Effect of chemical modifications of cytosine and guanine in a CpG-motif of oligonucleotides: structure-immunostimulatory activity relationships

Oligodeoxynucleotides containing unmethylated CpG-motifs stimulate the innate immune system, including inducing B-cell proliferation and cytokine production. However, the mechanism of immunostimulation by CpG-oligonucleotides and the precise structural requirements and specific functional groups of cytosine and guanine necessary for recognition of and interaction with protein/receptor factors that are responsible for immune stimulation have not been elucidated. We sought to understand the critical role of each functional group of the cytosine and guanine moieties in a CpG-motif in inducing immunostimulatory activity. To this end, we examined structure-immunostimulatory activity relationships of phosphorothioate oligodeoxynucleotides (PS-oligos) containing YpG- and CpR-motifs (Y and R stand for pyrimidine and purine analogues, respectively). The PS-oligos containing a YpG-motif in which the natural deoxycytidine was replaced with deoxy-5-hydroxycytidine or deoxy-N4-ethylcytidine showed immunostimulatory activity. Substitution of deoxycytidine with a deoxy-5-methylisocytidine, deoxyuridine, or deoxy-P-base-nucleoside in the YpG-motif completely abolished the immunostimulatory activity, similar to the results observed with deoxy-5-methylcytidine. In the case of PS-oligos containing a CpR-motif, 7-deazaguanine substitution for natural guanine showed immunostimulatory activity similar to that of a parent PS-oligo. These studies suggest that the 2-keto, 3-imino and 4-amino groups of cytosine, and the 1-imino, 2-amino and 6-keto groups of guanine in a CpG-motif are important for the immunostimulatory activity of CpG-PS-oligos. The absence of N7 on guanine of the CpG-motif does not affect immunostimulatory activity significantly. These studies suggest that it is possible to develop YpG- and CpR-motifs as an alternative to CpG-motifs in PS-oligos for immunostimulatory studies.     

Immunostimulatory activity of CpG containing phosphorothioate oligodeoxynucleotide is modulated by modification of a single deoxynucleoside

Phosphorothioate oligodeoxynucleotides (PS-oligos) containing the CpG motif have immunostimulatory properties. Our earlier study had shown that the immunostimulatory activity of PS-oligos containing the CpG motif can be modulated by incorporation of 2'-O-methylribonucleosides (Zhao, Q.; Yu, D.; Agrawal, S. Bioorg. Med. Chem. Lett. 1999, 9, 3453). Here we show that the immunostimulatory activity of a PS-oligo containing a CpG motif can be modulated by substitution of a single deoxynucleoside at specific sites with either 2'-O-methylribonucleoside or 3'-O-methylribonucleoside in the flanking region to CpG motif. Furthermore, substitution of deoxynucleosides with 2'-O-methoxyethoxyribonucleosides also results in modulating immunostimulatory activity of PS-oligos.     

Assessing the effectiveness of coding and non-coding regions in antisense ribosome inhibition of gene expression in Tetrahymena

In Tetrahymena thermophila, an "antisense ribosome" technology has been developed for inhibiting gene expression and generating novel mutants. Short segments of genes are inserted in antisense orientation into an rDNA vector in a region corresponding to an external loop of the folded rRNA. DNA segments derived from the 5'-ends of genes have proven most effective in reducing cognate gene expression. To investigate the efficacy of other genic regions, we generated Tetrahymena cell lines with antisense ribosome constructs containing 100-bp DNA segments derived from the 5'-ends, 3'-ends, and internal coding regions of two non-essential genes, granule lattice protein 1 and macronuclear histone H1. The 5'- and 3'-end constructs inhibited gene expression, but antisense ribosomes derived exclusively from coding regions had little effect.     

Synthesis and RNAse L binding and activation of a 2-5A-(5')-DNA-(3')-PNA chimera, a novel potential antisense molecule

Fully automated solid-phase synthesis gave access to a hybrid in which 5'-phosphorylated-2'-5'-linked oligoadenylate (2-5A) is connected to the 5'-terminus of DNA which, in turn, is linked at the 3'-end to PNA [2-5A-(5')-DNA-(3')-PNA chimera]. This novel antisense molecule retains full RNase L activation potency while suffering only a slight reduction in binding affinity.     

The nucleotide sequence at the 3''-end of Neurospora crassa 25S-rRNA and the location of a 5.8S-rRNA binding site

The sequence of 110 nucleotides adjacent to the 3'-end of Neurospora crassa 25S-rRNA has been derived by chemical sequencing methods. Sequences present between 40 and 85 nucleotides of the 3'-end were found to complement sequences at the 3'- and 5'-ends of 5.8S-rRNA. Interaction was shown to occur between 5.8S-rRNA and a specific 3'-terminal fragment of 85 nucleotides derived from 25S-rRNA. We have also demonstrated that the nucleotide sequence at the 3'-end of N. crassa 5.8S-rRNA (-UCAUUOH) is different from the published sequence (-UUUUOH) which was derived from rDNA.     

The efficiency of strand invasion by Escherichia coli RecA is dependent upon the length and polarity of ssDNA tails

RecA protein is essential for homologous recombination and the repair of DNA double-strand breaks in Escherichia coli. The protein binds DNA to form nucleoprotein filaments that promote joint molecule formation and strand exchange in vitro. RecA polymerises on ssDNA in the 5'-3' direction and catalyses strand exchange and branch migration with a 5'-3' polarity. It has been reported previously, using D-loop assays, in which ssDNA (containing a heterologous block at one end) invades supercoiled duplex DNA that 3'-homologous ends are reactive, whereas 5'-ends are inactive. This polarity bias was thought to be due to the polarity of RecA filament formation, which results in the 3'-ends being coated in RecA, whereas 5'-ends remain naked. Using a range of duplex substrates containing ssDNA tails of various lengths and polarities, we now demonstrate that when no heterologous block is imposed, 5'-ends are just as reactive as 3'-ends. Moreover, using short-tailed substrates, we find that 5'-ends form more stable D-loops than 3'-ends. This bias may be a consequence of the instability of short 3'-joints. With more physiological substrates containing long ssDNA tails, we find that RecA shows no intrinsic preference for 5' or 3'-ends and that both form D-loop complexes with high efficiency.     

Triplex staples: DNA double-strand cross-linking at internal and terminal sites using psoralen-containing triplex-forming oligonucleotides

A method has been developed to attach 4'-(hydroxymethyl)-4,5',8-trimethylpsoralen to the 5 position of thymine bases during solid-phase oligonucleotide synthesis. UV irradiation of triplex-forming oligonucleotides (TFOs) containing internally attached psoralens produces photoadducts at TpA steps within target duplexes, thus relaxing the constraints on selection of psoralen target sequences. Photoreaction of TFOs containing two psoralens, located at the 5'- and 3'-ends, has been used to create double-strand cross-links (triplex staples) at both termini of the TFO. Such complexes have no free single-stranded ends. TFOs containing 4'-(hydroxymethyl)-4,5',8-trimethylpsoralen, 3-methyl-2-aminopyridine, and 5-(3-aminoprop-2-ynyl)deoxyuridine formed photoadducts with target duplexes under near-physiological conditions.     

A hidden break in the 28.0S rRNA from Diphyllobothrium dendriticum.

Nondenatured and denatured total RNA from the tapeworm Diphyllobothrium dendriticum (Cestoda) was analysed by agarose gel electrophoresis. It was found that the large subunit ribosomal RNA (lrRNA) is 28.0S and the small subunit ribosomal RNA (srRNA) is 19.5S. Following denaturation the 28.0S rRNA was disrupted into a 19.5S subfragment and a 20.7S subfragment due to the presence of a centrally located hidden break. By hybridization of Northern blot membranes with oligonucleotide probes specific for the 5'- and 3'-ends of the lrRNA respectively, we have shown that the 19.5S subfragment is from the 5'-end (the alpha-subfragment) and the 20.7S subfragment from the 3'-end (the beta-subfragment) of the 28.0S rRNA of D. dendriticum.     

Tailed duplex DNA is the preferred substrate for Rad51 protein-mediated homologous pairing

The repair of potentially lethal DNA double-stranded breaks (DSBs) by homologous recombination requires processing of the broken DNA into a resected DNA duplex with a protruding 3'-single-stranded DNA (ssDNA) tail. Accordingly, the canonical models for DSB repair require invasion of an intact homologous DNA template by the 3'-end of the ssDNA, a characteristic that the bacterial pairing protein RecA possesses. Unexpectedly, we find that for the eukaryotic homolog, Rad51 protein, the 5'-end of ssDNA is more invasive than the 3'-end. This pairing bias is unaffected by Rad52, Rad54 or Rad55-57 proteins. However, further investigation reveals that, in contrast to RecA protein, the preferred DNA substrate for Rad51 protein is not ssDNA but rather dsDNA with ssDNA tails. This important distinction permits the Rad51 proteins to promote DNA strand invasion using either 3'- or 5'-ends with similar efficiency.     

Nucleosides and nucleotides. 208. Alternate-strand triple-helix formation by the 3'-3'-linked oligodeoxynucleotides with the anthraquinonyl group at the junction point.

The synthesis of 3'-3'-linked oligodeoxynucleotides (ODNs) with the anthraquinonyl group at the junction point is described. The ODNs were synthesized on a DNA synthesizer using a controlled pore glass (CPG) carrying pentaerythritol that has an intercalator at one of the four hydroxymethyl groups. Stability of the triplexes with the target duplexes was studied by thermal denaturation. The 3'-3'-linked ODNs with the anthraquinonyl group enhanced the thermal stability of the triplexes when compared with those without the intercalator and the unmodified nonamer 10. It was found that the ODNs 12 and 13 carrying the anthraquinonyl groups can form thermally stable triplexes by skipping two or three extra base pairs between two binding domains of the target duplexes. The ability of the 3'-3'-linked ODNs to inhibit cleavage of the target DNA 22 by the restriction enzyme Hind III was tested. It was found that the 3'-3'-linked ODN 16 with the anthraquinonyl group at the junction point inhibited the cleavage by the enzyme more effectively than the nonamer 14 and the 3'-3'-linked ODN 15 without the intercalator.     

DNA substrate requirements for stable joint molecule formation by the RecA and single-stranded DNA-binding proteins of Escherichia coli

In reactions between linear single-stranded DNAs (ssDNAs) and circular double-stranded DNAs (dsDNAs), stable joint molecule formation promoted by the recA protein (RecA) requires negative superhelicity, a homologous end, and an RecA-ssDNA complex. Linear ssDNAs with 3'-end homology react more efficiently than linear ssDNAs with 5'-end homology. This 3'-end preference is explained by the finding that 3'-ends are more effectively coated by RecA than 5'-ends, as judged by exonuclease VII protection, and are thus more reactive. The ability of linear ssDNAs with 5'-end homology to react is improved by the presence of low concentrations of exonuclease VII. In reactions between ssDNAs and linear dsDNAs with end homology, stable joint molecule formation occurs more efficiently when the homology is at the 3'-end rather than at the 5'-end of the complementary strand. In addition, linear dsDNAs with homology at the 3'-end of the complementary strand react more efficiently with linear ssDNAs with 3'-end homology than with linear ssDNAs with 5'-end homology. The ability of linear ssDNAs with 5'-end homology to react, in the absence of single-stranded DNA-binding protein, is improved by adding 33-46 nucleotides of heterologous sequence to the 5'-end of the linear ssDNA. The poor reactivity of linear ssDNAs with 5'-end homology is explained by a lack of RecA at the 5'-ends of linear ssDNAs, which is a consequence of the polar association and dissociation of RecA.     

Cleavage of RNA in hybrid duplexes by E. coli ribonuclease H. II. Substrate properties of nucleotides containing non-nucleotide linkers]

The 20-mer bridged oligodeoxynucleotides containing short oligomers joined by the hexamethylenediol and hexaethylene glycol linkers were shown to form complementary DNA/DNA and RNA/DNA complexes whose thermostability depends on the length and number of the nonnucleotide linkers. Hybrid complexes of the bridged oligonucleotides proved to be substrates for the E. coli ribonuclease H. The presence of one-three nonnucleotide linkers in a 20-mer decreased the hydrolysis efficacy only 1.2-1.4-fold. It is the composition of the RNA cleavage products that was influenced the most significantly by the nonnucleotide linkers. RNase H simultaneously hydrolyzed the RNA 3'-ends of each hybrid duplex involving a bridged oligonucleotide. The presence of an inverted 3'-3'-phosphodiester bond at the 3'-end of the oligodeoxyribonucleotide only slightly affected the RNase H activity.     

Requirement of nucleobase proximal to CpG dinucleotide for immunostimulatory activity of synthetic CpG DNA

Synthetic oligodeoxyribonucleotides containing CpG dinucleotides exhibit potent immunostimulatory activity in vertebrates. Although the molecular mechanisms of recognition and interaction of CpG DNA sequences with receptors are not well understood, the current evidence suggests that the receptor shows considerable selectivity for CpG DNA sequences with different preferences in mouse (GACGTT) and human (GTCGTT) species. In our continued effort to understand the chemical and structural characteristics of CpG DNA required for the immunostimulatory activity and thereby for the recognition of receptors in the immunostimulatory pathway, we examined the requirement of nucleobases in the two adjacent nucleotide positions on the 5'- and the 3'-side to the CpG dinucleotide (P(1)P(2)CGP(3)P(4)) for the immunostimulatory activity. These studies, in which a natural nucleoside is substituted with an abasic nucleoside (X), suggest that a nucleobase is absolutely required in C, G, P(3), and P(4) positions for immunostimulatory activity. Surprisingly, an abasic nucleoside is permitted at either P(1) or P(2) depending on the neighboring base. It was found that 'GXCGTT' motif has an intermediate immunostimulatory activity between those of 'GACGTT' and 'GTCGTT' in the mouse cells.     

3'-end labeling of DNA with [alpha-32P]cordycepin-5'-triphosphate

Cordycepin-5'-triphosphate (3'-deoxyadenosine-5'-triphosphate) can be incorporated into the 3'-ends of DNA fragments using terminal deoxynucleotidyl transferase from calf thymus (Bollum, 1974). Because cordycepin-5'-monophosphate lacks a 3'-OH group, only a single residue is incorporated. Furthermore, DNA molecules that contain cordycepin-5'-monophosphate at their 3'-ends become resistant to hydrolysis by exonucleases that require free 3'-OH ends. As an alternative to 5'-end labeling of complementary DNA strands, we have used [32P]cordycepin-5'-triphosphate labeling of 3'-ends to confirm the nucleotide sequence of a HhaI-endonuclease-generated pTU4-plasmid DNA fragment that contains several hot spots for insertions of the transposable genetic element Tn3. 3'-End labeling with [32P] cordycepin-5'-triphosphate has also proved useful in determining the sequence of the pTU4 DNA in the vicinity of a strategically located SstII endonuclease cleavage site in the replication region of the plasmid.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Template-directed synthesis of oligoadenylates catalyzed by Pb2+ ions

The Pb2+ ion is an effective catalyst for the template-directed condensation of ImpA on poly(U). This reaction generates up to 35% of oligomers 5 or more units long. Furthermore, the product is predominantly 3'-5'-linked (75%) unlike that from the uncatalyzed reaction which is more than 90% 2'-5'-linked. The significance of metal-ion catalysis for prebiotic polynucleotide formation is discussed.