Complexes of DNA hairpins and a single-stranded oligonucleotide detected by affinity chromatography and mung bean nuclease cleavage

The emergence of a simple translation device consisting of an assembler strand (primordial mRNA) and RNA hairpins (primordial tRNA) is presumed to be an important step leading to the origin of life. The assumption of a non-enzymatic interaction of primordial tRNA and mRNA is experimentally approached. DNA hairpins containing five or more adenosine residues in the loop are able to bind to complementary oligonucleotides covalently bound to cellulose. The exact number of base pairs formed between the hairpins and the assembler strand is determined by two methods applied to DNA hairpin/assembler complexes. The melting temperature of a complex is measured and the cleavage pattern by nuclease from mung bean is determined. The loop of the smallest hairpin able to bind consists of five adenosine residues and only three base pairs are formed. This supports the idea of a primordial recognition similar to the contemporary codon-anticodon interaction.     

Isolation and characterization of thermodynamically stable and unstable RNA hairpins from a triloop combinatorial library

Hairpins are the most common elements of RNA secondary structure, playing important roles in RNA tertiary architecture and forming protein binding sites.Triloops are common in a variety of naturally occurring RNA hairpins, but little is known about their thermodynamic stability. Reported here are the sequences and thermodynamic parameters for a variety of stable and unstable triloop hairpins. Temperature gradient gel electrophoresis (TGGE) can be used to separate a simple RNA combinatorial library based on thermal stability [Bevilacqua, J. M., and Bevilacqua, P. C. (1998) Biochemistry 45, 15877-15884]. Here we introduce the application of TGGE to separating and analyzing a complex RNA combinatorial library based on thermal stability, using an RNA triloop library. Several rounds of in vitro selection of an RNA triloop library were carried out using TGGE, and preferences for exceptionally stable and unstable closing base pairs and loop sequences were identified. For stable hairpins, the most common closing base pair is CG, and U-rich loop sequences are preferred. Closing base pairs of GC and UA result in moderately stable hairpins when combined with a stable loop sequence. For unstable hairpins, the most common closing base pairs are AU and UG, and U-rich loop sequences are no longer preferred. In general, the contributions of the closing base pair and loop sequence to overall hairpin stability appear to be additive. Thermodynamic parameters for individual hairpins determined by UV melting are generally consistent with outcomes from selection experiments, with hairpins containing a CG closing base pair having a DeltaDeltaG degrees (37) 2.1-2.5 kcal/mol more favorable than hairpins with other closing base pairs. Sequences and thermodynamic rules for triloop hairpins should aid in RNA structure prediction and determination of whether naturally occurring triloop hairpins are thermodynamically stable.     

Visualization of the cruciform structure of superhelical DNA by use of atomic force microscopy

Atomic force microscopy was used to visualize the cruciform structure in supercoiled plasmid pUC8 DNA immobilized on aminomodified mica. The cruciform hairpin was 14 base pairs in size, as determined from atomic force microscopy images of pUC8 DNA in air. Molecular modeling confirmed that the cruciform structure is formed by hairpins with self-complementary homopyrimidine-homopurine sequences (dT)8(dA)6 and a loop 4 nucleotides long.     

Perturbation of DNA hairpins containing the EcoRI recognition site by hairpin loops of varying size and composition: physical (NMR and UV) and enzymatic (EcoRI) studies.

We have investigated loop-induced structural perturbation of the stem structure in hairpins d(GAATTCXnGAATTC) (X = A, T and n = 3, 4, 5 and 6) that contain an EcoRI restriction site in close proximity to the hairpin loop. Oligonucleotides containing either a T3 or a A3 loop were not hydrolyzed by the restriction enzyme and also showed only weak binding to EcoRI in the absence of the cofactor Mg2+. In contrast, hairpins with larger loops are hydrolyzed by the enzyme at the scission site next to the loop although the substrate with a A4 loop is significantly more resistant than the oligonucleotide containing a T4 loop. The hairpin structures with 3 loop residues were found to be thermally most stable while larger hairpin loops resulted in structures with lower melting temperatures. The T-loop hairpins are thermally more stable than the hairpins containing the same number of A residues in the loop. As judged from proton NMR spectroscopy and the thermodynamic data, the base pair closest to the hairpin loop did form in all cases studied. The hairpin loops did, however, affect the conformation of the stem structure of the hairpins. From 31P and 1H NMR spectroscopy we conclude that the perturbation of the stem structure is stronger for smaller hairpin loops and that the extent of the perturbation is limited to 2-3 base pairs for hairpins with T3 or A4 loops. Our results demonstrate that hairpin loops modulate the conformation of the stem residues close to the loop and that this in turn reduces the substrate activity for DNA sequence specific proteins.     

MS2 RNA has a potential to form an unusually large number of stable hairpins

Several long nucleotide sequences were analysed to find out if any of them are unusual in terms of the possible formation of “hairpins” (pairs of complementary runs of nucleotides forming double-stranded structures) as compared to random sequences. The RNA of MS2 bacteriophage has more potential hairpins with short loops (up to 10 bases in a loop) than found in random sequences with the same length and base composition. Other analyzed nucleotide sequences (SV40, φX174, Fd and 16S rRNA) behaved very much as their corresponding random ones. Most of the extra hairpins of the MS2 RNA are estimated to be thermodynamically stable. These potential hairpins might play some role in the function of the MS2 RNA.     

Melting studies of short DNA hairpins: Influence of loop sequence and adjoining base pair identity on hairpin thermodynamic stability

Spectroscopic and calorimetric melting studies of 28 DNA hairpins were performed. These hairpins form by intramolecular folding of 16 base self‐complementary DNA oligomer sequences. Sequence design dictated that the hairpin structures have a six base pair duplex linked by a four base loop and that the first five base pairs in the stem are the same in every molecule. Only loop sequence and identity of the duplex base pair closing the loop vary for the set of hairpins. For these DNA samples, melting studies were carried out to investigate effects of the variables on hairpin stability. Stability of the 28 oligomers was ascertained from their temperature‐induced melting transitions in buffered 115 mM Na⁺ solvent, monitored by ultraviolet absorbance and differential scanning calorimetry (DSC). Experiments revealed the melting temperatures of these molecules range from 32.4 to 60.5°C and are concentration independent over strand concentrations of 0.5 to 260 μM; thus, as expected for hairpins, the melting transitions are apparently unimolecular. Model independent thermodynamic transition parameters, ΔH_cal, ΔS_cal, and ΔG_cal, were determined from DSC measurements. Model dependent transition parameters, ΔH_vH, ΔS_vH, and ΔG_vH were estimated from a van't Hoff (two‐state) analysis of optical melting transitions. Results of these studies reveal a significant sequence dependence to DNA hairpin stability. Thermodynamic parameters evaluated by either procedure reveal the transition enthalpy, ΔH_cal (ΔH_vH) can differ by as much as 20 kcal/mol depending on sequence. Similarly, values of the transition entropy ΔS_cal (ΔS_vH) can differ by as much as 60 cal/Kmol (eu) for different molecules. Differences in free energies ΔG_cal (ΔG_vH) are as large as 4 kcal/mol for hairpins with different sequences. Comparisons between the model independent calorimetric values and the thermodynamic parameters evaluated assuming a two‐state model reveal that 10 of the 28 hairpins display non‐two‐state melting behavior. The database of sequence‐dependent melting free energies obtained for the hairpins was employed to extract a set of n‐n (nearest‐neighbor) sequence dependent loop parameters that were able to reproduce the input data within error (with only two exceptions). Surprisingly, this suggests that the thermodynamic stability of the DNA hairpins can in large part be reasonably represented in terms of sums of appropriate nearest‐neighbor loop sequence parameters. © 1999 John Wiley & Sons, Inc. Biopoly 50: 425–442, 1999     

Interaction of DNA hairpin loops and a complementary strand by a triplet of base pairs

Hypothesis of non-enzymatic recognition of primordial tRNA and mRNA precursors is experimentally approached. DNA hairpins containing a different number of deoxyguanosine residues in the loop are analyzed for their binding ability to a chemically fixed single-strand of oligo(dC). In presence of small Mg2+ concentration a hairpin with five dG residues in the loop is adsorbed to affinity matrix. Comparison of elution temperatures of hairpin oligonucleotides with those of single-stranded oligoguanylic acids with length of the loop indicates, that smallest loop able to bind forms a triplet of base pairs.     

The initial step of DNA hairpin folding: a kinetic analysis using fluorescence correlation spectroscopy

Conformational fluctuations of single-stranded DNA (ssDNA) oligonucleotides were studied in aqueous solution by monitoring contact-induced fluorescence quenching of the oxazine fluorophore MR121 by intrinsic guanosine residues (dG). We applied fluorescence correlation spectroscopy as well as steady-state and time-resolved fluorescence spectroscopy to analyze kinetics of DNA hairpin folding. We first characterized the reporter system by investigating bimolecular quenching interactions between MR121 and guanosine monophosphate in aqueous solution estimating rate constants, efficiency and stability for formation of quenched complexes. We then studied the kinetics of complex formation between MR121 and dG residues site-specifically incorporated in DNA hairpins. To uncover the initial steps of DNA hairpin folding we investigated complex formation in ssDNA carrying one or two complementary base pairs (dC–dG pairs) that could hybridize to form a short stem. Our data show that incorporation of a single dC–dG pair leads to non-exponential decays for opening and closing kinetics and reduces rate constants by one to two orders of magnitude. We found positive activation enthalpies independent of the number of dC–dG pairs. These results imply that the rate limiting step of DNA hairpin folding is not determined by loop dynamics, or by mismatches in the stem, but rather by interactions between stem and loop nucleotides.     

Covariance of complementary rRNA loop nucleotides does not necessarily represent functional pseudoknot formation in vivo

We examined mutationally a two-hairpin structure (nucleotides 57 to 70 and 76 to 110) in a region of domain I of Escherichia coli 23S rRNA that has been implicated in specific functions in protein synthesis by other studies. On the basis of the observed covariance of several nucleotides in each loop in Bacteria, Archaea, and chloroplasts, the two hairpins have been proposed to form a pseudoknot. Here, appropriate loop changes were introduced in vitro by site-directed mutagenesis to eliminate any possibility of base pairing between the loops. The bacterial cells containing each cloned mutant rRNA operon were then examined for cell growth, termination codon readthrough, and assembly of the mutant rRNAs into functional ribosomes. The results show that, under the conditions examined, the two hairpins do not form a pseudoknot structure that is required for the functioning of the ribosome in vivo and therefore that sequence covariance does not necessarily indicate the formation of a functional pseudoknot.     

Effects of single-base bulges on intercalator binding to small RNA and DNA hairpins and a ribosomal RNA fragment

The way in which a single-base bulge might affect the structure of an RNA helix has been examined by preparing a series of six RNA hairpins, all with seven base pairs and a four-nucleotide loop. Five of the hairpins have single-base bulges at different positions. The intercalating cleavage reagent (methidiumpropyl)-EDTA-Fe(II) [MPE-Fe(II)] binds preferentially at a CpG sequence in the helix lacking a bulge and in four of the five hairpins with bulges. Hairpins with a bulge one or two bases to the 3' side of the CpG sequence bind ethidium 4-5-fold more strongly than the others. V1 RNase, which is sensitive to RNA backbone conformation in helices, detects a conformational change in all of the helices when ethidium binds; the most dramatic changes, involving the entire hairpin stem, are in one of the two hairpins with enhanced ethidium affinity. Only a slight conformational change is detected in the hairpin lacking a bulge. A bulge adjacent to a CpG sequence in a 100-nucleotide ribosomal RNA fragment enhances MPE-Fe(II) binding by an order of magnitude. These results extend our previous observations of bulges at a single position in an RNA hairpin [White, S. A., & Draper, D.E. (1987) Nucleic Acids Res. 15, 4049] and show that (1) a structural change in an RNA helix may be propagated for several base pairs, (2) bulges tend to increase the number of conformations available to a helix, and (3) the effects observed in small RNA hairpins are relevant to larger RNAs with more extensive structure. A bulge in a DNA hairpin identical in sequence with the RNA hairpins does not enhance MPE-Fe(II) binding affinity, relative to a control DNA hairpin. The effects of bulges on ethidium intercalation are evidently modulated by helix structure.     

Crystallographic studies of RNA hairpins in complexes with recombinant MS2 capsids: implications for binding requirements.

The coat protein of bacteriophage MS2 is known to bind specifically to an RNA hairpin formed within the MS2 genome. Structurally this hairpin is built up by an RNA double helix interrupted by one unpaired nucleotide and closed by a four-nucleotide loop. We have performed crystallographic studies of complexes between MS2 coat protein capsids and four RNA hairpin variants in order to evaluate the minimal requirements for tight binding to the coat protein and to obtain more information about the three-dimensional structure of these hairpins. An RNA fragment including the four loop nucleotides and a two-base-pair stem but without the unpaired nucleotide is sufficient for binding to the coat protein shell under the conditions used in this study. In contrast, an RNA fragment containing a stem with the unpaired nucleotide but missing the loop nucleotides does not bind to the protein shell.     

Stem-loop structures can effectively substitute for an RNA pseudoknot in -1 ribosomal frameshifting

-1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base-base and base-sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in -1 PRF. Here, we investigated the efficiency of hairpins of similar base pair composition as the SRV-1 gag-pro pseudoknot. Although not capable of triple helix formation they proved worthy stimulators of frameshifting. Subsequent investigation of ～30 different hairpin constructs revealed that next to thermodynamic stability, loop size and composition and stem irregularities can influence frameshifting. Interestingly, hairpins carrying the stable GAAA tetraloop were significantly less shifty than other hairpins, including those with a UUCG motif. The data are discussed in relation to natural shifty hairpins.     

Thermodynamic parameters for loop formation in RNA and DNA hairpin tetraloops.

We determined the melting temperatures (Tm) and thermodynamic parameters of 15 RNA and 19 DNA hairpins at 1 M NaCl, 0.01 M sodium phosphate, 0.1 mM EDTA, at pH 7. All these hairpins have loops of four bases, the most common loop size in 16S and 23S ribosomal RNAs. The RNA hairpins varied in loop sequence, loop-closing base pair (A.U, C.G, or G.C), base sequence of the stem, and stem size (four or five base pairs). The DNA hairpins varied in loop sequence, loop-closing base pair (C.G, or G.C), and base sequence of the four base-pair stem. Thermodynamic properties of a hairpin may be represented by nearest-neighbor interactions of the stem plus contributions from the loop. Thus, we obtained thermodynamic parameters for the formation of RNA and DNA tetraloops. For the tetraloops we studied, a free energy of loop formation (at 37 degrees C) of about +3 kcal/mol is most common for either RNA or DNA. There are extra stable loops with delta G degrees 37 near +1 kcal/mol, but the sequences are not necessarily the same for RNA and DNA. The closing base pair is also important; changing from C.G to G.C lowered the stability of several tetraloops in both RNA and DNA. These values will be useful in predicting RNA and DNA secondary structures.     

Preference for Ribose Over Deoxyribose in Loop-Closing Base Pairs of Extra Stable Nucleic Acid Hairpins

We have investigated the effect of switching ribose to deoxyribose at the closing base-pair of an extra-stable RNA hairpin. Specifically, we studied the sequence 5′-GGAC(UUCG)GUCC, a dodecanucleotide that folds into a well-characterized, “extra stable” RNA hairpin structure. Recently, we showed that hairpins containing a 2′,5′-linked (UUCG) loop instead of the native 3′,5′-linked loop also exhibit extra-stability (Hannoush and Damha, J. Am. Chem. Soc., 2001, 123, 12368–12374). In this article, we show that the ribose units located at the loop-closing positions (i.e., rC ₄ and rG ₉ ) contribute significantly to the stabilization of RNA hairpins, particularly those containing the 3′,5′-UUCG loop. Interestingly, the requirement of rC4 and rG9 is more relaxed for DNA hairpins containing the 2′,5′-UUCG loop and, in fact, they may be replaced altogether (ribose → deoxyribose) without affecting stability. The results broaden our understanding of the behavior of highly stable (UUCG) hairpin loops and how they respond to structural perturbation of the loop-closing base pairs.     

On loop folding in nucleic acid hairpin-type structures

In a series of studies, combining NMR, optical melting and T-jump experiments, it was found that DNA hairpins display a maximum stability when the loop part of the molecule comprises four or five nucleotide residues. This is in contrast with the current notion based on RNA hairpin studies, from which it had been established that a maximum hairpin stability is obtained for six or seven residues in the loop. Here we present a structural model to rationalize these observations. This model is based on the notion that to a major extent base stacking interactions determine the stability of nucleic acid conformations. The model predicts that loop folding in RNA is characterized by an extension of the base stacking at the 5'-side of the double helix by five or six bases; the remaining gap can then easily be closed by two nucleotides. Conversely, loop folding in DNA is characterized by extending base stacking at the 3'-side of the double helical stem by two or three residues; again bridging of the remaining gap can then be achieved by one or two nucleotides. As an example of loop folding in RNA the anticodon loop of yeast tRNAPhe is discussed. For the DNA hairpin formed by d(ATCCTAT4TAGGAT) it is shown that the loop structure obtained from molecular mechanics calculations obeys the above worded loop folding principles.     

Characterization of RNA hairpin loop stability.

Fifteen RNA hairpins that share the same stem sequence and have homopolymer loops of A, C and U residues which vary in length from three to nine nucleotides were synthesized and their thermal stabilities determined. Tm varies as a function of loop size but is almost independent of loop composition. Loops of four or five nucleotides are found to be the most stable loop size. This is consistent with the observation that four-membered loops are the most prevalent loop size in 16S-like RNAs. The contribution of each loop to hairpin stability was calculated by subtracting the known contribution of the helical stem. These data should be useful for predicting the stability of other hairpins.     

Mechanism for verification of mismatched and homoduplex DNAs by nucleotides‐bound MutS analyzed by molecular dynamics simulations

In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base‐pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base‐pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide‐binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS–mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA‐repair reaction step. Moreover, MM‐PBSA/GBSA showed that the MutS–homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base‐pairs. Proteins 2016; 84:1287–1303. © 2016 Wiley Periodicals, Inc.     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

Structural characterization of an intermolecular RNA-RNA interaction involved in the transcription regulation element of a bipartite plant virus

The 34-nucleotide trans-activator (TA) located within the RNA-2 of Red clover necrotic mosaic virus folds into a simple hairpin. The eight-nucleotide TA loop base pairs with eight complementary nucleotides in the TA binding sequence (TABS) of the capsid protein subgenomic promoter on RNA-1 and trans-activates subgenomic RNA synthesis. Short synthetic oligoribonucleotide mimics of the RNA-1 TABS and the RNA-2 TA form a weak 1:1 bimolecular complex in vitro with a K(a) of 5.3 x 10(4) M(-1). K(a) determination for a series of RNA-1 and RNA-2 mimic variants indicated optimum stability is obtained with seven-base complementarity. Thermal denaturation and NMR show that the RNA-1 TABS 8mers are weakly ordered in solution while RNA-2 TA oligomers form the predicted hairpin. NMR diffusion studies confirmed RNA-1 and RNA-2 oligomer complex formation in vitro. MC-Sym generated structural models suggest that the bimolecular complex is composed of two stacked helices, one being the stem of the RNA-2 TA hairpin and the other formed by the intermolecular base pairing between RNA-1 and RNA-2. The RCNMV TA structural model is similar to those for the Simian retrovirus frameshifting element and the Human immunodeficiency virus-1 dimerization kissing hairpins, suggesting a conservation of form and function.