The alpha/beta hydrolase fold.

We have identified a new protein fold--the alpha/beta hydrolase fold--that is common to several hydrolytic enzymes of widely differing phylogenetic origin and catalytic function. The core of each enzyme is similar: an alpha/beta sheet, not barrel, of eight beta-sheets connected by alpha-helices. These enzymes have diverged from a common ancestor so as to preserve the arrangement of the catalytic residues, not the binding site. They all have a catalytic triad, the elements of which are borne on loops which are the best-conserved structural features in the fold. Only the histidine in the nucleophile-histidine-acid catalytic triad is completely conserved, with the nucleophile and acid loops accommodating more than one type of amino acid. The unique topological and sequence arrangement of the triad residues produces a catalytic triad which is, in a sense, a mirror-image of the serine protease catalytic triad. There are now four groups of enzymes which contain catalytic triads and which are related by convergent evolution towards a stable, useful active site: the eukaryotic serine proteases, the cysteine proteases, subtilisins and the alpha/beta hydrolase fold enzymes.     

Knowledge-based modeling of the serine protease triad into non-proteases.

The Asp-His-Ser triad of serine proteases has been regarded, in the present study, as an independent catalytic motif, because in nature it has been incorporated at the active sites of enzymes as diverse as the serine proteases and the lipases. Incorporating this motif into non-protease scaffolds, by rational design and mutagenesis, might lead to the generation of novel catalysts. As an aid to such experiments, a knowledge-based computer modeling procedure has been developed to model the protease Asp-His-Ser triad into non-proteases. Catalytic triads from a set of trypsin family proteases have been analyzed and criteria that characterize the geometry of the triads have been obtained. Using these criteria, the modeling procedure first identifies sites in non-proteases that are suitable for modeling the protease triad. H-bonded Asp-His-Ser triads, that mimic the protease catalytic triad in geometry, are then modeled in at these sites, provided it is stereochemically possible to do so. Thus non-protease sites at which H-bonded Asp-His-Ser triads are successfully modeled in may be considered for mutagenesis experiments that aim at introducing the protease triad into non-proteases. The triad modeling procedure has been used to identify sites for introducing the protease triad in three binding proteins and an immunoglobulin. A scoring function, depending on inter-residue distances, solvent accessibility and the substitution potential of amino acid residues at the modeling sites in the host proteins, has been used to assess the quality of the model triads.     

Mutagenesis of E477 or K505 in the B' domain of human topoisomerase II beta increases the requirement for magnesium ions during strand passage

A type II topoisomerase is essential for decatenating DNA replication products, and it accomplishes this task by passing one DNA duplex through a transient break in a second duplex. The B' domain of topoisomerase II contains three highly conserved motifs, EGDSA, PL(R/K)GK(I/L/M)LNVR, and IMTD(Q/A)DXD. We have investigated these motifs in topoisomerase II beta by mutagenesis, and report that they play a critical role in establishing the DNA cleavage-religation equilibrium. In addition, the mutations E477Q (EGDSA) and K505E (PLRGKILNVR) increase the optimal magnesium ion concentration for strand passage, without affecting the Mg(2+) dependence of ATP hydrolysis. It is likely that the binding affinity of the magnesium ion(s) specifically required for DNA cleavage has been reduced by these mutations. The crystal structure of yeast topo II indicates that residues E477 and K505 may help to position the three aspartate residues of the IMTD(Q/A)DXD motif for magnesium ion coordination, and we propose two possible locations for the magnesium ion binding site(s). These observations are consistent with a previous model in which the B' domain is positioned such that these acidic residues lie next to the active site tyrosine residue. A magnesium ion bound by these aspartate residues could therefore mediate the DNA cleavage-religation reaction.     

Divergent evolution of the thiolase superfamily and chalcone synthase family

Enzymes of the thiolase superfamily catalyze the formation of carbon-carbon bond via the Claisen condensation reaction. Thiolases catalyze the reversible non-decarboxylative condensation of acetoacetyl-CoA from two molecules of acetyl-CoA, and possess a conserved Cys-His catalytic diad. Elongation enzymes (beta-ketoacyl-acyl carrier protein synthase (KAS) I and KAS II and the condensing domain of polyketide synthase) have invariant Cys and two His residues (CHH triad), while a Cys-His-Asn (CHN) triad is found in initiation enzymes (KAS III, 3-ketoacyl-CoA synthase (KCS) and the chalcone synthase (CHS) family). These enzymes all catalyze decarboxylative condensation reactions. 3-Hydroxyl-3-methylglutaryl-CoA synthase (HMGS) also contains the CHN triad, although it catalyzes a non-decarboxylative condensation. That the enzymes of the thiolase superfamily share overall similarity in protein structure and function suggested a common evolutionary origin. All thiolases were found to have, in addition to the Cys-His diad, either Asn or His (thus C(N/H)H) at a position corresponding to the His in the CHH and CHN triads. In our phylogenetic analyses, the thiolase superfamily was divided into four main clusters according to active site architecture. During the functional divergence of the superfamily, the active architecture was suggested to evolve from the C(H)H in archaeal thiolases to the C(N/H)H in non-archaeal thiolases, and subsequently to the CHH in the elongation enzymes and the CHN in the initiation enzymes. Based on these observations and available biochemical and structural evidences, a plausible evolutionary history for the thiolase superfamily is proposed that includes the emergence of decarboxylative condensing enzymes accompanied by a recruitment of the His in the CHH and CHN triads for a catalytic role during decarboxylative condensation. In addition, phylogenetic analysis of the plant CHS family showed separate clustering of CHS and non-CHS members of the family with a few exceptions, suggesting repeated gene birth-and-death and re-invention of non-CHS functions throughout the evolution of angiosperms. Based on these observations, predictions on the enzymatic functions are made for several members of the CHS family whose functions are yet to be characterized. Further, a moss CHS-like enzyme that is functionally similar to a cyanobacterial enzyme was identified as the most recent common ancestor to the plant CHS family.     

Structure-based mutational analysis of the 4'-phosphopantetheinyl transferases Sfp from Bacillus subtilis: carrier protein recognition and reaction mechanism

The activation of apo-peptidyl carrier proteins (PCPs) of nonribosomal peptide synthetases (NRPSs), apo-acyl carrier proteins (ACPs) of polyketide synthases (PKSs), and fatty acid synthases (FASs) to their active holo form is accomplished with dedicated 4'-phosphopantetheinyl transferases (PPTases). They catalyze the transfer of the essential prosthetic group 4'-phosphopantetheine (4'-Ppant) from coenzyme A (CoA) to a highly conserved serine residue in all PCPs and ACPs. PPTases, based on sequence and substrate specifity, have been classified into three types: bacterial holo-acyl carrier protein synthase (AcpS), fatty acid synthase of eukaryotes (FAS2) and Sfp, a PPTase of secondary metabolism. The recently solved crystal structures of AcpS and Sfp-type PPTases with CoA revealed a common alpha + beta-fold with a beta(1)alpha(3)beta(2) motif and similarities in CoA binding and polymerization mode. However, it was not possible to discern neither the PCP binding region of Sfp nor the priming reaction mechanism from the Sfp-CoA cocrystal. In this work, we provide a model for the reaction mechanism based on mutational analysis of Sfp that suggests a reaction mechanism in which the highly conserved E151 deprotonates the hydroxyl group of the invariant serine of PCP. That, in turn, acts as a nucleophile to attack the beta-phosphate of CoA. The Sfp mutants K112, E117, and K120 further revealed that the loop region between beta4 and alpha5 (residues T111-S124) in Sfp is the PCP binding region. Also, residues T44, K75, S89, H90, D107, E109, E151, and K155 that have been shown in the Sfp-CoA cocrystal structure to coordinate CoA are now all confirmed by mutational and biochemical analysis.     

An Arabidopsis protein closely related to Synechocystis cryptochrome is targeted to organelles

Cryptochromes (CRYs) are blue/UV-A photoreceptors related to the DNA repair enzyme DNA photolyase. They have been found in plants, animals and most recently in the cyanobacterium Synechocystis. Closely related to the Synechocystis cryptochrome is the Arabidopsis gene At5g24850. Here, we show that the encoded protein of At5g24850 binds flavin adenine dinucleotide (FAD). It has no photolyase activity, and is likely to function as a photoreceptor. We have named it At-cry3 to distinguish it from the other Arbabidopsis cryptochrome homologues At-cry1 and At-cry2. At-cry3 carries an N-terminal sequence, which mediates import into chloroplasts and mitochondria. Furthermore, we show that At-cry3 binds DNA. DNA binding was also demonstrated for the Synechocystis cryptochrome, indicating that both photoreceptors could have similar modes of action. Based on the finding of a new cryptochrome class in bacteria and plants, it has been suggested that cryptochromes evolved before the divergence of eukaryotes and prokaryotes. However, our phylogenetic analyses are also consistent with an alternative explanation that the presence of cryptochromes in the plant nuclear genome is the result of dual horizontal gene transfer. That is, CRY1 and CRY2 genes may originate from an endosymbiotic ancestor of modern-day alpha-proteobacteria, while the CRY3 gene may originate from an endosymbiotic ancestor of modern-day cyanobacteria.     

Mutational analysis of peptidyl carrier protein and acyl carrier protein synthase unveils residues involved in protein-protein recognition

4'-Phosphopantetheinyl transferases (PPTases) are essential for the production of fatty acids by fatty acid synthases (primary metabolism) and natural products by nonribosomal peptide synthetases and polyketide synthases (secondary metabolism). These systems contain carrier proteins (CPs) for the covalent binding of reaction intermediates during synthesis. PPTases transfer the 4'-phosphopantetheine moiety from coenzyme A (CoA) onto conserved serine residues of the apo-CPs to convert them to their functionally active holo form. In bacteria, two types of PPTases exist that are evolutionary related but differ in their substrate spectrum. Acyl carrier protein synthases (AcpSs) recognize CPs from primary metabolism, whereas Sfp- (surfactin production-) type PPTases have a preference for CPs of secondary metabolism. Previous investigations showed that a peptidyl carrier protein (PCP) of secondary metabolism can be altered to serve as substrate for AcpS. We demonstrate here that a single mutation in PCP suffices for the modification of this CP by AcpS, and we have identified by mutational analysis several other PCP residues and two AcpS residues involved in substrate discrimination by this PPTase. These altered PCPs were still capable of serving their designated function in NRPS modules, and selective use of AcpS or Sfp leads to production of two different products by a trimodular NRPS.     

Crystal structure of ATP sulfurylase from Penicillium chrysogenum: insights into the allosteric regulation of sulfate assimilation

ATP sulfurylase from Penicillium chrysogenum is an allosterically regulated enzyme composed of six identical 63.7 kDa subunits (573 residues). The C-terminal allosteric domain of each subunit is homologous to APS kinase. In the presence of APS, the enzyme crystallized in the orthorhombic space group (I222) with unit cell parameters of a = 135.7 A, b = 162.1 A, and c = 273.0 A. The X-ray structure at 2.8 A resolution established that the hexameric enzyme is a dimer of triads in the shape of an oblate ellipsoid 140 A diameter x 70 A. Each subunit is divided into a discreet N-terminal domain, a central catalytic domain, and a C-terminal allosteric domain. Two molecules of APS bound per subunit clearly identify the catalytic and allosteric domains. The sequence 197QXRN200 is largely responsible for anchoring the phosphosulfate group of APS at the active site of the catalytic domain. The specificity of the catalytic site for adenine nucleotides is established by specific hydrogen bonds to the protein main chain. APS was bound to the allosteric site through sequence-specific interactions with amino acid side chains that are conserved in true APS kinase. Within a given triad, the allosteric domain of one subunit interacts with the catalytic domain of another. There are also allosteric-allosteric, allosteric-N-terminal, and catalytic-catalytic domain interactions across the triad interface. The overall interactions-each subunit with four others-provide stability to the hexamer as well as a way to propagate a concerted allosteric transition. The structure presented here is believed to be the R state. A solvent channel, 15-70 A wide exists along the 3-fold axis, but substrates have access to the catalytic site only from the external medium. On the other hand, a surface "trench" links each catalytic site in one triad with an allosteric site in the other triad. This trench may be a vestigial feature of a bifunctional ("PAPS synthetase") ancestor of fungal ATP sulfurylase.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

A novel scenario for the evolution of haem-copper oxygen reductases

The increasing sequence information on oxygen reductases of the haem-copper superfamily, together with the available three-dimensional structures, allows a clear identification of their common, functionally important features. Taking into consideration both the overall amino acid sequences of the core subunits and key residues involved in proton transfer, a novel hypothesis for the molecular evolution of these enzymes is proposed. Three main families of oxygen reductases are identified on the basis of common features of the core subunits, constituting three lines of evolution: (i) type A (mitochondrial-like oxidases), (ii) type B (ba3-like oxidases) and (iii) type C (cbb3-type oxidases). The first group can be further divided into two subfamilies, according to the helix VI residues at the hydrophobic end of one of the proton pathways (the so-called D-channel): (i) type A1, comprising the enzymes with a glutamate residue in the motif -XGHPEV-, and (ii) type A2, enzymes having instead a tyrosine and a serine in the alternative motif -YSHPXV-. This second subfamily of oxidases is shown to be ancestor to the one containing the glutamate residue, which in the Bacteria domain is only present in oxidases from Gram-positive or purple bacteria. It is further proposed that the Archaea domain acquired terminal oxidases by gene transfer from the Gram-positive bacteria, implying that these enzymes were not present in the last common ancestor before the divergence between Archaea and Bacteria. In fact, most oxidases from archaea have a higher amino acid sequence identity and similarity with those from bacteria, mainly from the Gram-positive group, than with oxidases from other archaea. Finally, a possible relation between the dihaemic subunit (FixP) of the cbb3 oxidases and subunit II of caa3 oxidases is discussed. As the families of haem-copper oxidases can also be identified by their subunit II, a parallel evolution of subunits I and II is suggested.     

A structural model of the plant acyl-acyl carrier protein thioesterase FatB comprises two helix/4-stranded sheet domains, the N-terminal domain containing residues that affect specificity and the C-terminal domain containing catalytic residues

Plant acyl-acyl carrier protein thioesterases (TEs) terminate the acyl-acyl carrier protein track of fatty acid biosynthesis and play an essential role in determining the amount and composition of fatty acids entering the storage lipid pool. A combination of bioinformatics tools was used to predict a three-dimensional model for Arabidopsis FatB (AtFatB), which comprises a fold similar to that of Escherichia coli TEII, an enzyme that is functionally similar to plant TEs but lacks significant sequence similarity and displays different inhibitor sensitivity. The catalytic residues in AtFatB, Cys-264 and His-229, localize to the same region of the model as catalytic residues found in other enzymes with helix/multi-stranded sheet motifs (hot dog folds). Based on the model, we identified Asn-227 as a possible third member of the proposed papain-like catalytic triad. The conversion of Asn-227 to Ala resulted in a loss of detectable activity (>200-fold reduction), similar to the result seen for the equivalent mutation in papain. Mapping of plant TE specificity-affecting mutations onto the structural model showed that these mutations all cluster around the catalytic triad. Also, superposition of the crystallographically determined structures of the complexes of 4-hydroxybenzoyl-CoA TE with substrate and beta-hydroxydecanoyl thiol ester dehydrase with inhibitor onto the AtFatB model showed that the substrate and inhibitor localize to the same region as the AtFatB catalytic triad in their respective structures. Together these data corroborate the structural model and show that the hot dog fold is common to enzymes from both prokaryotes and eukaryotes and that this fold supports at least three different catalytic mechanisms.     

Molecular evolutionary analysis based on the amino acid sequence of catalase

Heme-containing catalase sequences from 20 different organisms representing prokaryotes, fungi, animals, and plants have been compiled for phylogenetic reconstruction. Phylogenies based on distance and parsimony analysis show that fungal and animal catalases can be derived from one ancestor, whereas bacterial catalases fail to form a monophyletic group. Plant catalases appear to form a second class of catalases that arose independently from a possible prokaryotic ancestor.Correspondence to: P.C. Loewen     

Structure-function studies on the active site of the coelenterazine-dependent luciferase from Renilla

Renilla luciferase (RLUC) is a versatile tool for gene expression assays and in vivo biosensor applications, but its catalytic mechanism remains to be elucidated. RLUC is evolutionarily related to the alpha/beta hydrolase family. Its closest known homologs are bacterial dehalogenases, raising the question of how a protein with a hydrolase fold can function as a decarboxylating oxygenase. Molecular docking simulations with the coelenterazine substrate against an RLUC homology model as well as a recently determined RLUC crystal structure were used to build hypotheses to identify functionally important residues, which were subsequently tested by site-directed mutagenesis, heterologous expression, and bioluminescence emission spectroscopy. The data highlighted two triads of residues that are critical for catalysis. The putative catalytic triad residues D120, E144, and H285 bear only limited resemblance to those found in the active site of aequorin, a coelenterazine-utilizing photoprotein, suggesting that the reaction scheme employed by RLUC differs substantially from the one established for aequorin. The role of H285 in catalysis was further supported by inhibition using diethylpyrocarbonate. Multiple substitutions of N53, W121, and P220--three other residues implicated in product binding in the homologous dehalogenase Sphingomonas LinB--also supported their involvement in catalysis. Together with luminescence spectra, our data lead us to propose that the conserved catalytic triad of RLUC is directly involved in the decarboxylation reaction of coelenterazine to produce bioluminescence, while the other active-site residues are used for binding of the substrate.     

Protein translocation across membranes: common themes in divergent organisms

Specific signal sequences are required for the translocation of proteins into and across both the endoplasmic reticulum of eukaryotes and the plasma membrane of prokaryotes. The similar properties of these signals, together with their ability to function when transferred between systems, suggested that the mechanisms of translocation in the two cases may be fundamentally similar. Indeed, recent findings have revealed striking similarities between essential components of the prokaryotic and eukaryotic translocation systems, suggesting that both are derived from a common ancestor.     

A new native EcHsp31 structure suggests a key role of structural flexibility for chaperone function

Heat shock proteins and proteases play a crucial role in cell survival under conditions of environmental stress. The heat shock protein Hsp31, produced by gene hchA at elevated temperatures in Escherichia coli, is a homodimeric protein consisting of a large A domain and a smaller P domain connected by a linker. Two catalytic triads are present per dimer, with the Cys and His contributed by the A domain and an Asp by the P domain. A new crystal Form II confirms the dimer and catalytic triad arrangement seen in the earlier crystal Form I. In addition, several loops exhibit increased flexibility compared to the previous Hsp31 dimer structure. In particular, loops D2 and D3 are intriguing because their mobility leads to the exposure of a sizable hydrophobic patch made up by surface areas of both subunits near the dimer interface. The residues creating this hydrophobic surface are completely conserved in the Hsp31 family. At the same time, access to the catalytic triad is increased. These observations lead to the hypothesis for the functioning of Hsp31 wherein loops D2 and D3 play a key role: first, at elevated temperatures, by becoming mobile and uncovering a large hydrophobic area that helps in binding to client proteins, and second, by removing the client protein from the hydrophobic patch when the temperature decreases and the loops adopt their low-temperature positions at the Hsp31 surface. The proposed mode of action of flexible loops in the functioning of Hsp31 may be a general principle employed by other chaperones.     

Point mutation of (+)-germacrene A synthase from <Emphasis Type="Italic">Ixeris dentata</Emphasis>

Sesquiterpene cyclases catalyze the conversion of common precursor, farnesyl pyrophosphate, into various terpene backbones. X-ray crystallography of tobacco epi-aristolochene synthase has previously proposed a cyclization mechanism wherein the allylic carbocation intermediate is stabilized by the main chain carbonyl oxygens of three consecutive threonine residues. Alignment of amino acid sequences of plant terpene cyclases shows that the first position of the triad is almost invariably threonine or serine. To probe the carbocation-stabilizing role, the amino acid residues of the ₄₃₃TSA₄₃₅ triad in (+)-germacrene A synthase from Ixeris dentata were altered by site-directed mutagenesis. Enzyme kinetic measurements of the mutants and GC/MS analysis of the enzyme reaction products indicate that mutations of the triad decreased enzyme catalysis rather than substrate binding but did not affect its structural rearrangement in the catalytic mechanism. This is the first report that the hydroxyl group of threonine at the first position of the triad is required for the cyclase activity.     

The Vein Patterning 1 (VEP1) gene family laterally spread through an ecological network

Lateral gene transfer (LGT) is a major evolutionary mechanism in prokaryotes. Knowledge about LGT--particularly, multicellular--eukaryotes has only recently started to accumulate. A widespread assumption sees the gene as the unit of LGT, largely because little is yet known about how LGT chances are affected by structural/functional features at the subgenic level. Here we trace the evolutionary trajectory of VEin Patterning 1, a novel gene family known to be essential for plant development and defense. At the subgenic level VEP1 encodes a dinucleotide-binding Rossmann-fold domain, in common with members of the short-chain dehydrogenase/reductase (SDR) protein family. We found: i) VEP1 likely originated in an aerobic, mesophilic and chemoorganotrophic α-proteobacterium, and was laterally propagated through nets of ecological interactions, including multiple LGTs between phylogenetically distant green plant/fungi-associated bacteria, and five independent LGTs to eukaryotes. Of these latest five transfers, three are ancient LGTs, implicating an ancestral fungus, the last common ancestor of land plants and an ancestral trebouxiophyte green alga, and two are recent LGTs to modern embryophytes. ii) VEP1's rampant LGT behavior was enabled by the robustness and broad utility of the dinucleotide-binding Rossmann-fold, which provided a platform for the evolution of two unprecedented departures from the canonical SDR catalytic triad. iii) The fate of VEP1 in eukaryotes has been different in different lineages, being ubiquitous and highly conserved in land plants, whereas fungi underwent multiple losses. And iv) VEP1-harboring bacteria include non-phytopathogenic and phytopathogenic symbionts which are non-randomly distributed with respect to the type of harbored VEP1 gene. Our findings suggest that VEP1 may have been instrumental for the evolutionary transition of green plants to land, and point to a LGT-mediated 'Trojan Horse' mechanism for the evolution of bacterial pathogenesis against plants. VEP1 may serve as tool for revealing microbial interactions in plant/fungi-associated environments.     

Glycogen phosphorylase sequences from the amitochondriate protists, Trichomonas vaginalis, Mastigamoeba balamuthi, Entamoeba histolytica and Giardia intestinalis

Glycogen phosphorylase genes or messages from four amitochondriate eukaryotes, Trichomonas vaginalis, Mastigamoeba balamuthi, Entamoeba histolytica (two genes) and Giardia intestinalis, have been isolated and sequenced. The sequences of the amitochondriate protist enzymes appear to share a most recent common ancestor. The clade containing these sequences is closest to that of another protist, the slime mold (Dictyostelium discoideum), and is more closely related to fungal and plant phosphorylases than to mammalian and eubacterial homologs. Structure-based amino acid alignment shows conservation of the residues and domains involved in catalysis and allosteric regulation by glucose 6-phosphate but high divergence at domains involved in phosphorylation-dependent regulation and AMP binding in fungi and animals. Protist phosphorylases, as their prokaryotic and plant counterparts, are probably not regulated by phosphorylation.     

The DDE motif in RAG-1 is contributed in trans to a single active site that catalyzes the nicking and transesterification steps of V(D)J recombination

The process of assembling immunoglobulin and T-cell receptor genes from variable (V), diversity (D), and joining (J) gene segments, called V(D)J recombination, involves the introduction of DNA breaks at recombination signals. DNA cleavage is catalyzed by RAG-1 and RAG-2 in two chemical steps: first-strand nicking, followed by hairpin formation via direct transesterification. In vitro, these reactions minimally proceed in discrete protein-DNA complexes containing dimeric RAG-1 and one or two RAG-2 monomers bound to a single recombination signal sequence. Recently, a DDE triad of carboxylate residues essential for catalysis was identified in RAG-1. This catalytic triad resembles the DDE motif often associated with transposase and retroviral integrase active sites. To investigate which RAG-1 subunit contributes the residues of the DDE triad to the recombinase active site, cleavage of intact or prenicked DNA substrates was analyzed in situ in complexes containing RAG-2 and a RAG-1 heterodimer that carried an active-site mutation targeted to the same or opposite RAG-1 subunit mutated to be incompetent for DNA binding. The results show that the DDE triad is contributed to a single recombinase active site, which catalyzes the nicking and transesterification steps of V(D)J recombination by a single RAG-1 subunit opposite the one bound to the nonamer of the recombination signal undergoing cleavage (cleavage in trans). The implications of a trans cleavage mode observed in these complexes on the organization of the V(D)J synaptic complex are discussed.