共查询到20条相似文献,搜索用时 15 毫秒
1.
Catalytic DNA cleavage reactions by an ATP-dependent deoxyribonuclease (DNase) from Micrococcus luteus were monitored directly with a DNA-immobilized 27-MHz quartz-crystal microbalance (QCM). The 27-MHz QCM is a very sensitive mass-measuring device in aqueous solution, as the frequency decreases linearly with increasing mass on the electrode at a nanogram level. Three steps in ATP-dependent DNA hydrolysis reactions, including (1) binding of DNase to the end of double-stranded DNA (dsDNA) on the QCM electrode (mass increase), (2) degradation of one strand of dsDNA in the 3' --> 5' direction depending on ATP (mass decrease), and (3) release of the enzyme from the nonhydrolyzed 5'-free-ssDNA (mass decrease), could be monitored stepwise from the time dependencies of QCM frequency changes. Kinetic parameters for each step were obtained as follows. The binding constant (K(a)) of DNase to the dsDNA was determined as (28 +/- 2) x 10(6) M(-)(1) (k(on) = (8.0 +/- 0.3) x 10(3) M (-)(1) s(-)(1) and k(off) = (0.29 +/-0.01) x 10(-)(3) s(-)(1)), and it decreased to (0.79 +/- 0.16) x 10(6) M(-)(1) (k'(on) = (2.3 +/- 0.2) x 10(3) M (-)(1) s(-)(1) and k'(off) = (2.9 +/- 0.1) x 10(-)(3) s(-)(1)) for the completely nonhydrolyzed 5'-free ssDNA. This is the reason the DNase bound to the dsDNA substrate can easily release from the nonhydrolyzed 5'-free-ssDNA after the complete hydrolysis of the 3' --> 5' direction of the complementary ssDNA. K(a) values depended on the DNA structures on the QCM, and the order of these values was as follows: the dsDNA having a 4-base-mismatched base-pair end (3) > the dsDNA having a 5' 15-base overhanging end (2) > the dsDNA having a blunt end (1) > the ssDNA having a 3'-free end (4) > the ssDNA having a 5'-free end (5). Thus, DNase hardly recognized the free 5' end of ssDNA. Michaelis-Menten parameters (K(m) for ATP and k(cat)) of the hydrolysis process also could be obtained, and the order of k(cat)/K(m) was as follows: the dsDNA having a blunt end (1) approximately the dsDNA having a 4-base-mismatched base-pair end (3) > the ssDNA having a free 3' end (4) > the ssDNA having a free 5' end (5). Thus, DNase could not recognize and not hydrolyze the free 5' end of ssDNA. The DNA hydrolysis reaction could be driven by dATP and GTP (purine base) as well as ATP, whereas the cleavage efficiency was very low driven with UTP, CTP (pyrimidine base), ADP, and AMP. 相似文献
2.
A minimal kinetic mechanism for a trans-acting ribozyme derived from the HDV antigenomic RNA self-cleaving element was established from steady-state, pre-steady-state, single-turnover, and binding kinetics. Rate constants for individual steps, including substrate binding and dissociation, cleavage, and product release and binding, were measured at 37 degrees C at pH 8.0 in 10 mM Mg(2+) using oligonucleotides as either substrates, noncleavable analogues or 3' product mimics. A substrate containing a normal 3',5'-linkage was cleaved with a first-order rate constant (k(2)) of 0.91 min(-)(1). The association rate constant for the substrate to the ribozyme (2.1 x 10(7) M(-)(1) min(-)(1)) was at the lower range of the expected value for RNA duplex formation, and the substrate dissociated with a rate constant (1.4 min(-)(1)) slightly faster than that for cleavage. Thus the binary complex was not at equilibrium with free enzyme and substrate prior to the cleavage step. Following cleavage, product release was kinetically ordered in that the 5' product was released rapidly (>12 min(-)(1)) relative to the 3' product (6.0 x 10(-)(3) min(-)(1)). Rapid 5' product release and lack of a demonstrable binding site for the 5' product could contribute to the difficulty in establishing the ribozyme-catalyzed reverse reaction (ligation). Slow release of the 3' product was consistent with the extremely low turnover under steady-state conditions as 3' product dissociation was rate-limiting. The equilibrium dissociation constant for the substrate was 24-fold higher than that of the 3' cleavage product. A substrate with a 2',5'-linkage at the cleavage site was cleaved with a rate constant (k(2)) of 1.1 x 10(-)(2) min(-)(1). Thus, whereas cleavage of a 3',5'-linkage followed a Briggs-Haldane mechanism, 2', 5' cleavage followed a Michaelis-Menten mechanism. 相似文献
3.
F Helling R D Dennis B Weske G Nores J Peter-Katalinic U Dabrowski H Egge H Wiegandt 《European journal of biochemistry》1991,200(2):409-421
A group of Calliphora vicina pupal glycolipids could be segregated from the neutral glycosphingolipids, according to their two-dimensional TLC migration properties and positive reactions toward ninhydrin and fluorescamine spray reagents. These classified zwitterionic glycolipids were isolated by silica-gel column chromatography and characterized by the presence of a N-acetyl-glucosamine-bound phosphoethanolamine residue. The structural elucidation of the oligosaccharide moieties was performed by the determination of constituent carbohydrates as alditol acetates, linkage analysis by permethylation, exoglycosidase cleavage, fast-atom-bombardment mass spectrometry and NMR spectroscopy. The dominant fatty acid and sphingoid base species of the ceramide moieties were C20:0 (arachidic acid) and C14:1 (tetradecasphing-4-enine), respectively. The chemical structures of the zwitterionic, biogenetic glycosphingolipid series were determined as: (PEtn-6')GlcNAc(beta 1-3)Man(beta 1-4)Glc beta Cer; GalNAc(beta 1-4)(PEtn-6')GlcNAc(beta 1-3)Man(beta 1-4)Glc beta Cer; GalNAc(alpha 1-4)GalNAc(beta 1-4)(PEtn-6')GlcNAc(beta 1-3)Man(beta 1- 4)Glc beta Cer; Gal(beta 1-3)GalNAc(beta 1-4)(PEtn-6')GlcNAc(beta 1-3)Man(beta 1-4)Glc beta Cer; Gal(beta 1-3)GalNAc(alpha 1-4)GalNAc(beta 1-4)(PEtn-6')GlcNAc(beta 1- 3)Man(beta 1-4)Glc beta Cer; GlcNAc(beta 1-3)Gal(beta 1-3)GalNAc(alpha 1-4)GalNAc(beta 1-4)(PEtn- 6')GlcNAc(beta 1-3)Man(beta 1-4)Glc beta Cer. 相似文献
4.
A simple selective method for determination of ascorbic acid using polymerized direct blue 71 (DB71) is described. Anodic polymerization of the azo dye DB71 on glassy carbon (GC) electrode in 0.1M H(2)SO(4) acidic medium was found to yield thin and stable polymeric films. The poly(DB71) films were electroactive in wide pH range (1-13). A pair of symmetrical redox peaks at a formal redox potential, E('0)=-0.02V vs. Ag/AgCl (pH 7.0) was observed with a Nernstian slope -0.058V, is attributed to a 1:1 proton+electron involving polymer redox reactions at the modified electrode. Scanning electron microscope (SEM), atomic force microscope (AFM) and electrochemical impedance spectroscopy (EIS) measurements were used for surface studies of polymer modified electrode. Poly(DB71) modified GC electrode showed excellent electrocatalytic activity towards ascorbic acid in neutral buffer solution. Using amperometric method, linear range (1x10(-6)-2x10(-3)M), dynamic range (1x10(-6)-0.01M) and detection limit (1x10(-6)M, S/N=3) were estimated for measurement of ascorbic acid in pH 7.0 buffer solution. Major interferences such as dopamine and uric acid are tested at this modified electrode and found that selective detection of ascorbic acid can be achieved. This new method successfully applied for determination of ascorbic acid in commercial tablets with satisfactory results. 相似文献
5.
6.
Group II introns self-splice via a two-step mechanism: cleavage at the 5' splice site followed by exon ligation at the 3' splice site. The second step has been difficult to study in vitro because it is generally faster than the first. Herein we describe development and partial kinetic characterization of a novel assay for studying the second step in isolation. In this system, a truncated linear intron (nucleotides 1-881) mediates exon ligation between two oligonucleotide substrates: a 19 nt 5' exon and a 3' substrate consisting of the last 6 nucleotides of the intron plus a 6 nucleotide 3' exon. We found that neither the exact structure of domain 6 nor the identity of nucleotides flanking the 3' splice site is critical for accurate 3' splice site choice by the ai5gamma group II intron. The multiple turnover k(cat) (0.14 min(-)(1)) is slower than the single turnover k(obs) (0.6-0.7 min(-)(1)), consistent with rate-limiting product release under steady-state conditions. Decreased single turnover rates at lower pHs were more consistent with loss of catalytic activity than with rate-limiting chemistry. Binding of the 3' substrate (K(m) = 2.6 microM) could be improved by changing a long-range A:U base pair involving the last intronic nucleotide (the gamma-gamma' interaction) to G:C (K(m(3)(')(substrate)) = 1 microM). 相似文献
7.
Cooreman P Thoelen R Manca J vandeVen M Vermeeren V Michiels L Ameloot M Wagner P 《Biosensors & bioelectronics》2005,20(10):2151-2156
In the work reported here, we investigated the interaction between the semiconducting polymer MDMO-PPV and antibodies against the fluorescent dyes fluorescein isothiocyanate (FITC) and Cy5. The antibodies are adsorbed physically onto thin polymer films on gold electrodes, as seen in AFM images of these films. By tuning the antibody concentration, the contact angle of distilled water with the film can be made to vary between 95 degrees and 50 degrees, showing that different surface densities of antibody can be obtained. That these biosensor films specifically bind their antigenic fluorescent molecules from PBS buffer solution is demonstrated by confocal fluorescence microscopy. Specific antigen-antibody recognition is demonstrated by lack of cross-sensitivity between the two antibodies and their antigens. In a biosensor prototype based on differential impedance spectroscopy, these polymer films show a clear response to 1 ppb antigen solution, with a time constant of 2-3 min. 相似文献
8.
The fabrication of Bacillus subtilis endospore imprinted conducting polymer films and subsequent electrochemical detection of bound spores is reported. Imprinted films were prepared by absorbing spores on the surface of glassy carbon electrodes upon which a polypyrrole, followed by a poly(3-methylthiophene), layer were electrochemically deposited. Spore template release was achieved through soaking the modified electrode in DMSO. Binding of endospores to imprinted films could be detected via impedance spectroscopy by monitoring changes in Y' (susceptance) using Mn(II)Cl2 (0.5M pH 3) as the supporting electrolyte. Here, the change in Y' could be correlated to spore densities between 10(4) and 10(7)cfu/ml. More sensitive detection of absorbed spores was achieved by following endospore germination via changes in film charge as measured using cyclic voltammetry. Here, imprinted films were submerged in spore suspensions to permit absorption, heat activated at 70 degrees C for 10 min prior to transferring to an electrochemical cell containing germination activators. By using the assay format it was possible to detect 10(2)cfu/ml. The observed changes in film charge could be attributed to the interaction of the supporting conducting polymer with dipicolinic acid (DPA) and other constituents released from the core in the course of germination. In all cases, it was not possible to regenerate the imprinted films without losing electrode response. In summary, the study has provided proof-of-concept for fabricating microbial imprinted films using conducting polymers. 相似文献
9.
Acyclic hydroxy carotenoids were produced from lycopene and 3,4-didehydrolycopene in Escherichia coli by combining different carotenogenic genes including the carotene hydratase gene crtC and the carotene 3,4-desaturase gene crtD. The genes originated either from Rhodobacter species or Rubrivivax gelatinosus. It was shown that the product of crtD from Rubrivivax unlike the one from Rhodobacter is able to convert 1-HO-3,4-didehydrolycopene to 1-HO-3,4,3',4'-tetradehydrolycopene (=3,4,3',4'-tetradehydro-1,2-dihydro-psi,psi-caroten-1-ol). Thus, only when the desaturase from Rubrivivax is expressed can this novel carotenoid be obtained. In the presence of crtC from Rubrivivax, another carotenoid 1,1'-(HO)(2)-3,4-didehydrolycopene (=3,4-didehydrolycopene-1,2,1',2'-tetrahydro-psi,psi-caroten-1,1'-diol) not found in a non-transgenic organism before is formed in E. coli. Its accumulation under these conditions and its absence when crtC from Rubrivivax is replaced by the corresponding gene from Rhodobacter is discussed. The function of the different crtC and crtD genes in the pathway leading to the individual carotenoids is outlined. Since 1,1'-(HO)(2)-3,4-didehydrolycopene could not be produced in substantial amounts and 1-HO-3,4,3',4'-tetradehydrolycopene has not been described before, their structural characteristics were determined for the definite assignment of their identity. This included spectral properties, determination of relative molecular mass as well as the number of hydroxy groups by mass spectroscopy and NMR spectroscopy for 1,1'-(HO)(2)-3,4-didehydrolycopene. 相似文献
10.
Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups. 总被引:4,自引:4,他引:0
下载免费PDF全文
![点击此处可从《Nucleic acids research》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates. 相似文献
11.
The pH- and time-dependent reaction of the anticancer drug carboplatin, [Pt(cbdca-kappa(2)O,O')(NH(3))(2)] (cbdca=cyclobutane-1,1-dicarboxylate), with the tripeptides H-glyglymet-OH (glycylglycyl-L-methionine) and Ac-glyglymet-OH at 313 K was investigated by high-performance liquid chromatography, NMR and mass spectrometry. The relative stability of the initial ring-opened kappaS complex [Pt(cbdca-kappaO)(Ac-glyglymet-OH-kappaS)(NH(3))(2)] leads to increased formation of the kinetically favoured kappaS:kappaS' bis-adduct [Pt(Ac-glyglymet-OH-kappaS)(2)(NH(3))(2)](2+) in comparison with cisplatin. As a result a second 1:2 reaction pathway kappaS-->kappaS:kappaS'-->kappa(2)N(M), S:kappaS'-->kappa(3)N(G2),N(M), S:kappaS', where N(M) and N(G2) represent, respectively, metallated methionine and glycine nitrogen atoms, competes with the 1:1 route kappaS-->kappa(2)N(M), S-->kappa(3)N(G2),N(M), S also observed for cisplatin. Cleavage of N-acetylglycine at the backbone C(O)-N bond to the second gly residue (G2) is observed after 100 h for the respective tridentate complexes [Pt(Ac-glyglyH(-1)metH(-1)-OH-kappa(3)N(G2),N(M), S) (Ac-glyglymet-OH-kappaS)] and [Pt(Ac-glyglyH(-1)metH(-1)-OH-kappa(3)N(G2),N(M), S)(NH(3))] at pH <5.2. The longevity of the initial kappaS complex leads to about an eight-fold increase in the rate of formation of the kappaN7:kappaN7' bis-adduct [Pt(5'-GMP-kappaN7)(2)(NH(3))(2)](2-) for the reaction of carboplatin with 5'-GMP(2-) at pH 7 in the presence of Ac-glyglymet-OH. A mixed-ligand kappaS:kappaN7 species [Pt(5'-GMP-kappaN7)(Ac-glyglymet-OH-kappaS)(NH(3))(2)] provides the major precursor for this 1:2 nucleotide complex and kappaN7 coordination of 5'-GMP(2-) is also observed in the kappa(2)N(M),S:kappaN7 complex [Pt(5'-GMP-kappaN7)(Ac-glyglymetH(-1)-OH-kappa(2)N(M),S)(NH(3))(2)](-) formed by substitution of the ammine ligand trans to the methionine sulphur. As the intermediate kappaS:kappaN7 species is formed rapidly within the first 10 h of reaction, these results suggest that the transfer reaction pathway kappaS-->kappaS:kappaN7-->kappaN7:kappaN7' involving kappaS platinated peptides could play an important role in accelerating the rate of DNA binding for carboplatin. 相似文献
12.
13.
14.
R W Miller R R Eady S A Fairhurst C A Gormal B E Smith 《European journal of biochemistry》2001,268(3):809-818
Stable inactive 2 : 1 complexes of the Klebsiella pneumoniae nitrogenase components (Kp2/Kp1) were prepared with ADP or the fluorescent ADP analogue, 2'(3')-O-[N-methylanthraniloyl] ADP and AlF(4)(-) or BeF(3)(-) ions. By analogy with published crystallographic data [Schindelin et al. (1997) Nature 387, 370-376)], we suggest that the metal fluoride ions replaced phosphate at the two ATP-binding sites of the iron protein, Kp2. The beryllium (BeF(x)) and aluminium (AlF(4)(-)) containing complexes are proposed to correspond to the ATP-bound state and the hydrolytic transition states, respectively, by analogy with the equivalent complexes of myosin [Fisher et al. (1995) Biochemistry 34, 8960-8972]. (31)P NMR spectroscopy showed that during the initial stages of complex formation, MgADP bound to the complexed Kp2 in a manner similar to that reported for isolated Kp2. This process was followed by a second step that caused broadening of the (31)P NMR signals and, in the case of the AlF4- complex, slow hydrolysis of some of the excess ADP to AMP and inorganic phosphate. The purified BeFx complex contained 3.8 +/- 0.1 MgADP per mol Kp1. With the AlF(4)(-) complex, MgAMP and adenosine (from MgAMP hydrolysis) replaced part of the bound MgADP although four AlF(4)(-) ions were retained, demonstrating that full occupancy by MgADP is not required for the stability of the complex. The fluorescence emission maximum of 2'(3')-O-[N-methylanthraniloyl] ADP was blue-shifted by 6-8 nm in both metal fluoride complexes and polarization was 6-9 times that of the free analogue. The fluorescence yield of bound 2'(3')-O-[N-methylanthraniloyl] ADP was enhanced by 40% in the AlF(4)(-) complex relative to the solvent but no increase in fluorescence was observed in the BeFx complex. Resonance energy transfer from conserved tyrosine residues located in proximity to the Kp2 nucleotide-binding pocket was marked in the AlF(4)(-) complex but minimal in the BeFx fluoride complex, illustrating a clear conformational difference in the Fe protein of the two complexes. Our data indicate that complex formation during the nitrogenase catalytic cycle is a multistep process involving at least four conformational states of Kp2: similar to the free Fe protein; as initially complexed with detectable (31)P NMR; as detected in mature complexes with no detectable (31)P NMR; in the AlF(4)(-) complex in which an altered tyrosine interaction permits resonance energy transfer with 2'(3')-O-[N-methylanthraniloyl] ADP. 相似文献
15.
Forty-eight RNA duplexes were constructed that contained all common single base bulges at six different locations. The stabilities of the RNAs were determined by temperature gradient gel electrophoresis (TGGE). The relative stability of a single base bulge was dependent on both base identity and the nearest neighbor context. The single base bulges were placed into two categories. A bulged base with no identical neighboring base was defined as a Group I base bulge. Group II-bulged bases had at least one neighboring base identical to it. Group II bulges were generally more stable than Group I bulges in the same nearest neighbor environments. This indicates that position degeneracy of an unpaired base enhances stability. Differences in the mobility transition temperatures between the RNA fragments with bulges and the completely base-paired reference RNAs were related to free energy differences. Simple models for estimating the free energy contribution of single base bulges were evaluated from the free energy difference data. The contribution of a Group I bulge 5'-(XNZ)-3'.5'-(Z'-X')-3' where N is the unpaired base and X.X' and Z.Z' the neighboring base pairs, could be well-represented (+/-0.34 kcal/mol) by the equation, DeltaG((X)(N)()(Z))(.)((Z)(')(-)(X)(')()) = 3.11 + 0. 40DeltaG(s)()((XZ))(.)((Z)(')(X)(')()). DeltaG(s)()((XZ))(. )((Z)(')(X)(')()) is the stacking energy of the closing base pair doublet. By adding a constant term, delta = -0.3 kcal/mol, to the right side of the above equation, free energies of Group II bulges could also be predicted with the same accuracy. The term delta represents the stabilizing effect due to position degeneracy. A similar equation/model was applied to previous data from 32 DNA fragments with single base bulges. It predicted the free energy differences with a similar standard deviation. 相似文献
16.
By immobilizing synthesized Mn-TPAA (TPAA=tris[2-[N-(2-pyridylmethyl) amino] ethyl] amine) on TiO(2) nanoneedle surface, a biosensor for superoxide ion (O(2)(-)) has been developed and applied for determination of O(2)(-) released from living cells. Direct electron transfer of Mn-TPAA is realized with a formal redox potential (E°') falling in the range of the E°' values of the redox couples O(2)/O(2)(-) and O(2)(-)/H(2)O(2). This suggests that Mn-TPAA on TiO(2) films is electrochemically active and capable of thermodynamically mediating both the oxidation of O(2)(-) to O(2) and the reduction of O(2)(-) to H(2)O(2). Therefore, Mn-TPAA immobilized on the TiO(2) films can be used electrochemically for determination of O(2)(-) due to its electrochemical activities and biomimetic catalytic activities like superoxide dismutase (SOD) toward O(2)(-). The present biomimetic O(2)(-) sensor shows high selectivity at the low working potential of 0V vs. Ag|AgCl, a wide linear range from 10(-7)M to 10(-4)M and a quick response time within 6s. By taking advantage of the developed method and the properties of biomimetic SOD themselves, we have realized the real-time monitoring of O(2)(-) concentration released from living cells and investigated the relationship between the concentration changes of O(2)(-) and intracelluar Ca(2+), which may gain additional insights on the reactive oxygen species (ROS) signal transduction and other physiological and pathological events. 相似文献
17.
Self-assembled multilayers comprised of alternate layers of polyphenol oxidase (PPO) and poly(allylamine) (PAH) or PPO and poly(diallyldimethylamine) (PDDA), deposited on a 3-mercaptopropanesulfonic acid (MPS)-modified gold surface, were studied "in-situ" (under water) by means of ellipsometry and quartz crystal microbalance (QCM), and "ex-situ" (in open air) by ellipsometry and fourier transform infrared reflection-absorption spectroscopy (FT-IRRAS). Optical ellipsometric properties of (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) multilayers were obtained at two wavelengths, employing an isotropic single-layer model with the substrate parameters measured after thiol adsorption. Film thickness as well as ellipsometric mass values based on the de Feijter equation were also evaluated. The quartz crystal impedance analysis showed that self-assembled multilayers behaved as acoustically thin films, and therefore, the shifts observed in the film inductive impedance parameter were interpreted in terms of gravimetric mass. The enzyme mass up-take in each adsorption step was determined on PAH or on PDDA topmost layer. A comparative study between the ellipsometric thickness and acoustic mass values allowed us to obtain average values of "apparent" densities of (2.1 +/- 0.1) and (2.4 +/- 0.1) g cm(-3) for (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) multilayers, respectively. The content of water included in the open polymer-enzyme structure was evaluated by comparison of QCM and ellipsometric mass values. FT-IRRAS spectra of each layer in (PAH)(n)(PPO)(n) and (PDDA)(n)(PPO)(n) films were recorded, and the intensity ratio of the amide bands was evaluated to obtain information about layer-by-layer enzyme conformation. An enzyme/polycation distribution model for (PAH)(n)(PPO)(n)and (PDDA)(n)(PPO)(n) multilayer structures is presented on the basis of combined ellipsometric, QCM, and FT-IRRAS results. 相似文献
18.
J F Gaucher M Selkti G Tiraboschi T Prangé B P Roques A Tomas M C Fournié-Zaluski 《Biochemistry》1999,38(39):12569-12576
Three alpha-mercaptoacyldipeptides differing essentially in the size of their C-terminal residues have been crystallized in the thermolysin active site. A new mode of binding was observed for 3 [HS-CH(CH(2)Ph)CO-Phe-Tyr] and 4 [HS-CH((CH(2))(4)CH(3))CO-Phe-Ala], in which the mercaptoacyl moieties act as bidentates with Zn-S and Zn-O distances of 2.3 and 2.4 A, respectively, the side chains fitting the S(1), S(1)', and S(2)' pockets. Moreover, a distance of 3.1 A between the sulfur atom and the OE1 of Glu(143) suggests that they are H-bonded and that one of these atoms is protonated. This H-bond network involving Glu(143), the mercaptoacyl group of the inhibitor, and the Zn ion could be considered a "modified" transition state mimic of the peptide bond hydrolysis. Due to the presence of the hindering (5-phenyl)proline, the inhibitor HS-CH(CH(2)Ph)CO-Gly-(5-Ph)Pro (2) interacts through the usual Zn monodentation via the thiol group and occupancy of S(1)' and S(2)' subsites by the aromatic moieties, the proline ring being outside the active site. The inhibitory potencies are consistent with these structural data, with higher affinities for 3 (4.2 x 10(-)(8) M) and 4 (4.8 x 10(-)(8) M) than for 2 (1.2 x 10(-)(6) M). The extension of the results, obtained with thermolysin being considered as the model of physiological zinc metallopeptidases, allows inhibitor-recognition modes for other peptidases, such as angiotensin converting enzyme and neutral endopeptidase, to be proposed and opens interesting possibilities for the design of new classes of inhibitors. 相似文献
19.
G Floyd-Smith 《Analytical biochemistry》1991,192(2):268-276
A latent endoribonuclease, RNase L, binds to and is activated by (2'-5')oligoadenylates ((2'-5')(A)n, n = 2-15). Binding to a labeled derivative of (2'-5')(A)n, [32P](2'-5')(A)3pCp, is detected as a protein-ligand complex observed following nondenaturing polyacrylamide gel electrophoresis. One major binding complex and two minor binding complexes are readily seen in cytoplasmic extracts from Ehrlich ascites tumor cells, murine tissue extracts and rabbit liver tissue extracts. At least one of the more rapidly migrating complexes appears to be a proteolytic degradation product of the larger [32P](2'-5')(A)3pCp binding protein. Cell and tissue extracts containing [32P](2'-5')(A)3pCp binding activity can be immobilized onto nitrocellulose filters and [32P](2'-5')(A)3pCp binding activity detected using a simple, rapid, economical affinity blot assay. Detection of [32P](2'-5')(A)3pCp binding proteins following electrophoresis on nondenaturing polyacrylamide gels and the affinity blot assay significantly improve and simplify the analysis of (2'-5')(A)n binding proteins. 相似文献
20.
Sproviero EM Gascon JA McEvoy JP Brudvig GW Batista VS 《Journal of inorganic biochemistry》2006,100(4):786-800
The capabilities and limitations of the Becke-3-Lee-Yang-Parr (B3LYP) hybrid density functional are investigated as applied to studies of mixed-valent multinuclear oxomanganese complexes. Benchmark calculations involve the analysis of structural, electronic and magnetic properties of di-, tri- and tetra-nuclear Mn complexes, previously characterized both chemically and spectroscopically, including the di-mu-oxo bridged dimers [Mn(III)Mn(IV)(mu-O)(2)(H(2)O)(2)(terpy)(2)](3+) (terpy=2,2':6,2'-terpyridine) and [Mn(III)Mn(IV)(mu-O)(2)(phen)(4)](3+) (phen=1,10-phenanthroline), the Mn trimer [Mn(3)O(4)(bpy)(4)(H(2)O)(2)](4+) (bpy=2,2'-bipyridine), and the tetramer [Mn(4)O(4)L(6)](+) with L=Ph(2)PO(2)(-). Furthermore, the density functional theory (DFT) B3LYP level is applied to analyze the hydrated Mn(3)O(4)CaMn cluster completely ligated by water, OH(-), Cl(-), carboxylate and imidazole ligands, analogous to the '3+1 Mn tetramer' of the oxygen-evolving complex of photosystem II. It is found that DFT/B3LYP predicts structural and electronic properties of oxomanganese complexes in pre-selected spin-electronic states in very good agreement with X-ray and magnetic experimental data, even when applied in conjunction with rather modest basis sets. However, it is conjectured that the energetics of low-lying spin-states is beyond the capabilities of the DFT/B3LYP level, constituting a limitation to mechanistic studies of multinuclear oxomanganese complexes where until now the performance of DFT/B3LYP has raised little concern. 相似文献