The nucleotide sequence at the 5'' end of foot and mouth disease virus RNA.

Foot and mouth disease virus RNA has been treated with RNase H in the presence of oligo (dG) specifically to digest the poly(C) tract which lies near the 5' end of the molecule (10). The short (S) fragment containing the 5' end of the RNA was separated from the remainder of the RNA (L fragment) by gel electrophoresis. RNA ligase mediated labelling of the 3' end of S fragment showed that the RNase H digestion gave rise to molecules that differed only in the number of cytidylic acid residues remaining at their 3' ends and did not leave the unique 3' end necessary for fast sequence analysis. As the 5' end of S fragment prepared form virus RNA is blocked by VPg, S fragment was prepared from virus specific messenger RNA which does not contain this protein. This RNA was labelled at the 5' end using polynucleotide kinase and the sequence of 70 nucleotides at the 5' end determined by partial enzyme digestion sequencing on polyacrylamide gels. Some of this sequence was confirmed from an analysis of the oligonucleotides derived by RNase T1 digestion of S fragment. The sequence obtained indicates that there is a stable hairpin loop at the 5' terminus of the RNA before an initiation codon 33 nucleotides from the 5' end. In addition, the RNase T1 analysis suggests that there are short repeated sequences in S fragment and that an eleven nucleotide inverted complementary repeat of a sequence near the 3' end of the RNA is present at the junction of S fragment and the poly(C) tract.     

A new moderately repetitive rat DNA sequence detected by a cloned 4.5 SI DNA

4.5 SI RNA is an abundant, noncapped, small nuclear RNA found in rodent cells. The 4.5 SI RNA is 98 or 99 nucleotides long and contains no modified nucleotides; it is synthesized by RNA polymerase III, is partly hydrogen-bonded to poly(A+) hnRNA, and was the first small nuclear RNA to be purified and sequenced (Busch, H., Reddy, R., Ruthblum, L., and Choi, Y. C. (1982) Annu. Rev. Biochem. 51, 617-654). In studies on the structure and organization of genes coding for this abundant RNA, it was found that this RNA is homologous to an apparently novel family of repetitive sequences. Two clones were characterized; one clone showed that its sequence is identical to the RNA in the first 92 residues and differed only in the last six nucleotides. In addition, the 3'-end of the sequence contained an A,T-rich region, and the sequence was flanked by a 15-nucleotide long direct repeat of AAAATATAGACACTG. The second clone characterized contained nucleotide sequences 1-57 corresponding to the RNA and was flanked by a 15-nucleotide long direct repeat. The structural features of these two DNAs are consistent with RNA-mediated DNA synthesis and integration of this DNA into the genome at random sites. It is estimated that there are about 10,000 copies of this family of sequences in the haploid rat genome.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

The complete nucleotide sequence of the potexvirus white clover mosaic virus.

The complete nucleotide sequence (5845 nucleotides) of the genomic RNA of the potexvirus white clover mosaic virus (WC1MV) has been determined from a set of overlapping cDNA clones. Forty of the most 5'-terminal nucleotides of WC1MV showed homology to the 5' sequences of other potexviruses. The genome contained five open reading frames which coded for proteins of Mr 147, 417, Mr 26,356, Mr 12,989, Mr 7,219 and Mr 20,684 (the coat protein). The Mr 147,417 protein had domains of amino acid sequence homology with putative polymerases of other RNA viruses. The Mr 26,356 and Mr 12,989 proteins had homology with proteins of the hordeivirus barley stripe mosaic virus RNA beta and the furovirus beet necrotic yellow vein virus (BNYVV) RNA-2. A portion of the Mr 26,356 protein was also conserved in the cylindrical inclusion proteins of two potyviruses. The Mr 7,219 protein had homology with the 25K putative fungal transmission factor of BNYVV RNA-3.     

The 5'' splice site: phylogenetic evolution and variable geometry of association with U1RNA.

The 5' splice site sequences of 3294 introns from various organisms (1-672) were analyzed in order to determine the rules governing evolution of this sequence, which may shed light on the mechanism of cleavage at the exon-intron junction. The data indicate that, currently, in all organisms, a common sequence 1GUAAG6U and its derivatives are used as well as an additional sequence and its derivatives, which differ in metazoa (G/1GUgAG6U), lower eucaryotes (1GUAxG6U) and higher plants (AG/1GU3A). They all partly resemble the prototype sequence AG/1GUAAG6U whose 8 contigous nucleotides are complementary to the nucleotides 4-11 of U1RNA, which are perfectly conserved in the course of phylogenetic evolution. Detailed examination of the data shows that U1RNA can recognize different parts of 5' splice sites. As a rule, either prototype nucleotides at position -2 and -1 or at positions 4, 5 or 6 or at positions 3-4 are dispensable provided that the stability of the U1RNA-5' splice site hybrid is conserved. On the basis of frequency of sequences, the optimal size of the hybridizable region is 5-7 nucleotides. Thus, the cleavage at the exon-intron junction seems to imply, first, that the 5' splice site is recognized by U1RNA according to a "variable geometry" program; second, that the precise cleavage site is determined by the conserved sequence of U1RNA since it occurs exactly opposite to the junction between nucleotides C9 and C10 of U1RNA. The variable geometry of the U1RNA-5' splice site association provides flexibility to the system and allows diversification in the course of phylogenetic evolution.     

Site specific enzymatic cleavage of RNA.

The hybridization of a DNA oligonucleotide a specific tetramer or longer) will direct a cleavage by RNase H (EC 3.1.4.34) to a specific site in RNA. The resulting fragments can then be labeled at their 5' or 3' ends, purified, and sequenced directly. This procedure is demonstrated with two RNA molecules of known sequence: 5.8S rRNA from yeast (158 nucleotides) and satellite tobacco necrosis virus (STNV) RNA (1240 nucleotides).     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.     

The identification of the A-type RNA helices in a 55mer RNA by selective incorporation of deuterium-labelled nucleotide residues (Uppsala NMR-window concept)

The 55-nt long RNA, modelling a three-way junction, with non-uniformly incorporated deuterated nucleotides has been synthesised in a pure form. The NMR-window part in this partially deuterated 55mer RNA consists of natural non-enriched nucleotide blocks at the three-way junction (shown in a square box in Fig. 2), whereas all other nucleotides of the rest of the molecule are partially deuterated (> 97 atom% 2H at C2', C3', C5', C5, and approximately 50 atom% 2H at C4'). The secondary structure of this 55mer RNA was determined by 2D 1H NOESY spectroscopy in D2O or in 10% D2O-H2O mixture. The use of deuterated building blocks in the specific region of the 55mer RNA allowed us to identify two distinct A-type RNA helices in a straightforward manner by observing connectivities of H1' with the basepaired imino and the aromatic H2 of all adenosine nucleotides as the first step for the determination of its tertiary structure in a cost- and time-effective manner without employing any 13C/15N labelling. These two decameric helices involve 40 nucleotides, for which all non-exchangeable H1', H6, H2, H8 and H5 protons (all 40 H1', all 40 H6 or H8 aromatics, all seven H2 of adenine nucleotide and all four non-deuterated H5 of cytosines) as well as all 16 exchangeable imino protons (with the exception of four terminal basepairs) and 16 amino protons of cytosines have been assigned. Since all aromatic-H2', H3' as well as H5'/5' crosspeaks from partially deuterated residues have been eliminated from the NMR spectra, the observation of natural nucleotide residues in the NMR window part has essentially been simplified. It has been found that the crosspeaks from the natural nucleotides located at the three-way junction in the NMR-window part show different degrees of line-broadening, thereby indicating that the various nucleotide residues have very different mobilities with respect to themselves as well as compared to other nucleotides in the helices. The assignment of H2' and H3' in the NMR-window part has been made based on NOESY and DQF-COSY crosspeaks. It is noteworthy that, even in this preliminary study, it has been possible to identify 10 H2' out of total 14 and 9 H3' out of 14. The data show that expanded AU containing a tract of 55mer RNA does not self-organise into a tight third helix, as the two decameric A-type helices, across the three-way junction which is evident from the absence of any additional imino protons, except those that already have been assigned for the two decameric helices.     

The complete nucleotide sequence of the RNA coding for the primary translation product of foot and mouth disease virus.

The complete nucleotide sequence of the coding region of foot and mouth disease virus RNA (strain A1061) is presented. The sequence extends from the primary initiation site, approximately 1200 nucleotide from the 5' end of the genome, in an open translational reading frame of 6,999 nucleotides to a termination codon 93 nucleotides from the 3' terminal poly (A). Available amino acid sequence data correlates with that predicted from the nucleotide sequence. The amino acid sequence around cleavage sites in the polyprotein shows no consistency, although a number of the virus-coded protease cleavage sites are between glutamate and glycine residues.     

Relationship Between Moloney Murine Leukemia and Sarcoma Virus RNAs: Purification and Hybridization Map of Complementary DNAs from Defined Regions of Moloney Murine Sarcoma Virus 124

Complementary DNAs (cDNA's) specific for various regions of the Moloney murine sarcoma virus (MSV) 124 RNA genome were prepared by cross-hybridization techniques. A cDNA specific for the first 1,000 nucleotides adjacent to the RNA 3' end (cDNA 3') was prepared and shown to also be complementary to the 3'-terminal 1,000 nucleotides of a related Moloney murine leukemia virus (MLV) genome. A cDNA complementary to the "MSV-specific" portion of the MSV 124 genome was prepared. This cDNA was shown not to anneal to Moloney MLV RNA and to anneal to a portion of the viral RNA of about 1,500 to 1,800 nucleotides in length, located 1,000 nucleotides from the 3' end of MSV RNA. A cDNA common to the genome of MSV and MLV was also obtained and shown to anneal to the 5'-terminal two-thirds, as well as to the 3'-terminal 1,000 nucleotides, of the MSV RNA genome. This cDNA also annealed to the RNA from MLV and mainly to the 5'-terminal half of the MLV genome. It is concluded that the 6-kilobase Moloney MSV 124 RNA genome has a sequence arrangement that includes (i) a 3' portion of about 1,000 nucleotides, which is also present at the 3' terminus of MLV; (ii) an MSV-specific region, not shared with MLV, which extends between 1,000 and 2,500 nucleotides from the 3' terminus; and (iii) a second "common" region, again shared with MLV, which extends from 2,500 nucleotides to the 5' terminus. This second common region appears to be located in the 5' half of the 10-kilobase MLV genome as well. Experiments in which a large excess of cold MLV cDNA was annealed to (3)H-labeled polyadenylic acid-containing fragments of MSV RNA gave results consistent with this arrangement of the MSV genome.     

Nucleotide sequence at the 5'' end of ovalbumin messenger RNA from chicken.

DNA-sequence analysis of 300 nucleotides from the region of cloned, double-stranded ovalbumin cDNA corresponding to the 5' end of ovalbumin messenger RNA was accomplished using the technique of Maxam and Gilbert (Proc. Nat. Acad. Sci. USA (1977) 74,560-564). The AUG initiation codon was located 52 nucleotides from the AT linkers used in cloning and immediately adjacent to the amino terminal peptide of ovalbumin, indicating the absence of a "signal peptide" in this protein. The nucleotide sequence coding for a phosphorylated peptide from ovalbumin was also found. These results demonstrate that the coding portion of mRNAov begins near the 5' end of the molecule leaving some 600 nucleotides of noncoding information at the 3' end.     

Rapid print-readout technique for sequencing of RNA's containing modified nucleotides.

A rapid, simple, and highly sensitive method for sequence analysis of RNA was developed, which consists of the following steps: (i) controlled hydrolysis of the RNA by brief heating in water; (ii) (32P)-labeling of 5'-hydroxyl groups of the fragments produced in (i); (iii) resolution of labeled fragments by size on polyacrylamide gels giving the familiar "ladder"; (iv) contact transfer ("print") of the ladder from the gel to a PEI-cellulose thin layer; (v) in situ treatment of the ladder with RNase T2 resulting in the release of 5'-(32P)-labeled nucleoside-3',5' diphosphates; (vi) contact transfer and thin-layer separation of (32P)-labeled nucleotides on PEI-cellulose in ammonium sulfate and ammonium formate solvents; (vii) autoradiography. The chromatographic behavior of the 4 major and 18 modified nucleotides was determined. The positions of major and modified nucleotides in the sequence can be read directly from the separation patterns displayed on X-ray film. As this is the only sequencing method presently available that allows one to display and identify directly the positions in the RNA chain of major and modified nucleotides, no additional procedures are required to analyze the latter.     

Synthesis of RNA having cap structure.

RNA consisting 43 nucleotides bearing cap structure was synthesized (Figure). In the first place, 9 mer of a leader sequence with the cap structure (F-1) was synthesized by the phosphotriester method and followed by the capping reaction. Next, 32 mer of a cistron was divided into two fragments and each was synthesized by the phosphoramidite method. The 3'-end nucleotide of the RNA, a modified guanosine 5'-phosphate, was introduced to F-3 by use of P1-2',3'-O-methoxymethylene guanosine-5'-yl P2-adenosine-5'-yl diphosphate (A5' ppGmM) with T4 RNA ligase. The chemically synthesized RNA fragments were ligated with T4 RNA ligase to afford the desired RNA.