Complete nucleotide sequence of a thermophilic alpha-amylase gene: homology between prokaryotic and eukaryotic alpha-amylases at the active sites

The nucleotide sequence of a thermophilic, liquefying alpha-amylase gene cloned from B. stearothermophilus was determined. The NH2-terminal amino acid sequence analysis of the B. stearothermophilus alpha-amylase confirmed that the reading frame of the gene consisted of 1,644 base pairs (548 amino acids). The B. stearothermophilus alpha-amylase had a signal sequence of 34 amino acids, which was cleaved at exactly the same site in E. coli. The mature enzyme contained two cysteine residues, which might play an important role in maintenance of a stable protein conformation. Comparison of the amino acid sequence inferred from the B. stearothermophilus alpha-amylase gene with those inferred from other bacterial liquefying alpha-amylase genes and with the amino acid sequences of eukaryotic alpha-amylases showed three homologous sequences in the enzymatically functional regions.     

Signal peptide of Bacillus subtilis alpha-amylase

Mature alpha-amylase of Bacillus subtilis is known to be formed from its precursor by the removal of the NH2-terminal 41 amino acid sequence (41 amino acid leader sequence). DNA fragments coding for short sequences consisting of 28 (Pro as the COOH terminus) 29 (Ala), 31 (Ala), and 33 (Ala) amino acids from the translation initiator, Met, in the leader sequence were prepared and fused in frame to the DNA encoding the mature alpha-amylase. The secretion activity of the 33 amino acid sequence was nearly twice as high as that of the parental 41 amino acid sequence, whereas the activity of the 31 amino acid sequence was 75% of that of the parent. In contrast, almost no secretion activity was observed with the 28 and 29 amino acid sequences. The signal peptide cleavage site of the precursor expressed from the plasmid encoding the 33 amino acid sequence was located between Ala and Leu at positions 33 and 34 and that from the 31 amino acid sequence between Thr and Ala at positions 33 and 34. The NH2-terminal amino acid from the latter corresponded to the 3rd amino acid of the mature enzyme. These results indicated that the functional signal peptide of the B. subtilis beta-amylase consists of the first 33 amino acids from the initiator, Met.     

Artificial insertion of peptides between signal peptide and mature protein: effect on secretion and processing of hybrid thermostable alpha-amylases in Bacillus subtilis and Escherichia coli cells

To study the effect of inserted peptides on the secretion and processing of exported proteins in Bacillus subtilis and Escherichia coli, pBR322-derived DNA fragments coding for small peptides were inserted between the DNA coding for the 31 amino acid B. subtilis alpha-amylase signal peptide and that coding for the mature part of the extracellular thermostable alpha-amylase of B. stearothermophilus. Most of the inserted peptides (21 to 65 amino acids) decreased the production of the enzyme in B. subtilis and E. coli, the effect of each peptide being similar in the two strains. In contrast, with one peptide (a 21 amino acid sequence encoded by the extra DNA in pTUBE638), the production of alpha-amylase was enhanced more than 1.7-fold in B. subtilis in comparison with that of the parent strain. The molecular masses of the thermostable alpha-amylases in the periplasm of the E. coli transformants varied for each peptide insert, whereas those in the culture supernatants of the B. subtilis transformants had molecular masses similar to that of the mature enzyme. Based on the NH2-terminal amino acid sequence of the hybrid protein from pTUBE638, it was shown that in E. coli, the NH2-terminally extended thermostable alpha-amylase was translocated and remained in the periplasm after the 31 amino acid signal sequence was removed. In the case of B. subtilis, after the removal of a 34-amino acid signal sequence, the hybrid protein was secreted and processed to the mature form.     

Length and structural effect of signal peptides derived from Bacillus subtilis alpha-amylase on secretion of Escherichia coli beta-lactamase in B. subtilis cells.

The precursor of Bacillus subtilis alpha-amylase contains an NH2-terminal extension of 41 amino acid residues as the signal sequence. The E. coli beta-lactamase structural gene was fused with the DNA for the promoter and signal sequence regions. Activity of beta-lactamase was expressed and more than 95% of the activity was secreted into the culture medium. DNA fragments coding for short signal sequences 28, 31, and 33 amino acids from the initiator Met were prepared and fused with the beta-lactamase structural gene. The sequences of 31 and 33 amino acid residues with Ala COOH-terminal amino acid were able to secrete active beta-lactamase from B. subtilis cells. However beta-lactamase was not secreted into the culture medium by the shorter signal sequence of 28 amino acid residues, which was not cleaved. Molecular weight analysis of the extracellular and cell-bound beta-lactamase suggested that the signal peptide of B. subtilis alpha-amylase was the first 31 amino acids from the initiator Met. The significance of these results was discussed in relation to the predicted secondary structure of the signal sequences.     

Processing of an NH2-terminally extended thermostable alpha-amylase by Bacillus subtilis alkaline protease

To analyze the processing of extracellular enzymes of Bacillus subtilis, an NH2-terminally extended hybrid alpha-amylase [pTUBE638-alpha-amylase (E24)] was purified from the periplasm of E. coli(pTUBE638) as the substrate for the in vitro processing reaction, in which a 21-amino-acid extra-peptide was added at the NH2-terminus of the mature thermostable alpha-amylase. The extended peptide in pTUBE638-alpha-amylase (E24) was completely processed by the extracellular alkaline protease of B. subtilis alone at pH 7.5 to 10.0. The processing was inhibited by 2 mM PMSF. In contrast, the neutral protease did not process the extended peptide. The processing activity of the purified alkaline protease was fully active in 100 mM phosphate and glycine-NaCl-NaOH buffer while it was partially active in 100 mM Tris-HCl or MOPS buffer. The optimum pH of the activity ranged from 8.0 to 9.0, although the optimum pH of the alkaline protease activity toward casein and Azocoll was 10.5. The NH2-terminal amino acid sequences of the enzymes processed in vitro coincided with those of the mature extracellular thermostable alpha-amylases in the culture medium of B. subtilis (pTUBE638). The appearance of the processing activity of alkaline protease was correlated with the changes of the pH in the culture medium.     

Nucleotide sequence of the beta-cyclodextrin glucanotransferase gene of alkalophilic Bacillus sp. strain 1011 and similarity of its amino acid sequence to those of alpha-amylases.

The nucleotide sequence of the gene for cyclodextrin glucanotransferase of alkalophilic Bacillus sp. strain 1011 was determined. The deduced amino acid sequence at the NH2-terminal side of the enzyme showed a high homology with the sequences of alpha-amylase in the three regions which constitutes the active centers of alpha-amylases.     

Structural requirements of Bacillus subtilis alpha-amylase signal peptide for efficient processing: in vivo pulse-chase experiments with mutant signal peptides.

The Bacillus subtilis alpha-amylase signal peptide consists of 33 amino acids from its translation initiation site. To analyze the structural requirements for efficient processing of the signal peptide, single and repeated Ala-X-Ala sequences and their modifications were introduced into B. subtilis alpha-amylase signal peptides of different lengths and the mature thermostable alpha-amylase. Then the cleavage positions and processing rates of the signal peptides were analyzed by the NH2-terminal amino acid sequences of the exported thermostable alpha-amylases and by in vivo pulse-chase experiments. In B. subtilis, the most efficient cleavage site was located at the peptide bond between Ala-33 and amino acid X at position 34, even though Val-X-Ala and six repeating Ala-X-Ala sequences were present around the cleavage site. However, the cleavage site was shifted to the peptide bond between Ala-31 and amino acid X when Ala-33 was deleted, and it was also shifted to Ala-35 and X when Ala-33 was replaced with Val-33. The shorter signal peptide consisting of 31 amino acids reduced the processing rate and alpha-amylase production. In contrast, those signal peptides were cleaved preferentially at the peptide bond between Ala-31 and amino acid X in Escherichia coli. In addition to the presence of an Ala residue at the -1 amino acid position, the length of the signal peptide was another important requirement for efficient processing.     

Purification, characterization, and nucleotide sequence of an intracellular maltotriose-producing alpha-amylase from Streptococcus bovis 148.

An intracellular alpha-amylase from Streptococcus bovis 148 was purified and characterized. The enzyme was induced by maltose and soluble starch and produced about 80% maltotriose from soluble starch. Maltopentaose was hydrolyzed to maltotriose and maltose and maltohexaose was hydrolyzed mainly to maltotriose by the enzyme. Maltotetraose, maltotriose, and maltose were not hydrolyzed. This intracellular enzyme was considered to be a maltotriose-producing enzyme. The enzymatic characteristics and hydrolysis product from soluble starch were different from those of the extracellular raw-starch-hydrolyzing alpha-amylase of strain 148. The deduced amino acid sequence of the intracellular alpha-amylase was similar to the sequences of the mature forms of extracellular liquefying alpha-amylases from Bacillus strains, although the intracellular alpha-amylase did not contain a signal peptide. No homology between the intracellular and extracellular alpha-amylases of S. bovis 148 was observed.     

Nucleotide sequence of the maltohexaose-producing amylase gene from an alkalophilic Bacillus sp. #707 and structural similarity to liquefying type alpha-amylases

The nucleotide sequence of the gene for maltohexaose-producing amylase from an alkalophilic Bacillus sp. #707 was determined. Starting at an ATG initiation codon, an open reading frame was composed of 1554 bp (518 amino acids). The NH2-terminal portion encoded a 33 amino acid-long signal peptide. The deduced amino acid sequence of the extracellular mature enzyme was more than 60% homologous to those of the liquefying type alpha-amylases but not to those of the saccharifying type alpha-amylases. The sequence of its signal peptide was completely different from those of other alpha-amylases.     

Nucleotide sequence of the G6-amylase gene from alkalophilic Bacillus sp. H-167

The nucleotide sequence of the G6-amylase gene from alkalophilic Bacillus sp. H-167 was determined. The open reading frame of the gene consisted of 2865 base pairs, encoding 955 amino acids. The NH2-terminal amino acid sequence analysis of the G6-amylase indicated that the enzyme had a single peptide of 33 amino acid residues and the mature enzyme was composed of 922 amino acids, giving a molecular mass of 102,598. Identity of the NH2-terminal amino acid sequences among each component of the multiform G6-amylase suggested the proteolytic processing of the COOH-terminal side of the enzyme. The DNA sequence and the deduced amino acid sequence of the G6-amylase gene showed no homology with those of other bacterial alpha-amylases although the consensus amino acid sequences of the active center were well conserved.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

Structure of yeast pGKL 128-kDa killer-toxin secretion signal sequence. Processing of the 128-kDa killer-toxin-secretion-signal-alpha-amylase fusion protein.

The linear double-stranded DNA plasmid pGKL1 in yeast encodes a killer toxin consisting of 97-kDa, 31-kDa and 28-kDa subunits. A 128-kDa protein precursor of the 97-kDa and 31-kDa subunits, was first synthesized with a 29-amino-acid extension at its NH2-terminus as a secretion signal sequence. In the present study, the property of this signal sequence was studied by the analysis of a fusion protein with mouse alpha-amylase. Using the secretion signal sequence of the killer protein, the mouse alpha-amylase was successfully secreted into the culture medium. An intracellular precursor form of alpha-amylase was identified and purified. Analysis of the NH2-terminal sequence of this precursor molecule indicated that it corresponded to the secretory intermediate (pro form) of alpha-amylase with the removal of the hydrophobic segment (Met1-Gly16) of the secretion signal. Both the secretion of alpha-amylase into the culture medium and the detection of the pro-alpha-amylase species in the cells were prohibited by a sec 11 mutation, or by the conversion of Gly to Val at the 16th position of the secretion signal. These results strongly suggest that the cleavage occurs between Gly16 and Leu17 by a signal peptidase, and that this cleavage is required for the secretion of alpha-amylase into the medium. Based on the data from the NH2-terminal amino acid sequences of secreted alpha-amylases, we conclude that the 29-amino-acid secretion signal present in the 128-kDa killer toxin precursor protein is a prepro structure.     

Maturation of an NH2-terminally extended thermostable alpha-amylase in Bacillus subtilis: a possible mechanism examined by in vitro experiments.

An artificially inserted extra peptide (21 amino acid peptide) between the B. subtilis alpha-amylase signal peptide and the mature thermostable alpha-amylase was completely cleaved by B. subtilis alkaline protease in vitro. The cleavage to form a mature enzyme was observed between pH 7.5 and 10, but not between pH 6.0 and 6.5, although a similar protease activity toward Azocall was observed between pH 6.0 and 7.5. To analyze the effects of pH on the cleavage, CD spectra at pH 6, 8, and 11 of the NH2-terminally extended thermostable alpha-amylase were analyzed and the results were compared with those of the mature form of the alpha-amylase. It is suggested that the cleavage of the NH2-terminally extended peptide is controlled by the secondary and tertiary structure of the precursor enzyme. Similar cleavage of different NH2-terminally extended peptides by the alkaline protease was also found in other hybrid thermostable alpha-amylases obtained.     

Processing of the prepropeptide portions of the Bacillus amyloliquefaciens neutral protease fused to Bacillus subtilis alpha-amylase and human growth hormone during secretion in Bacillus subtilis.

A set of nested 3'-terminal deletions of the prepropeptide of the Bacillus amyloliquefaciens neutral protease gene was constructed. Alpha-amylase and human growth hormone were secreted using these truncated genes in Bacillus subtilis. The level of the secreted alpha-amylase varied with the region for the truncated prepropeptide contained in the fusion gene but was independent of its length. Even though length of the prepropeptide varied, the mobilities of secreted alpha-amylases were the same as that of the control alpha-amylase derived from the alpha-amylase clone, pTUB4 (Yamazaki et al., 1983). Analyses of the secreted N-terminal amino acid sequences confirmed that they were all identical to that of the authentic one. Precursor proteins of the alpha-amylase were found in the cell-associated fraction, suggesting that the prepropeptide portion was processed during secretion. On the other hand, the N-terminus of hGH secreted using one of these prepropeptide portions varied by 1 to 4 additional N-terminal amino acid residues derived from the junction sequence between the sequence for propeptide portion and mature hGH or from C-terminal region of the propeptide portion. These results suggest that the prepropeptide portion can be generally processed even in the heterogeneous fusion. A probable mechanism of processing and maturation of the fusion gene products is also discussed.     

Structural genes encoding the thermophilic alpha-amylases of Bacillus stearothermophilus and Bacillus licheniformis.

The genes encoding the thermostable alpha-amylases of Bacillus stearothermophilus and B. licheniformis were cloned in Escherichia coli, and their DNA sequences were determined. The coding and deduced polypeptide sequences are 59 and 62% homologous to each other, respectively. The B. stearothermophilus protein differs most significantly from that of B. licheniformis in that it possesses a 32-residue COOH-terminal tail. Transformation of E. coli with vectors containing either gene resulted in the synthesis and secretion of active enzymes similar to those produced by the parental organisms. A plasmid was constructed in which the promoter and the NH2-terminal two-thirds of the B. stearothermophilus coding sequence was fused out of frame to the entire mature coding sequence of the B. licheniformis gene. Approximately 1 in 5,000 colonies transformed with this plasmid was found to secrete an active amylase. Hybridization analysis of plasmids isolated from these amylase-positive colonies indicated that the parental coding sequences had recombined by homologous recombination. DNA sequence analysis of selected hybrid genes revealed symmetrical, nonrandom distribution of loci at which the crossovers had resolved. Several purified hybrid alpha-amylases were characterized and found to differ with respect to thermostability and specific activity.     

The prepro-peptide of Mucor rennin directs the secretion of human growth hormone by Saccharomyces cerevisiae

An aspartic proteinase, Mucor pusillus rennin (MPR), of filamentous fungus Mucor pusillus, is efficiently secreted from a transformant of Saccharomyces cerevisiae containing the intact MPR gene. To test the usefulness of the MPR leader peptide in secretion of heterologous proteins from yeast cells, several plasmids encoding the fusion proteins composed of different parts of the NH2-terminal region of prepro-MPR and human growth hormone (hGH) were constructed. The parts of the leader peptide upstream of hGH were the whole prepro-peptide following the NH2-terminal region of mature MPR in JGH1, the intact pre-sequence and a part of the pro-sequence in JGH2, and the putative signal sequences of the NH2-terminal 18 and 22 amino acids in JGH3 and JGH7, respectively. When the hGH genes fused to these leader sequences were expressed in yeast cells under the control of the yeast GAL7 promoter, proteins of various sizes immunoreactive with the anti-hGH antibody were secreted into the medium. Among the plasmids mentioned above, JGH2 directed the greatest secretion of the protein of 23 kilodaltons in size, which contained the expected NH2-terminal amino acid sequence of an additional eight amino acids derived from the pro-peptide of MPR. The addition of the GAL10 terminator downstream of the hGH gene in JGH2 resulted in a greater than three- to fivefold increase in the secretion, whereas the insertion of the GAL4 gene, which is a positive regulator for the GAL system, had no significant effect. The improved yield of the total protein of hGH secreted into the medium reached approximately 10 mg/liter.     

The prepro-peptide of Mucor rennin directs the secretion of human growth hormone by Saccharomyces cerevisiae.

An aspartic proteinase, Mucor pusillus rennin (MPR), of filamentous fungus Mucor pusillus, is efficiently secreted from a transformant of Saccharomyces cerevisiae containing the intact MPR gene. To test the usefulness of the MPR leader peptide in secretion of heterologous proteins from yeast cells, several plasmids encoding the fusion proteins composed of different parts of the NH2-terminal region of prepro-MPR and human growth hormone (hGH) were constructed. The parts of the leader peptide upstream of hGH were the whole prepro-peptide following the NH2-terminal region of mature MPR in JGH1, the intact pre-sequence and a part of the pro-sequence in JGH2, and the putative signal sequences of the NH2-terminal 18 and 22 amino acids in JGH3 and JGH7, respectively. When the hGH genes fused to these leader sequences were expressed in yeast cells under the control of the yeast GAL7 promoter, proteins of various sizes immunoreactive with the anti-hGH antibody were secreted into the medium. Among the plasmids mentioned above, JGH2 directed the greatest secretion of the protein of 23 kilodaltons in size, which contained the expected NH2-terminal amino acid sequence of an additional eight amino acids derived from the pro-peptide of MPR. The addition of the GAL10 terminator downstream of the hGH gene in JGH2 resulted in a greater than three- to fivefold increase in the secretion, whereas the insertion of the GAL4 gene, which is a positive regulator for the GAL system, had no significant effect. The improved yield of the total protein of hGH secreted into the medium reached approximately 10 mg/liter.     

A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes.