The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes

Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.     

Sequences of the 5S rRNAs of the thermo-acidophilic archaebacterium Sulfolobus solfataricus (Caldariella acidophila) and the thermophilic eubacteria Bacillus acidocaldarius and Thermus aquaticus.

We have determined the nucleotide sequences of the 5 S rRNAs of three thermophilic bacteria: the archaebacterium Sulfolobus solfataricus, also named Caldariella acidophila, and the eubacteria Bacillus acidocaldarius and Thermus aquaticus. A 5 S RNA sequence for the latter species had already been published, but it looked suspect on the basis of its alignment with other 5 S RNA sequences and its base-pairing pattern. The corrected sequence aligns much better and fits in the universal five helix secondary structure model, as do the sequences for the two other examined species. The sequence found for Sulfolobus solfataricus is identical to that determined by others for Sulfolobus acidocaldarius. The secondary structure of its 5 S RNA shows a number of exceptional features which distinguish it not only from eubacterial and eukaryotic 5 S RNAs, but also from the limited number of archaebacterial 5 S RNA structures hitherto published. The free energy change of secondary structure formation is large in the three examined 5 S RNAs.     

Two thraustochytrid 5S ribosomal RNAs.

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.     

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.     

Phylogeny of the 5S ribosomal RNA from Synechococcus lividus II: the cyanobacterial/chloroplast 5S RNAs form a common structural class

The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacterium Synechococcus lividus II has been determined. The sequence is (sequence in text) This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA of S. lividus II has 27 base differences compared with the 5S RNA of the related strain S. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs from S. lividus II, S. lividus III, and spinach chloroplasts are identical, but differ considerably from that of Escherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA of E. coli and these cyanobacterial and chloroplast 5S RNAs.     

The calculation of plant 5S rRNAs secondary structure

Using commercially available computer software package for ribonucleic acid (RNA) secondary structure analysis we calculated the free energy (delta G) of all higher plant 5S rRNA species. To gain insight into the relation between structure (nucleotide sequence) and free energy we generated point mutants of plant 5S rRNA and calculated their secondary structure. This analysis permitted to identify single sites which affect the stability and conformation of RNA molecule. Furthermore, the calculated data were compared with the electrophoretic mobility of 5S rRNA on polyacrylamide gels.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Two 5S genes are expressed in chicken somatic cells.

Two 5S RNA species were detected in chicken cells. 5S I RNA has the nucleotide sequence of chicken 5S RNA previously published by Brownlee et al. (1) and 5S II RNA differs from it by 10 mutations. The secondary structure of both species is compatible with that proposed for other eukaryotic 5S RNAs. 5S II RNA represents 50-60% of 5S I RNA. Both species were found in total chicken liver and brain and were present in polysomes in the same relative proportions. Only one 5S RNA species could be detected in rat liver and HeLa cells. Chicken is the first vertebrate described so far in which two 5S RNA genes are expressed in somatic cells.     

Evolutionary relationships amongst archaebacteria. A comparative study of 23 S ribosomal RNAs of a sulphur-dependent extreme thermophile, an extreme halophile and a thermophilic methanogen

The 23 S RNA genes representative of each of the main archaebacterial subkingdoms, Desulfurococcus mobilis an extreme thermophile, Halococcus morrhuae an extreme halophile and Methanobacterium thermoautotrophicum a thermophilic methanogen, were cloned and sequenced. The inferred RNA sequences were aligned with all the available 23 S-like RNAs of other archaebacteria, eubacteria/chloroplasts and the cytoplasm of eukaryotes. Universal secondary structural models containing six major structural domains were refined, and extended, using the sequence comparison approach. Much of the present structure was confirmed but six new helices were added, including one that also exists in the eukaryotic 5.8 S RNA, and extensions were made to several existing helices. The data throw doubt on whether the 5' and 3' ends of the 23 S RNA interact, since no stable helix can form in either the extreme thermophile or the methanogen RNA. A few secondary structural features, specific to the archaebacterial RNAs were identified; two of these were supported by a comparison of the archaebacterial RNA sequences, and experimentally, using chemical and ribonuclease probes. Seven tertiary structural interactions, common to all 23 S-like RNAs, were predicted within unpaired regions of the secondary structural model on the basis of co-variation of nucleotide pairs; two lie in the region of the 23 S RNA corresponding to 5.8 S RNA but they are not conserved in the latter. The flanking sequences of each of the RNAs could base-pair to form long RNA processing stems. They were not conserved in sequence but each exhibited a secondary structural feature that is common to all the archaebacterial stems for both 16 S and 23 S RNAs and constitutes a processing site. Kingdom-specific nucleotides have been identified that are associated with antibiotic binding sites at functional centres in 23 S-like RNAs: in the peptidyl transferase centre (erythromycin-domain V) the archaebacterial RNAs classify with the eukaryotic RNAs; at the elongation factor-dependent GTPase centre (thiostrepton-domain II) they fall with the eubacteria, and at the putative amino acyl tRNA site (alpha-sarcin-domain VI) they resemble eukaryotes. Two of the proposed tertiary interactions offer a structural explanation for how functional coupling of domains II and V occurs at the peptidyl transferase centre. Phylogenetic trees were constructed for the archaebacterial kingdom, and for the other two kingdoms, on the basis of the aligned 23 S-like RNA sequences.(ABSTRACT TRUNCATED AT 400 WORDS)     

An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.     

Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

Molecular evolution of 5S RNA

Summary Based on the comparative analyses of the primary structure of 5S RNAs from 19 organisms, a secondary structure model of 5S RNA is proposed. 5S RNA has essentially the same structure among all prokaryotic species. The same is true for eukaryotic 5S RNAs. Prokaryotic and eukaryotic 5S RNAs are also quite similar to each other, except for a difference in a specific region.By comparing the nucleotide alignment from the juxtaposed 5S RNA secondary structures, a phylogenic tree of nineteen organisms was constructed. The time of divergence between prokaryotes and eukaryotes was estimated to be 2.5×10⁹ years ago (minimum estimate: 2.1×10⁹).     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

Raman and 19F(1H) nuclear Overhauser evidence for a rigid solution conformation of Escherichia coli 5-fluorouracil 5S ribonucleic acid

Escherichia coli cells grown on a medium containing 5-fluorouracil (FU) produce 5S RNA whose uracil residues are approximately 80% replaced by FU. The Raman spectra of native and FU-5S RNA are very similar, confirming similar solution conformations for the two species and a highly base-stacked structure in solution. The 254-MHz 19F NMR spectrum of FU-5S RNA shows that the 20-odd FU residues reside in at least ten distinct chemical environments, suggesting a highly ordered structure. Comparison of theoretical and experimental 19F(1H) nuclear Overhauser enhancements demonstrates definitively that virtually all the labeled uracils are bound to a rigid macromolecular frame, with a rotational correlation time of about 19 ns or longer. Since these uracils are widely distributed throughout the nucleotide primary sequence, it may be concluded that the entire FU-5S RNA solution structure is relatively rigid, in agreement with the most recently proposed "cloverleaf" secondary structural model for native prokaryotic 5S RNA.     

Conservation of the secondary structure elements of the 5''-untranslated region of cardio- and aphthovirus RNAs.

An analysis of published nucleotide sequences of the 5'-untranslated region (5'-UTR) of 7 cardioviruses and 3 aphthoviruses has allowed us to derive a consensus secondary structure model that differs from that previously proposed for the 5'-UTR of entero- and rhinoviruses, though all these viruses belong to the same family, Picornaviridae. The theoretical model derived here was experimentally supported by investigating the accessibility of encephalomyocarditis virus RNA to modifications with dimethyl sulfate and its susceptibility to S1 and cobra venom nucleases. The possible involvement of the 5"-UTR secondary structure domains in the translational control is briefly discussed.     

An enhanced thermostability in thermophilic 5-S ribonucleic acids under physiological salt conditions.

The secondary structure of 5-S rRNAs of Thermus aquaticus (an extreme thermophile), Bacillus stearothermophilus (a moderate thermophile) and Escherichia coli (a mesophile) was compared using thermal denaturation techniques under varying ionic conditions. At a low ionic strength (10 mM K+), the Tm of T. aquaticus 5-S RNA differed by only 1 degrees C from that of E. coli RNA and the molecule was fully denatured well below the optimum growth temperature of the thermophile. The internal Na+, K+ and Mg2+ concentrations of T. aquaticus cells were determined to be 91 mM, 130 mM and 59 mM, respectively. Under these salt conditions, T. aquaticus 5-S RNA was significantly more stable than E. coli RNA and the 5-S RNA from B. stearothermophilus was intermediate as is its optimum growth temperature. The results suggest that the thermostability of macromolecules from thermophilic organisms may be specially dependent on the internal salt concentration. Furthermore, under these salt conditions, most of the secondary structure of the RNA remained stable at the optimum growth temperatures suggesting that ribosomal RNAs of thermophilic organisms contribute more to the thermostability of the ribosome than previously thought.     

Characterization of cytoplasmic and chloroplast 5S ribosomal ribonucleic acid from broad-bean leaves

Green leaves of the broad bean (Vicia faba) contain two 5S RNA components that can be separated from each other by polyacrylamide-gel electrophoresis. The major component is located in the larger subunit of cytoplasmic ribosomes, whereas the minor component occurs in the larger subunit of chloroplast ribosomes. Their electrophoretic mobilities relative to those of Escherichia coli 5S RNA (120 nucleotides) and plant 4S RNA (78 nucleotides) suggest that they consist of 118 and 122 nucleotide residues respectively. Thermal ;melting' profiles of plant cytoplasmic and chloroplast 5S RNA species at 260nm indicate the similarity of their secondary structures, not only to each other, but also to those of E. coli and mammalian 5S RNA species. The base compositions of the two plant 5S RNA species have more in common with each other than with the corresponding molecules from either E. coli or mammalian cells.     

Phylogeny of the 5S ribosomal RNA fromSynechococcus lividus II: The cyanobacterial/chloroplast 5S RNAs form a common structural class

Summary The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacteriumSynechococcus lividus II has been determined. The sequence is 5-UGCCUAGUGUUUAUGGCGCG-GUGGAACCACGCUGAUCCAUCCCGAACUC-AGAGGUGAAACAUCGCAGCGGUGAAGAU-AGUUGGAGGGUAGCCUCCUGCAAAAAUA-GCUCAAUGCUAGGCA_OH-3. This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA ofS. lividus II has 27 base differences compared with the 5S RNA of the related strainS. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs fromS. lividus II,S. lividus III, and spinach chloroplasts are identical, but differ considerably from that ofEscherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA ofE. coli and these cyanobacterial and chloroplast 5S RNAs.