Static and dynamic conformational properties of AT sequences in B-DNA.

A theoretical study of the optimal conformations of nucleic acid oligomers containing tracts of AT base pairs is presented. The oligomers are studied in isolation and complexed with netropsin, a minor groove binding ligand. The flexibility of the oligomers and of their complexes is calculated by adiabatic mapping with respect to the total winding angle. The results of this study show that in uncomplexed oligomers the dinucleotide junctions AA, AT and TA have very different structural parameters and different responses to winding stress. The TA junction is clearly the most flexible and is the principal site for accommodating the imposed overwinding. Complexation by netropsin leads to two important effects: firstly, the three junctions adopt more uniform structures, the largest changes again being observed for TA, secondly, the differences in flexibility as a function of sequence are strongly attenuated.     

Binding of Non-Intercalating Antibiotics to B-DNA: A Theoretical Study Taking Into Account Nucleic Acid Flexibility

Abstract

A detailed theoretical study has been made for five antibiotics which all bind selectively to AT sequences in the minor groove of B-DNA: SN-18071, NSCT-101327, distamycin-2, distamycin-3 and netropsin. The optimal complexes were found for systems in which the flexibility of DNA, as well as that of the antibiotics, was taken into account. Explicit, mobile counterions and a dielectric function modelling aqueous solution were also included. The binding geometries of the most strongly interacting antibiotics, distamycin-3 and netropsin, are compared in considerable detail and it is shown that notable differences exist between them. The results for netropsin are also discussed in the light of recent disagreements concerning its exact binding location within DNA.     

A Theoretical Study of the Sequence Specificity in Binding of Lexitropsins to B-DNA

Abstract

A theoretical study is presented on the binding to B-DNA of a series of lexitropsins, these ligands being netropsin derivatives in which one or both of the pyrrole rings have been replaced by imidazoles. The best complexes have been located by energy minimisation taking into account nucleic acid flexibility, ligand flexibility, explicit, mobile counterions and solvent dielectric effects. Calculations have been performed for two homopolymeric DNA receptor sequences, AT and GC. All the compounds studied exhibit an overall binding preference for the AT base sequence, which only decreases in the imidazole derivatives. These results emphasize the decisive role of the molecular electrostatic potential of the nucleic acid in determining the sequence selectivity of these ligands, as opposed to the postulated role of adenine C2 - pyrrole β hydrogen contacts.     

Influence of Drug Binding on DNA Flexibility: A Normal Mode Analysis

Abstract

DNA-drug complexes are important because of their pharmacological interest but, in addition, they provide a useful model to study the essential aspects of DNA recognition processes. In order to investigate the influence of ligand binding on the dynamic properties of DNA we have carried out normal mode analysis for complexes with drugs of two types: a typical intercalator, 9-aminoacridine, and a typical groove binder, netropsin. Normal modes are analysed in terms of helicoidal parameter variations with special attention being paid to global deformations of the double helix. The results show that the influence of these two drugs is very different. Intercalation of 9-aminoacridine leads to an increase in the flexibility of the intercalated dinucleotide step, with notably larger vibrational amplitudes for both roll and twist parameters compared to free DNA. In contrast, the groove binding of netropsin induces a stiffening of the DNA segment which is in contact with the drug reflected by decreased vibrational amplitudes for backbone angles and inter base pair helicoidal parameters and an increase in vibrations for adjacent base pairs in terms of buckle and propeller twist.     

Theoretical Exploration of Netropsin Binding to tRNAPhe

Abstract

Theoretical exploration of the possible interaction of netropsin with tRNA^Phe indicates that binding should occur preferentially with the major groove of the TψC stem of the macromolecule, specifically with the bases G51, U52, G53 and phosphates 52, 53, 61 and 62. This agrees with the recent crystallographic result of Rubin and Sundaralingam. It is demonstrated that the difference with respect to netropsin binding with B-DNA, where it occurs specifically in the minor groove of AT sequences, is due to the differences in the distribution of the electrostatic molecular potential generated by these different types of DNA: this potential is sequence dependent in B-DNA (located in the minor groove of AT sequences and the major groove of GC sequences), while it is sequence independent and always located in the major groove in A-RNA. The result demonstrates the major role of electrostatics in determining the location of the binding site.     

Hairpin Polyamides That use Parallel and Antiparallel Side-by-Side Peptide Motifs in Binding to DNA

Abstract

Pt-bis-netropsin is a synthetic sequence-specific DNA-binding ligand comprizing two netropsin-like fragments which are linked in a tail-to-tail manner via a cis-diammineplat-inum (II) residue. The CD studies and thermodynamic characterization of the DNA-binding properties exhibited by this compound reveal that it forms two types of complexes with poly[d(AT)]?poly[d(AT)] and DNA oligomers containing nucleotide sequences 5′-CC (TA)_nCC-3′, with n = 4, 5 and 6. The first type corresponds to the binding of Pt-bis-netropsin in the extended conformation and is characterized by the saturating ratio of one bound Pt-bis-netropsin molecule per 9 AT-base pairs. The second type of the complex corresponds to the binding of Pt-bis-netropsin to DNA in the folded hairpin form. The binding approaches saturation level when one Pt-bis-netropsin molecule is bound per four or five AT-base pairs. The hairpin form of Pt-bis-netropsin complex is built on the basis of parallel side-by-side peptide motif which is inserted in the minor DNA groove. The CD spectral profiles reflecting the binding of Pt-bis-netropsin in the hairpin form are different from those observed for binding of another bis-netropsin with the sequence Lys-Gly-Py-Py-Gly-Gly-Gly-Py-Py-Dp, where Py is a N-propylpyrrole amino acid residue and Dp is a dimethylaminopropylamino residue. The hairpin form of this bis-netropsin is formed on the basis of antiparallel side- by-side peptide motif. The CD spectra obtained for complexes of this polyamide in the hairpin form with poly[dAT)]?poly[d(AT)] exhibit positive CD band with a peak at 325 nm, whereas the CD spectral profiles for the second complex of Pt-bis-Nt with poly[d(AT)] ?poly[d(AT)] and short DNA oligomers have two intense positive CD bands near 290 nm and 328 nm. This reflects the fact that two bis-netropsins use different structural motifs on binding to DNA in the hairpin form.     

Binding of non-intercalating antibiotics to B-DNA: a theoretical study taking into account nucleic acid flexibility

A detailed theoretical study has been made for five antibiotics which all bind selectively to AT sequences in the minor groove of B-DNA: SN-18071, NSC-101327, distamycin-2, distamycin-3 and netropsin. The optimal complexes were found for systems in which the flexibility of DNA, as well as that of the antibiotics, was taken into account. Explicit, mobile counterions and a dielectric function modelling aqueous solution were also included. The binding geometries of the most strongly interacting antibiotics, distamycin-3 and netropsin, are compared in considerable detail and it is shown that notable differences exist between them. The results for netropsin are also discussed in the light of recent disagreements concerning its exact binding location within DNA.     

FTIR Study of Specific Binding Interactions Between DNA Minor Groove Binding Ligands and Polynucleotides

Abstract

The use of FTIR spectroscopy is made to study the interactions between polynucleotides and two series of minor groove binding compounds. The latter were developed and described previously as part of an ongoing program of rational design of modified Ligands based on naturally occurring pyrrole amidine antibiotic netropsin, and varying the structure of bis- benzimidazole chromosomal stain Hoechst 33258. Characteristic IR absorptions due to the vibrations of thymidine and cytosine keto groups in polynucleotides containing AT and GC base pairs respectively are used to monitor their interaction with the added Ligands. Although the two thiazole based lexitropsins based on netropsin structure differ in the relative orientation of nitrogen and sulfur atoms with respect to the concave edge of the molecules, they interact exclusively with the thymidine C2=O carbonyl groups in the minor groove of the alternating AT polymer as evidenced by specific changes in the IR spectra.

In the second series of compounds based on Hoechst 33258, the structure obtained by replacing the two benzimidazoles in the parent compound by a combination of pyridoimidazole and benzoxazole, exhibits changes in the carbonyl frequency region of poly dG · poly dC which is attributed to the ligand interaction at the minor groove of GC base pairs. In contrast, Hoechst 33258 itself interacts only with poly dA · poly dT. Weak or no interaction exists between the Ligands and any of the polynucleotides at the levels of the phosphate groups or the deoxyribose units.     

Effects of netropsin on yeast mitochondria

Netropsin binds tightly to AT rich regions of DNA and correspondingly is an efficient inhibitor of mitochondrial DNA replication in $\text{Saccharomyces}\text{cerevisiae}$. Netropsin treatment does not cause formation of large populations of petite cells. However, a large portion of cells grown in cultures with ethanol as carbon source are killed by 1 μg/ml netropsin. When petite induction by berenil or ethidium bromide is carried out in the presence of netropsin, the petite cells are killed. This appears to be an effect of netropsin action on the cells during the process of petite formation.     

TIT for TAT: The Properties of Inosine and Adenosine in TATA Box DNA

Abstract

The sequence dependent conformation, flexibility and hydration properties of DNA molecules constitute selectivity determinants in the formation of protein-DNA complexes. TATA boxes in which AT basepairs (bp) have been substituted by IC bp (TITI box) allow for probing these selectivity determinants for the complexation with the TATA box-binding protein (TBP) with different sequences but identical chemical surfaces. The reference promoter Adenovirus 2 Major Late Promoter (mlp) is formed by the apposition of two sequences with very different dynamic properties: an alternating TATA sequence and an A-tract. For a comparative study, we carried out molecular dynamics simulations of two DNA oligomers, one containing the mlp sequence (2 ns), and the other an analog where AT basepairs were substituted by IC basepairs (1 ns). The simulations, carried out with explicit solvent and counteri-ons, yield straight purine tracts, the A-tract being stiffer than the I-tract, an alternating structure for the YRYR tracts, and hydration patterns that differ between the purine tracts and the alternating sequence tracts. A detailed analysis of the proposed interactions responsible for the stiffness of the purine tracts indicates that the stacking between the bases bears the strongest correlation to stiffness. The hydration properties of the minor groove in the two oligomers are distinctly different. Such differences are likely to be responsible for the stronger binding of TBP to mlp over the inosine-substituted variant. The calculations were made possible by the development, described here, of a new set of forcefield parameters for inosine that complement the published CHARMM all-hydrogen nucleic acid parametrization.     

Two Binding Modes of Netropsin are Involved in the Complex Formation with Poly(dA-dT)·Poly(dA-dT) and other Alternating DNA Duplex Polymers

Abstract

Using CD measurements we show that the interaction of netropsin to poly(dA-dT)·poly(dA-dT) involves two binding modes at low ionic strength. The first and second binding modes are distinguished by a defined shift of the CD maximum and the presence of characteristic isodichroic points in the long wavelength range from 313 nm to 325 nm. The first binding mode is independent of ionic strength and is primarily determined by specific interaction to dA·dT base pairs. Employing a netropsin derivative and different salt conditions it is demonstrated that ionic contacts are essential for the second binding mode. Other alternating duplexes and natural DNA also exhibit more or less a second step in the interaction with netropsin observable at high ratio of ligand per nucleotide. The second binding mode is absent for poly(dA)·poly(dT). The presence of a two-step binding mechanism is also demonstrated in the complex formation of poly(dA-dT)·poly(dA-dT) with the distamycin analog consisting of pentamethylpyrrolecarboxamide. While the binding mode I of netropsin is identical with its localization in the minor groove, for binding mode II we consider two alternative interpretations.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.     

Binding of Bis-linked Netropsin Derivatives in the Parallel-Stranded Hairpin Form to DNA

Abstract

Cis-diammine Pt(II)- bridged bis-netropsin and oligomethylene-bridged bis-netropsin in which two monomers are linked in a tail-to-tail manner bind to the DNA oligomer with the sequence 5′-CCTATATCC-3′ in a parallel-stranded hairpin form with a stoichiometry 1:1. The difference circular dichroism (CD) spectra characteristic of binding of these ligands in the hairpin form are similar. They differ from CD patterns obtained for binding to the same duplex of another bis-netropsin in which two netropsin moieties were linked in a head-to-tail manner. This reflects the fact that tail-to-tail and head-to-tail bis-netropsins use parallel and antiparallel side-by-side motifs, respectively, for binding to DNA in the hairpin forms. The binding affinity of cis -diammine Pt(II)- bridged bis-netropsin in the hairpin form to DNA oligomers with nucleotide sequences 5′-CCTATATCC-3′ (I), 5′-CCTTAATCC-3′ (II), 5′-CCTTATTCC-3′ (III), 5′-CCTTTTTCC-3′ (IV) and 5′-CCAATTTCC-3′ (V) decreases in the order I = II > III > IV> V. The binding of oligomethylene-bridged bis-netropsin in the hairpin form follows a similar hierarchy. An opposite order of sequence preferences is observed for partially bonded monodentate binding mode of the synthetic ligand.     

Oligodeoxynucleotide folding in solution: loop size and stability of B-hairpins

The secondary structures of the synthetic DNA fragments d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT) were investigated in a combined electrophoretic and spectroscopic study. All the oligomers exist, at low temperature and over a wide range of ionic strength (0.5-100 mM salt) and of nucleotide concentration [0.1-2.0 mM (phosphate)], as a mixture of two slowly interconverting species, identified as the dimeric duplex and the monomeric hairpin structure. The thermodynamic parameters for hairpin denaturation of T5, A5, TA, and AT and for duplex denaturation of d(CGCGCG) show that (a) the hairpins are more stable than the reference hexamer duplex at all accessible nucleotide concentrations; (b) the loop contributes favorably to the enthalpy change of hairpin denaturation in the four DNA fragments; (c) the base composition of the loop (A vs T) and the size of the loop (A5/T5 vs TA/AT) do not appreciably influence the enthalpic contents of the hairpins; (d) hairpins TA and AT, with two AT bases intervening in the CG self-complementary part of the molecule, exhibit a markedly higher thermal stability than hairpins T5 and A5, which is entropic in origin. These findings are consistent with the presence of two-residue loops in the tetradecamers TA and AT.     

Theoretical studies of the selective binding to DNA of two non-intercalating ligands: netropsin and SN 18071.

A theoretical study of the binding to DNA of netropsin and a bisquaternary ammonium heterocycle, SN 18071, is undertaken with an energy minimizing program based on empirical potential functions. The positioning of the ligand is achieved by force and torque calculations and its internal flexibility is taken into account. The binding preference of both drugs studied for the AT minor groove of B-DNA is shown to depend on both the electrostatic potential generated by the base sequence and the quality of the steric fit of the ligand in the groove. Ligand-DNA hydrogen bonds are shown to aid binding, but not to be essential in establishing binding preferences.     

Netropsin Specifically Recognizes One of the Two Conformationally Equivalent Strands of Poly (dA)·Poly (dT). One Dimensional NMR Study at 500 MHz Involving NOE Transfer Between Netropsin and DNA Protons

Abstract

Recent observations that the heteronomous structural model for poly(dA)·poly(dT) is not found in solution and that in this DNA, the two strands are conformationally equivalent (J. Biomole. Str. Dyns. 2, 1057 (1985)), has added a new dimension to the structural dynamics of DNA-netropsin complex. Does the antibiotic somehow distinguish between the two strands and specifically interact with only one of the conformationally equivalent strands?

Model-building studies suggest that netropsin can either bind to the dA-strand in the minor groove such that H-bonds are formed between the imino protons N4-H, N6-H, N8-H of netropsin and N3 atoms of A or can bind to the dT-strand in the minor groove and form H-bonds between the imino-protons N4-H, N6-H, N8-H of netropsin and O2 atoms of T. If netropsin binds to the dA-strand, AH2 atoms of poly(dA)-poly(dT) would be in closer proximity to the imino protrons N4-H, N6-H, N8-H and pyrrole ring protons C5-H, Cll-H of netropsin than they would be, if netropsin binds to the dT-strand. In order to distinguish these possibilities experiments were conducted which involved NOE energy transfer between netropsin and DNA protons in the drug-DNA complex. Difference NOE spectra of netropsin·poly(dA)-poly(dT) complex in which AH2 was irradiated indicate that dominant NOEs were observed at the imino and pyrrole ring protons of netropsin. When the netropsin pyrrole ring protons were irradiated, the magnetization transfer was at AH2 of DNA. These observations suggest that netropsin binds to the dA-strand of poly(dA)-poly(dT) even though dA/dT strands are conformationally equivalent.     

A theoretical study of the sequence specificity in binding of lexitropsins to B-DNA

A theoretical study is presented on the binding to B-DNA of a series of lexitropsins, these ligands being netropsin derivatives in which one or both of the pyrrole rings have been replaced by imidazoles. The best complexes have been located by energy minimisation taking into account nucleic acid flexibility, ligand flexibility, explicit, mobile counterions and solvent dielectric effects. Calculations have been performed for two homopolymeric DNA receptor sequences, AT base sequence, which only decreases in the imidazole derivatives. These results emphasize the decisive role of the molecular electrostatic potential of the nucleic acid in determining the sequence selectivity of these ligands, as opposed to the postulated role of adenine C2 - pyrrole beta hydrogen contacts.     

The Left-Handed Z-DNA Conformation in Oligodeoxynucleotides Containing Different Amounts of AT Base Pairs: A Far UV Circular Dichroism Study

Abstract

A number of fully self-complementary oligodeoxynucleotides have been synthesized and examined for their ability to assume the left-handed Z-DNA conformation in high salt solutions. The B- and Z-forms are identified by circular dichroism spectra, covering both the long-(220–300 nm) and short-wavelength (185–220 nm) regions, the latter showing CD bands very useful for identifying the sense of the helix winding. The main results of the study can be summarized as follows:

a) sequences composed by AT and CG blocks do support the B to Z transition, even when the AT contents amounts to 50%;

b) the occurrence of consecutive purine-purine or pyrimidine-pyrimidine dyads does not inhibit the B to Z transition, although a stronger reduction of water activity is required;

c) (AC)_n and (GT)_n containing oligonucleotides do undergo the B to Z transition in solution;

d) a millimolar quantity of Ni²⁺ concomitant with 5 M NaC10₄ is found to be very effective in bringing about the B to Z transition in most of the sequences considered in this study.     

Molecular Modelling Study of the Netropsin Complexation With a Nucleic Acid Triple Helix

Abstract

A detailed molecular mechanical study has been made on the complexes of netropsin with the double stranded oligonucleotide (dA)₁₂.(dT)₁₂ and with the triple helix (dA)₁₂.(dT)₁₂.(dT)₁₂. The complexes were built using computer graphics and energy refined using JUMNA program. In agreement with circular dichroïsm experiments we have shown that 3 netropsins can bind the minor grooves of the triple helix and of the double helix. The groove geometry in the duplex and in the triplex is very similar. However a detailed analysis of the energetic terms shows, in agreement with thermal denaturation studies, that the affinity of netropsin toward the double helices is larger than towards triple helices.