The role of structural water in the formation of nucleotide mispairs

The results of NMR investigation of the double-helical nucleic acid fragments containing A.C, C.U, m6G.U and m6G.G mispairs can be explained on the assumption that the bases in such pairs being in usual tautomeric forms are linked via water bridges. A computer analysis of intermolecular interactions in the systems containing two bases and one or two water molecules shows that these pairs correspond to the energy minima. The formation of pairs with water bridges can be considered an intermediate step in mutagenesis caused by some spontaneous errors arising during nucleic acid biosynthesis as well in mutagenesis induced by alkylating agents.     

Theoretical studies on protein-nucleic acid interactions. II. Hydrogen bonding of amino acid side chains with bases and base pairs of nucleic acids

With a view to understanding the role of hydrogen bonds in the recognition of nucleic acids by proteins, hydrogen bonding between the bases and base pairs of nucleic acids and the amino acids (Asn, Gln, Asp and Glu, and charged residues Arg⁺, Glu^?, and Asp^?) has been studied by a second-order perturbation theory. Binding energies have been calculated for all possible configurations involving a pair of hydrogen bonds between the base (or base pair) and the amino acid residue. Our results show that the hydrogen bonding in these cases has a large contribution from electrostatic interaction. In general, the charged amino acids, compared to the uncharged ones, form more stable complexes with bases or base pairs. The hydrogen-bond energies are an order of magnitude smaller than the Coulombic interaction energies between basic amino acids (Lys⁺, Arg⁺, and His⁺) and the phosphate groups of nucleic acids. The stabilities of the complexes of amino acids Asn, Gln, Asp, and Glu with bases are in the order: G–X > C–X > A–X U–X or T–X, and G · C–X > A · T(U)–X, where X is one of these amino acid residues. It has been shown that Glu^? and Asp^? can recognize guanine in single-stranded nucleic acids; Arg⁺ can recognize G · C base pairs from A · T base pairs in double-stranded structures.     

Cooperative Non-enzymatic Base Recognition and the Stability of the G-U Wobble Pair

INVESTIGATIONS of paired complementary polynucleotides containing occasional mismatched bases have indicated that these bases are looped out of the double helical regions thereby making the helix unstable. But in a system containing mismatched G and U bases, no such definite conclusion could be drawn^1–4—stoichiometry and T_m values of such complexes can be interpreted in terms of the formation of a G-U wobble pair⁴. Recently the complexes formed by self-complementary block oligomers interrupted by mismatched bases, for example, A_nXU_n (X=G, C and U), have been studied in detail⁵·⁶. It seems that stacking interactions play a much more dominant role in the stabilization of double helices than was previously thought. Thus the extent of looping out and of non-Watson-Crick base pairing can hardly be assessed independently.     

Analysis of an RNA Pseudoknot Structure by CD Spectroscopy

Abstract

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.     

Possible conformations of double-helical polynucleotides containing incorrect base pairs

Theoretical conformational analysis using classical potential functions has shown the possibility of incorporation of nucleotide mispairs with the bases in normal tautomeric forms into the DNA double helix. Incorrect purine-pyrimidine, purine-purine and pyrimidine-pyrimidine pairs can be incorporated into the double helix existing both in A- and B-conformations. The most energy favourable conformations of fragments containing a mispair have all the dihedral angles of the sugar-phosphate backbone within the limits characteristic of double helices consisting of Watson-Crick nucleotide pairs. Incorporation of mispairs is possible practically without the appearance of reduced interatomic contacts. Mutual position of bases in the incorporated mispair does not differ much from their position at the energy minimum of the corresponding isolated base pairs. Conformational parameters of irregular regions of double-stranded polynucleotides containing G:U, I:A, I:A* (syn) and U:C pairs are presented. Distortion of the sugar-phosphate backbone is the least upon incorporation of the G:U pair. Formation of mispairs in the processes of nucleic acid biosynthesis and spontaneous mutagenesis is discussed.     

Crystallographic studies of drug-nucleic acid interactions: Proflavine intercalation between the non-complementary base-pairs of cytidilyl-3′,5′-adenosine

In order to get insights into the binding of dyes and mutagens with denatured and single-stranded nucleic acids and the possible implications in frameshift mutagenesis, a 1:1 complex between the non-self-complementary dinucleoside monophosphate cytidilyl-3′,5′-adenosine (CpA) and proflavine was crystallized. The crystals belong to the tetragonal space group P4₂2₁2 with cell constants $\text{a = b = 19.38(1)}\text{A}\text{?}\text{and}\text{c = 27.10(1)}\text{A}\text{?}$. The asymmetric unit contains one CpA, one proflavine and nine water molecules by weight. The structure was determined using Patterson and direct methods and refined to an R-value of 11% using 2454 diffractometer intensities.The non-self-complementary dinucleoside monophosphate CpA forms a selfpaired parallel chain dimer with a proflavine molecule intercalated between the protonated cytosine-cytosine (C · C) pair and the neutral adenine-adenine (A · A) pair. The dimer complex exhibits a right-handed helical twist and an irregular girth. The neutral A · A pair is doubly hydrogen-bonded through the N(6) and N(7) sites (C(1′)C(1′) distance: 10.97(2) Å) and the protonated C · C pair is triply hydrogen-bonded with a proton shared between the N(3) sites (C(1′)C(1′) distance: 9.59(2) Å). To accommodate the intercalating dye, the sugars of successive nucleotide residues adopt the two fundamental conformations (5′ end: 3′-endo, 3′ end: 2′-endo), the backbone adopts torsion angle values that fluctuate within their preferred conformational domains: the PO bonds (ω, ω′) adopt the characteristic helical (gauche^?-gauche^?) conformation, the CO bonds (φ, φ′) are both in the trans domain and the C(4′)C(5′) bonds (ψ) are in the gauche⁺ region. The bases of both residues are disposed in the preferred anti domain with the glycosyl torsion angles (χ) correlated to the puckering mode of the sugar so that the cytidine residue is C(3′)-endo, low χ (12 dg), and the adenosine residue is C(2′)-endo, high χ (84 °). The intercalated proflavine stacks more extensively with the C · C pair than the A · A pair. Between 4₂-related CpA proflavine units there is a second proflavine which stacks well with both the A · A and the C · C pairs sandwiching it. Both proflavine molecules are positionally disordered. In each of its two disordered sites, the intercalated proflavine forms hydrogen-bonded interactions with only one sugar-phosphate backbone. A total of 26 water sites has been characterized of which only two are fully occupied. These hydration sites are involved in an intricate network of hydrogen bonds with both the dye and CpA and provide insights on the various modes of interactions between water molecules and between water molecules and nucleic acids.The structure of the proflavine-CpA complex shows that intercalation of planar drugs can occur between non-complementary base-pairs. This result can be relevant for understanding the strong binding of acridine dyes to denatured DNA, single-stranded RNA, and single-stranded polynucleotides. Also, the ability of proflayine to promote self-pairs of adenine and cytosine bases could provide a chemical basis for an alternative mechanism of frameshift mutagenesis.     

Interactions of poly-N6-methyladenylic Acid and N6-substituted-9-methyladenines with poly-5-bromouridylic Acid: A Novel Base-pairing

Abstract

The interaction of poly-N⁶-methyladenylic acid (poly(m⁶A)) with poly-5-bromouridylic acid (poly(BU)) was studied by the mixing curve method. A 1 m⁶A: 2 BU stoichiometry was clearly indicated over a wide range of ionic strengths at neutral pH, while the binding of poly(m⁶A) to poly(U) is known to occur with 1 m⁶A:1 U. Digestion by nuclease S1 confirmed this stoichiometry, indicating the absence of single strands in a 1:2 mixture. Heating profile analysis and hydroxyapatite column chromatography provided further confirmation of this finding. To determine whether 1:2 stoichiometry holds in a monomer-polymer system, the interaction of N⁶-methyl-9-methyladenine (m⁶m⁹A), a corresponding monomer of poly(m⁶A), with poly(BU) was investigated.

Equilibrium dialysis experiments showed the stoichiometry of the interaction to be 1 m⁶A: 2 BU. Thus, we would describe some structural studies of the above complexes using c.d. and i. r. spectroscopy. Poly (m⁶A)·2poly(BU) and m⁶m⁹A·2poly(BU) are helical and analogous to each other in structure, and the bases in the complexes are all bound by hydrogen-bonding. N⁶-(Δ²-isopentenyl)- and N⁶-allyl-9-methyladenine were also found to form complexes with poly(BU), giving similar c.d. spectra with that of m⁶m⁹A·2poly(BU). The melting experiments indicated the T_ms to be substantially decreased, compared to the parent unmodified complexes, even though the T_m dependence of the polymer complex on salt concentration conforms to the typical triple strand. In the following, the biological significance of this novel pairing will be discussed.     

Characterization of segmented double-helical RNA from bacteriophage phi6

The nucleic acid component of bacteriophage φ6 is characterized as a double stranded RNA molecule with a buoyant density of 1.605 g/cm³ and nucleotide composition of C, 27.3%; A, 21.8%; G, 28.9%; and U, 22.0%. The hyperchromicity profile in 0.1 × SSC (SSC is 0.15 m-NaCl, 0.015 m-sodium citrate) demonstrated a rapid increase with a T_m value of 91 °C. The nucleic acid was resistant to degradation by DNase, spleen phosphodiesterase and pancreatic RNase in 2 × SSC buffer but sensitive to degradation by venom phosphodiesterase, pancreatic RNase in 0.01 × SSC and hydrolysis in KOH. Three distinct double stranded RNA species of 2.2, 2.8 and 4.5 × 10⁶ daltons were observed after rate zonal centrifugation, polyacrylamide gel electrophoresis and electron microscopy. This communication therefore presents data establishing a new class of double stranded RNA bacteriophage.     

Interaction of Nucleic Acids with Lipid Membranes

Abstract

The thermodynamics of nucleic acids which were enclosed in reverse-phase evaporation vesicles was studied by thermal denaturation with optical recording. The denaturation curves were recorded with a dual wavelength spectrophotometer. The sum of the hypochromicity of the nucleic acid and of the change in turbidity of the vesicles was measured at 260 nm and was corrected for the change in turbidity at 320 nm. Cloned fragments of double-stranded DNA containing 180 base pairs and poly A:poly U were enclosed in REV with a yield up to every vesicle containing five nucleic acid molecules. Vesicles were prepared from egg- lecithin, and the surface charge of the vesicles was varied by addition of stearic acid, phosphatidyl-glycerol and phosphatidyl-serine. The helix-coil transition of the nucleic acid enclosed in the vesicle could be resolved from that of the free nucleic acid. Due to the enclosure into the egg-lecithin REV the transition is stabilized from 70.5° to 74°C, the transition is broadened from 0.7°C to 2.7°C. Varying the phosphatidyl-serine-lecithin-ratio from 0–100%, an optimum in the yield of enclosure at 20% was obtained, a further broadening of the transition to 5.5°C and a decrease of the stabilization down to a small destabilization at 100% phosphatidyl serine was observed. Qualitatively, similar effects were observed with poly A:poly U. Variation of the ionic strength led to the conclusion that the replacement of the counterions of the phosphate backbone by the surface charge of the membrane, as well as a direct contact between the nucleic acid and the membrane have to be assumed. At present, the biological relevance of the results may be more in the drastic decrease in cooperativity than in the slight modulation of the stability. From nearly 180 base pairs opening up cooperatively in free nucleic acid this number is lowered to less than 50, a size in the range of promotor regions.     

Structure-Function Relationship of Three Triple-Helical Nucleic Acids

Abstract

The nucleic acid triplexes poly d(T)·poly d(A)·poly d(T), poly (U)·poly (A)·poly (U), and poly (I)·poly (A)·poly (I) display a sort of continuity between each other. However, their morphologies present their own individuality which, considering those of their parent duplexes, are quite unexpected. This comparison helps to understand triplex structure-function relationship. While helical parameters are functions of the sugar pucker, low values of WC and Hoogsteen base-pair propellers is commonplace for triplexes and the Hoogsteen base-pair geometry monitors the effects of the interstrand phosphates charge-charge repulsion.

Synopsis

The nucleic acid triplexes poly d(T)·poly d(A)·poly d(T), poly(U)·poly(A)·poly(U), and poly (I)·poly (A)·poly (I) present distinct morphologies. Considering those of their parent duplexes, they are also quite unexpected.     

Monte-Carlo simulation of hydration of nucleic acid fragments

Monte-Carlo simulation of the systems containing a stack of 6 complementary base pairs and 180 water molecules has been performed. Characteristic of the hydration shell structure in major and minor grooves has been found for the stacks of repeating A : U and G : C base pairs as well as alternating (A : U, U : A) and (G : C, C : G) ones. Probabilities of the formation of bridges, formed by 1, 2 and 3 water molecules, between hydrophilic centres of the bases have been estimated. One water molecule forms an H-bonded bridge between two adjacent hydrophilic centres with high probability if N...N, N...O or O...O distance between these centres is close to 4.3 A. Hydration shell structure was found to depend significantly on the stack sequence and configuration, while global hydration characteristics (average energy, the number of water-water and water-base H-bonds) are only slightly dependent on the stack sequence and configuration. For the stacks in A conformation the number of water molecules forming more than one H-bonds with the bases is greater in comparison with the stacks in B-like conformation. This result is discussed in connection with the concept of hydration economy during B to A transition.     

Macrocyclic zinc(II) complexes for selective recognition of nucleobases in single- and double-stranded polynucleotides

 As an extension of our earlier discoveries that Zn^II-cyclen complex (1) (cyclen=1,4,7,10-tetraazacyclododecane) and Zn^II-acridine-pendant cyclen complex Zn^II-N-(9-acridin)ylmethyl-cyclen (3) are the first compounds to selectively recognize thymidine and uridine nucleosides in aqueous solution at physiological pH, the interaction of these and a relevant complex, bis(Zn^II-cyclen) (7), has been investigated with a series of polynucleotides, single-stranded poly(U) and poly(G), and double-stranded poly(A)·poly(U), poly(dA)·poly(dT) and poly(dG)·poly(dC). These Zn^II-cyclen complexes interact with the imide-containing nucleobases in the single-stranded poly(U), unperturbed by the presence of the anionic phosphodiester backbone. The affinity constant of 1 for each N(3)-deprotonated uracil base in poly(U) is determined to be log K= 5.1 by a kinetic measurement, which is almost the same as log K=5.2 for the interaction of 1 with uridine. Thus, they disrupt the A-U (or A-T) hydrogen bonds to unzip the duplex of poly(A)·poly(U) or poly(dA)·poly(dT), as demonstrated by lowering of the melting temperatures (T _m) of poly(A)·poly(U) and poly(dA)·poly(dT) in 5 mM Tris-HCl buffer (pH 7.6, 10 mM NaCl) with increase in their concentrations. The order of the denaturing efficiency is well correlated with that of the 1 : 1 affinity constants for each complex with uracil or thymine;7>3>1. The comparison of circular dichroism (CD) spectra for poly(A)·poly(U), poly(A), and poly(U) in the presence of 3 has revealed a structural change from poly(A)·poly(U) to two single strands, poly(A) and poly(U), caused by 3 binding exclusively to uracils in poly(U). On the other hand, the acridine-pendant cyclen complex 3, which earlier was found to associate with guanine by the Zn^II coordinating with guanine N(7), in addition to the π-π stacking, interacts with guanine in the double helix of poly(dG)·poly(dC) from outside and stabilized the double-stranded structure, as indicated by higher T _m. Received: 31 December 1997 / Accepted: 23 February 1998     

The nature of the transition mismatches with Watson–Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem

This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson–Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (?G?=?.99?kcal?mol^?1, population?=?15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε?=?4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε?=?4), characteristic for the hydrophobic interfaces of specific protein–nucleic acid interactions. We were first able to show that the G*·T?G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε?=?4 with lifetime of 6.4·10^?12?s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (?23.76?kcal?mol^?1) exceeds the analogical value for the G·C Watson–Crick nucleobase pair (?20.38?kcal?mol^?1), “escapes from the hands” of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So, exactly the G*·T mismatch was established to play the crucial role in the spontaneous point mutagenesis.     

Base Analogue Interactions in DNA Duplexes

Abstract

Oligodeoxyribonucleotides containing N⁴ -methoxycytosine (mo⁴ C) and its 5-methyl derivative (mo⁴ m⁵ C) are synthesised and used to compare the stabilities of duplexes containing mo⁴ C.A and mo⁴C.G base-pairs with those containing normal and mismatch pairs.     

Sequence and conformational effects on imino proton exchange in A.T- and A.U-containing DNA and RNA duplexes

¹H-nmr relaxation has been used to study the effect of sequence and conformation on imino proton exchange in adenine–thymine (A · T) and adenine–uracil (A · U) containing DNA and RNA duplexes. At low temperature, relaxation is caused by dipolar interactions between the imino and the adenine amino and AH2 protons, and at higher temperature, by exchange with the solvent protons. Although room temperature exchange rates vary between 3 and 12s^?1, the exchange activation energies (E_α) are insensitive to changes in the duplex sequence (alternating vs homopolymer duplexes), the conformation (B-form DNA vs A-form RNA), and the identity of the pyrimidine base (thymine vs uracil). The average value of the activation energy for the five duplexes studied, poly[d(A-T)], poly[d(A) · d(T)], poly[d(A-U)], Poly[d(A) · d(U)], and poly[r(A) · r(U)], was 16.8 ± 1.3 kcal/mol. In addition, we find that the average E_α for the A.T base pairs in a 43-base-pair restriction fragment is 16.4 ± 1.0 kcal/mol. This result is to be contrasted with the observation that the E_α of cytosine-containing duplexes depends on the sequence, conformation, and substituent groups on the purine and pyrimidine bases. Taken together, the data indicate that there is a common low-energy pathway for the escape of the thymine (uracil) imino protons from the double helix. The absolute values of the exchange rates in the simple sequence polymers are typically 3–10 times faster than in DNAs containing both A · T and G · C base pairs.     

Studies on interaction between poly(L-lysine) and DNA of varied G + C contents

Interaction between polylysine and DNA's of varied G + C contents was studied using thermal denaturation and circular dichroism (CD). For each complex there is one melting band at a lower temperature t_m, corresponding to the helix–coil transition of free base pairs, and another band at a higher temperature t′_m, corresponding to the transition of polylysine-bound base pairs. For free base pairs, with natural DNA's and poly(dA-dT) a linear relation is observed between the t_m and the G + C content of the particular DNA used. This is not true with poly(dG)·poly(dC), which has a t_m about 20°C lower than the extrapolated value for DNA of 100% G + C. For polylysine-bound base pairs, a linear relation is also observed between the t′_m and the G + C content of natural DNA's but neither poly(dA-dT) nor poly(dG)·poly(dC) complexes follow this relationship. The dependence of melting temperature on composition, expressed as dt_m/dX_G·C, where X_G·C is the fraction of G·C pairs, is 60°C for free base pairs and only 21°C for polylysine-bound base pairs. This reduction in compositional dependence of T_m is similar to that observed for pure DNA in high ionic strength. Although the t′_m of polylysine-poly(dA-dT) is 9°C lower than the extrapolated value for 0% G + C in EDTA buffer, it is independent of ionic strength in the medium and is equal to the t_m⁰ extrapolated from the linear plot of t_m against log Na⁺. There is also a noticeable similarity in the CD spectra of polylysine· and polyarginine·DNA complexes, except for complexes with poly(dA-dT). The calculated CD spectrum of polylysine-bound poly(dA-dT) is substantially different from that of polyarginine-bound poly(dA-dT).     

Asymmetry in forming 2-aminopurine . hydroxymethylcytosine heteroduplexes; A model giving misincorporation frequencies and rounds of DNA replication from base-pair populations in vivo

We present the first direct measurement of a transient mismatched base-pair in a 2-aminopurine-induced mutagenic pathway. We provide a model to calculate misincorporation rates in vivo from measured base-pair populations. The population of 2-aminopurine · hydroxymethylcytosine (AP · C²) base-pairs at a marker locus in T4 bacteriophage is measured as rII-r⁺ heteroduplex-heterozygotes in a modified single burst experiment after 2-aminopurine mutagenesis. This completes the determination of each of the base-pairs in the 2-aminopurine-induced A · T → G · C transition pathway for the marker rUV199. The observed AP · C population confirms a surprising model prediction that the probability of incorporating HMdCTP opposite a template 2-aminopurine is very large, approximately 2% per round of replication. AP induces A · T → G · C and G · C → A · T transitions at roughly the same rates. A quantitative comparison of 2-aminopurine-induced A · T → G · C and G · C → A · T transition pathways shows a marked asymmetry in the formation of AP · C base-pairs; the probability of forming AP · C base-pair intermediates in the A · T → G · C transition pathway is several orders of magnitude larger than in the G · C → A · T pathway. A set of analytic equations giving the population of each state of an allele undergoing 2-aminopurine mutagenesis (A · T, AP · T, AP · C and G · C) as a function of interstate (e.g. A · T → AP · T) and intrastate (e.g. A · T → A · T) transition rate constants and the number of rounds of replication is derived. The equations also demonstrate that a determination of $\text{AP}\text{·}\text{C}\text{G}\text{·}\text{C}$ base-pair ratios is a direct measure of the number of rounds of replication; thus the value of 0.35 AP · C per G · C base-pair as measured in this experiment reveals that there were eight to nine rounds of DNA replication during the mutagenesis treatment.     

Structural Studies of DNA Fragments: The G·T Wobble Base Pair in A,B and Z DNA; The G·A Base Pair in B-DNA

Abstract

The crystal structures of five double helical DNA fragments containing non-Watson-Crick complementary base pairs are reviewed. They comprise four fragments containing G·T base pairs: two deoxyoctamers d(GGGGCTCC) and d(GGGGTCCC) which crystallise as A type helices; a deoxydodecamer d(CGCGAATTTGCG) which crystallises in the B-DNA conformation; and the deoxyhexamer d(TGCGCG), which crystallises as a Z-DNA helix. In all four duplexes the G and T bases form wobble base pairs, with bases in the major tautomer forms and hydrogen bonds linking N1 of G with 02 of T and 06 of G with N3 of T. The X-ray analyses establish that the G·T wobble base pair can be accommodated in the A, B or Z double helix with minimal distortion of the global conformation. There are, however, changes in base stacking in the neighbourhood of the mismatched bases. The fifth structure, d(CGCGAATTAGCG), contains the purine purine mismatch G·A where G is in the anti and A in the syn conformation. The results represent the first direct structure determinations of base pair mismatches in DNA fragments and are discussed in relation to the fidelity of replication and mismatch recognition.     

Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases

N6-methyladenine (m⁶A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH₃. Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m⁶A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH₃ changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m⁶A:G and trans-m⁶A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m⁶A to cis-m⁶A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m⁶A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

The Structure of Triple Helical Poly(U)·Poly(A)·Poly(U) Studied by Raman Spectroscopy

Abstract

Using Raman spectroscopy, we examined the ribose-phosphate backbone conformation, the hydrogen bonding interactions, and the stacking of the bases of the poly(U)·poly(A) ·poly(U) triple helix. We compared the Raman spectra of poly(U)·poly(A)·poly(U) in H₂O and D₂O with those obtained for single-stranded poly(A) and poly(U) and for double-stranded poly(A)·poly(U). The presence of a Raman band at 863 cm^?1 indicated that the backbone conformations of the two poly(U) chains are different in the triple helix. The sugar conformation of the poly(U) chain held to the poly(A) by Watson-Crick base pairing is C3′ endo; that of the second poly(U) chain may be C2′ endo. Raman hypochromism of the bands associated with base vibrations demonstrated that uracil residues stack to the same extent in double helical poly(A)·poly(U) and in the triple-stranded structure. An increase in the Raman hypochromism of the bands associated with adenine bases indicated that the stacking of adenine residues is greater in the triple helix than in the double helical form. Our data further suggest that the environment of the carbonyls of the uracil residues is different for the different strands.