Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.     

Bacterial beta-lactamase fragmentation complementation strategy can be used as a method for identifying interacting protein pairs

We investigated the applicability of the TEM-1 beta- lactamase fragment complementation (BFC) system to develop a strategy for the screening of protein-protein interactions in bacteria. A BFC system containing a human Fas-associated death domain (hFADD) and human Fas death domain (hFasDD) was generated. The hFADD-hFasDD interaction was verified by cell survivability in ampicillin-containing medium and the colorimetric change of nitrocefin. It was also confirmed by His pull-down assay using cell lysates obtained in selection steps. A coiled-coil helix coiled-coil domain-containing protein 5 (CHCH5) was identified as an interacting protein of human uracil DNA glycosylase (hUNG) from the bacterial BFC cDNA library strategy. The interaction between hUNG and CHCH5 was further confirmed with immunoprecipitation using a mammalian expression system. CHCH5 enhanced the DNA glycosylase activity of hUNG to remove uracil from DNA duplexes containing a U/G mismatch pair. These results suggest that the bacterial BFC cDNA library strategy can be effectively used to identify interacting protein pairs.