U) chain held to the poly(A) by Watson-Crick base pairing is C3′ endo; that of the second poly(U) chain may be C2′ endo. Raman hypochromism of the bands associated with base vibrations demonstrated that uracil residues stack to the same extent in double helical poly(A)·poly(U) and in the triple-stranded structure. An increase in the Raman hypochromism of the bands associated with adenine bases indicated that the stacking of adenine residues is greater in the triple helix than in the double helical form. Our data further suggest that the environment of the carbonyls of the uracil residues is different for the different strands.     

Prediction of collagen stability from amino acid sequence

An algorithm was derived to relate the amino acid sequence of a collagen triple helix to its thermal stability. This calculation is based on the triple helical stabilization propensities of individual residues and their intermolecular and intramolecular interactions, as quantitated by melting temperature values of host-guest peptides. Experimental melting temperature values of a number of triple helical peptides of varying length and sequence were successfully predicted by this algorithm. However, predicted T(m) values are significantly higher than experimental values when there are strings of oppositely charged residues or concentrations of like charges near the terminus. Application of the algorithm to collagen sequences highlights regions of unusually high or low stability, and these regions often correlate with biologically significant features. The prediction of stability from sequence indicates an understanding of the major forces maintaining this protein motif. The use of highly favorable KGE and KGD sequences is seen to complement the stabilizing effects of imino acids in modulating stability and may become dominant in the collagenous domains of bacterial proteins that lack hydroxyproline. The effect of single amino acid mutations in the X and Y positions can be evaluated with this algorithm. An interactive collagen stability calculator based on this algorithm is available online.     

The contribution of helical potential to the in vitro receptor binding activity of a neuropeptide Y N-terminal deletion fragment

In its dimeric form neuropeptide Y (NPY) folds into a compact structure in which the antiparallel oriented proline and α-helices apparently associate to form a primitive hydrophobic core. To investigate the contribution of helical stability to the receptor binding activity of NPY and its N-terminal deletion fragments, we synthesized and studied the solution conformational properties and in vitro activities of NPY, N^α-acetyl-NPY_2–36, NPY_15–36, N^α-propinonly-NPY_15–36, and N^α-succinyl-NPY_15–36 is significantly less helical than both NPY and N^α-acetyl-NPY_2–36, and this decreased helical potential is attributed of the absence of the intramolecular stabilizing interaction afforded by the proline helix in the latter analogues. However, in accord with the helix dipole model, the helical potential of NPY_15–36 is significantly increased by N-terminal succinlyation, whereas propionylation has no effect. In addition to an increase in helical potential, N^α-succinyl-NPY_15–36 is 2.5 and 4.6 times more active than NPY_15–36 and N^α-propionly-NPY_15–36, respectively and is equipotent with N^α-acteyl-NPY_2–36 in displacing 1mM[³H]-NPY from specific binding sites in rat brain membranes. The demonstration of positive correlation between % α-helix content and in vitro binding activity suggests that the helical potential of N-terminal NPY deletion fragments contributes to their in vitro activity in the rat brain, and that a second role of the proline helix might be to stabilize the receptor-active conformation of the NPY α-helix. © 1993 John Wiley & Sons, Inc.     

Contribution of dipole-dipole interactions to the stability of the collagen triple helix

Unveiling sequence-stability and structure-stability relationships is a major goal of protein chemistry and structural biology. Despite the enormous efforts devoted, answers to these issues remain elusive. In principle, collagen represents an ideal system for such investigations due to its simplified sequence and regular structure. However, the definition of the molecular basis of collagen triple helix stability has hitherto proved to be a difficult task. Particularly puzzling is the decoding of the mechanism of triple helix stabilization/destabilization induced by imino acids. Although the propensity-based model, which correlates the propensities of the individual imino acids with the structural requirements of the triple helix, is able to explicate most of the experimental data, it is unable to predict the rather high stability of peptides embedding Gly-Hyp-Hyp triplets. Starting from the available X-ray structures of this polypeptide, we carried out an extensive quantum chemistry analysis of the mutual interactions established by hydroxyproline residues located at the X and Y positions of the Gly-X-Y motif. Our data clearly indicate that the opposing rings of these residues establish significant van der Waals and dipole-dipole interactions that play an important role in triple helix stabilization. These findings suggest that triple helix stabilization can be achieved by distinct structural mechanisms. The interplay of these subtle but recurrent effects dictates the overall stability of this widespread structural motif.     

Crystal structure of the collagen model peptide (Pro‐Pro‐Gly)4‐Hyp‐Asp‐Gly‐(Pro‐Pro‐Gly)4 at 1.0 Å resolution

The single‐crystal structure of the collagen‐like peptide (Pro‐Pro‐Gly)₄‐Hyp‐Asp‐Gly‐(Pro‐Pro‐Gly)₄, was analyzed at 1.02 Å resolution. The overall average helical twist (θ = 49.6°) suggests that this peptide adopts a 7/2 triple‐helical structure and that its conformation is very similar to that of (Gly‐Pro‐Hyp)₉, which has the typical repeating sequence in collagen. High‐resolution studies on other collagen‐like peptides have shown that imino acid‐rich sequences preferentially adopt a 7/2 triple‐helical structure (θ = 51.4°), whereas imino acid‐lean sequences adopt relaxed conformations (θ < 51.4°). The guest Gly‐Hyp‐Asp sequence in the present peptide, however, has a large helical twist (θ = 61.1°), whereas that of the host Pro‐Pro‐Gly sequence is small (θ = 46.7°), indicating that the relationship between the helical conformation and the amino acid sequence of such peptides is complex. In the present structure, a strong intermolecular hydrogen bond between two Asp residues on the A and B strands might induce the large helical twist of the guest sequence; this is compensated by a reduced helical twist in the host, so that an overall 7/2‐helical symmetry is maintained. The Asp residue in the C strand might interact electrostatically with the N‐terminus of an adjacent molecule, causing axial displacement, reminiscent of the D‐staggered structure in fibrous collagens. © 2013 Wiley Periodicals, Inc. Biopolymers 99: 436–447, 2013.     

Sequence recombination improves target specificity in a redesigned collagen peptide abc‐type heterotrimer

Stability of the collagen triple helix is largely governed by its imino acid content, namely the occurrence of proline and 4R‐hydroxyproline at the X and Y positions, respectively, of the periodic (Gly‐X‐Y)_n sequence. Although other amino acids at these positions reduce stability of the triple helix, this can be partially compensated by introducing intermolecular side‐chain salt bridges. This approach was previously used to design an abc‐type heterotrimer composed of one basic, one acidic, and one neutral imino acid rich chain (Gauba and Hartgerink, J Am Chem Soc 2007;129:15034–15041). In this study, an abc‐type heterotrimer was designed to be the most stable species using a sequence recombination strategy that preserved both the amino acid composition and the network of interchain salt bridges of the original design. The target heterotrimer had the highest T_m of 50°C, 7°C greater than the next most stable species. Stability of the heterotrimer decreased with increasing ionic strength, consistent with the role of intermolecular salt bridges in promoting stability. Quantitative meta‐analysis of these results and published stability measurements on closely related peptides was used to discriminate the contributions of backbone propensity and side‐chain electrostatics to collagen stability. Proteins 2013. © 2012 Wiley Periodicals, Inc.     

Proline residues in transmembrane alpha helices affect the folding of bacteriorhodopsin

Proline residues occur frequently in transmembrane alpha helices, which contrasts with their behaviour as helix-breakers in water-soluble proteins. The three membrane-embedded proline residues of bacteriorhodopsin have been replaced individually by alanine and glycine to give P50A, or P50G on helix B, P91A, or P91G on helix C, and P186A or P186G on helix F, and the effect on the protein folding kinetics has been investigated. The rate-limiting apoprotein folding step, which results in formation of a seven transmembrane, alpha helical state, was slower than wild-type protein for the Pro50 and Pro91 mutants, regardless of whether they were mutated to Ala or Gly. These proline residues give rise to several inter-helix contacts, which are therefore important in folding to the seven transmembrane helix state. No evidence for cis-trans isomerisations of the peptidyl prolyl bonds was found during this rate-limiting apoprotein folding step. Mutations of all three membrane-embedded proline residues affected the subsequent retinal binding and final folding to bacteriorhodopsin, suggesting that these proline residues contribute to formation of the retinal binding pocket within the helix bundle, again via helix/helix interactions. These results point to proline residues in transmembrane alpha helices being important in the folding of integral membrane proteins. The helix/helix interactions and hydrogen bonds that arise from the presence of proline residues in transmembrane alpha helices can affect the formation of transmembrane alpha helix bundles as well as cofactor binding pockets.     

Theoretical evaluation of polytripeptide collagen models

The influence of inserting certain residues (X) into a polytripeptide sequence conformed into a poly-L -proline II helix is examined theoretically. It is found that for sequences such as -Gly-Pro-X- and -Gly-X-Pro-, the introduction of glycyl, L -alanyl or L -seryl residues in the X position destabilizes the helix so that it is no longer the most stable intramolecular form. On the other hand, L -prolyl and L -hydroxyprolyl residues cause the PP II helix to be most stable. Of the many stable intramolecular forms, the majority will not pack efficiently to form fiber or solid-state structures. The Rich-Crick and Ramachandran collagen model structures were examined in terms of a Gly-Pro-Ala sequence, the Ramachandran, one-hydrogen-bond structure, being the most stable. However, another triple-strand structure for (Gly-Pro-Ala)_n, is much more energetically favorable. Hence, it may be concluded that none of the aforementioned is an entirely satisfactory collagen model. The new triple helix conformation proposed by Traub, Yonath, and Segal for (Gly-Pro-Pro) is found to give a more favorable intramolecular conformation for (Gly-Pro-Ala)_n than those derived from other collagen models. It is concluded that the collagen molecule derives its stability from interchain interactions in proline-sparse regions and intrachain stability in proline-rich regions.     

Transport of Proline and Hydroxyproline by the Neutral Amino-acid Exchanger ASCT1

ASCT1 is a member of the glutamate transporter superfamily cloned from human brain and characterized as a Na⁺-dependent neutral amino-acid exchanger, which displays substrate-induced chloride-channel activity and mediates concentrative transport of alanine. Initial studies in ASCT1-expressing Xenopus laevis oocytes showed that proline did not elicit measurable currents, in contrast to what occurred with alanine, serine or cysteine, suggesting that proline was not an ASCT1 substrate, although it induced the release of alanine from preloaded oocytes. Here, we have studied the uptake of proline and hydroxyproline by ASCT1-expressing oocytes in order to investigate the ability of ASCT1 to translocate these imino acids. The results demonstrate ASCT1-mediated proline transport that is Na⁺-dependent, saturable, inhibited by the reported ASCT1 substrates as well as by hydroxyproline and can drive the imino acid against its concentration gradient. The apparent kinetic constants for the transport of alanine and the imino acids, obtained with oocytes from the same batch, showed maximal transport rate for proline and hydroxyproline to be half of that for alanine. However, K _0.5 for proline was 704 ± 86 µM, about three times higher than alanine K _0.5 (203.3 ± 36.4 µM), whereas hydroxyproline K _0.5 was 33.2 ± 4.3 µM, indicating that the hydroxylation on carbon 4 of proline strongly increases the affinity of ASCT1 for this proline derivative. In summary, the present work demonstrates for the first time the ability of ASCT1 to transport proline and hydroxyproline.     

Berenil Complexation with a Nucleic Acid Triple Helix

Abstract

The interaction of berenii molecule, a minor groove binding drug, with T-A-T triple helix and A-T double helix was studied using circular dichroism spectroscopy and thermal denaturation. The triple helix was made by an oligonucleotide (dA)₁₂?x-(dT)₁₂?x-(dT)₁₂, where x is a hexaethylene glycol chain bridged between the 3′ phosphate of one strand and the 5′ phosphate of the following strand. This oligonucleotide is able to fold back on itself to form a very stable triplex. Circular dichroism spectroscopy demonstrates that berenil can bind to the triple helical structure. Spectral analysis shows that in the same ionic strength the drug bound to a double-stranded structure exhibits a conformation and an environment close to those observed in triple-stranded structure. The influence of the ionic strength on the interaction between the berenil molecule and the 36-mer is clearly demonstrated. We showed that when no NaCl salt is added in the buffer the triplex form of (dA)₁₂?x-(dT)₁2-x-(dT)₁₂ is stabilized by berenil whereas it is destabilized slightly by the dye when NaCl concentration is 1 M.     

A peptide study of the relationship between the collagen triple-helix and amyloid

Type XXV collagen, or collagen‐like amyloidogenic component, is a component of amyloid plaques, and recent studies suggest this collagen affects amyloid fibril elongation and has a genetic association with Alzheimer's disease. The relationship between the collagen triple helix and amyloid fibrils was investigated by studying peptide models, including a very stable triple helical peptide (Pro‐Hyp‐Gly)₁₀, an amyloidogenic peptide GNNQQNY, and a hybrid peptide where the GNNQQNY sequence was incorporated between (GPO)_n domains. Circular dichroism and nuclear magnetic resonance (NMR) spectroscopy showed the GNNQQNY peptide formed a random coil structure, whereas the hybrid peptide contained a central disordered GNNQQNY region transitioning to triple‐helical ends. Light scattering confirmed the GNNQQNY peptide had a high propensity to form amyloid fibrils, whereas amyloidogenesis was delayed in the hybrid peptide. NMR data suggested the triple‐helix constraints on the GNNQQNY sequence within the hybrid peptide may disfavor the conformational change necessary for aggregation. Independent addition of a triple‐helical peptide to the GNNQQNY peptide under aggregating conditions delayed nucleation and amyloid fibril growth. The inhibition of amyloid nucleation depended on the Gly‐Xaa‐Yaa sequence and required the triple‐helix conformation. The inhibitory effect of the collagen triple‐helix on an amyloidogenic sequence, when in the same molecule or when added separately, suggests Type XXV collagen, and possibly other collagens, may play a role in regulating amyloid fibril formation. © 2012 Wiley Periodicals, Inc. Biopolymers 97: 795–806, 2012.     

Renaturation of triple helical polysaccharide lentinan in water-diluted dimethylsulfoxide solution

Triple helical lentinan, a β-(1→3)-d-glucan from Lentinus edodes, was denatured in dimethylsulfoxide (DMSO) into single random coils. The randomly coiled lentinan/DMSO solutions were diluted with pure water to w_H (the weight fraction of water in the mixed solvent) of 95%, and their intrinsic viscosity [η], weight-average molecular weight M_w, radius of gyration R_g, and hydrodynamic radius R_h were investigated at 25 °C after over 5-day storage. The [η] and M_w values, especially the conformation parameter ρ (≡R_g/R_h), of the renatured lentinan were close to those of the originally extracted one, suggesting that random lentinan chains in DMSO were reassembled into triple helical structures. Moreover, the renatured lentinan in 95% water/5% DMSO solution exhibited a unique behavior of triple helical glucans that shear modulus G′ decreased sharply at temperature from 8.4 °C to 13.3 °C with increasing temperature, which was ascribed to the intramolecular conformation transition from ordered triple helical I to disordered triple helical II. The AFM images gave was suggested intuitively evidence that the renatured lentinan mainly existed as rod-like chains, supporting that formation of triple helical structure. The optimal lentinan concentration for triple helical configuration formation was estimated to be over 0.04%. The time dependence of R_h and UV absorption of the water-diluted lentinan/DMSO solution with an indicator of azo dye of Congo red suggested that renaturation of triple helix was a very rapid process. Moreover, the blue-shift of UV-vis absorption spectra suggested that the dye molecules of Congo red were assembled into supramolecular structure in the hydrophobic cavity of the renatured triple helical lentinan. All the results showed that the triple helical structure formed once the randomly coiled lentinan/DMSO was diluted to the final water content of 95%.     

Mechanism of collagen folding propagation studied by Molecular Dynamics simulations

Collagen forms a characteristic triple helical structure and plays a central role for stabilizing the extra-cellular matrix. After a C-terminal nucleus formation folding proceeds to form long triple-helical fibers. The molecular details of triple helix folding process is of central importance for an understanding of several human diseases associated with misfolded or unstable collagen fibrils. However, the folding propagation is too rapid to be studied by experimental high resolution techniques. We employed multiple Molecular Dynamics simulations starting from unfolded peptides with an already formed nucleus to successfully follow the folding propagation in atomic detail. The triple helix folding was found to propagate involving first two chains forming a short transient template. Secondly, three residues of the third chain fold on this template with an overall mean propagation of ~75 ns per unit. The formation of loops with multiples of the repeating unit was found as a characteristic misfolding event especially when starting from an unstable nucleus. Central Gly→Ala or Gly→Thr substitutions resulted in reduced stability and folding rates due to structural deformations interfering with folding propagation.