樗蚕丝腺5SrRNA的核苷酸顺序

本文用凝胶直读法、末端鉴定法等相配合,测定了樗蚕(Philosamia cynthia)絲腺5SrRNA的核苷酸顺序:AGACAACGUCCAUACCACGUUGAAAACACCGGUUCUCGUCCGAUCACCGAAGUCAAGCAACGUCGGGCGCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGCGUGCUGUUGGCUU比较了樗蚕、蓖麻蚕、柞蚕、家蚕、果蝇等5SrRNA结构差异,在分子水平上探讨了昆虫的分化。     

Sequence and secondary structure of Drosophila melanogaster 5.8S and 2S rRNAs and of the processing site between them.

Drosophila melanogaster 5.8S and 2S rRNAs were end-labeled with 32p at either the 5' or 3' end and were sequenced. 5.8S rRNA is 123 nucleotides long and homologous to the 5' part of sequenced 5.8S molecules from other species. 2S rRNA is 30 nucleotides long and homologous to the 3' part of other 5.8S molecules. The 3' end of the 5.8S molecule is able to base-pair with the 5' end of the 2S rRNA to generate a helical region equivalent in position to the "GC-rich hairpin" found in all previously sequenced 5.8S molecules. Probing the structure of the labeled Drosophila 5.8S molecule with S1 nuclease in solution verifies its similarity to other 5.8S rRNAs. The 2S rRNA is shown to form a stable complex with both 5.8S and 26S rRNAs separately and together. 5.8S rRNA can also form either binary or ternary complexes with 2S and 26S rRNA. It is concluded that the 5.8S rRNA in Drosophila melanogaster is very similar both in sequence and structure to other 5.8 rRNAs but is split into two pieces, the 2S rRNA being the 3' part. 2S anchors the 5.8S and 26S rRNA. The order of the rRNA coding regions in the ribosomal DNA repeating unit is shown to be 18S - 5.8S - 2S - 26S. Direct sequencing of ribosomal DNA shows that the 5.8S and 2S regions are separated by a 28 nucleotide spacer which is A-T rich and is presumably removed by a specific processing event. A secondary structure model is proposed for the 26S-5.8S ternary complex and for the presumptive precursor molecule.     

5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions.     

Non-ribosomal nucleotide sequences in 7-S RNA, the immediate precursor of 5.8-S ribosomal RNA in yeast.

The topography and the length of the non-ribosomal sequences present in 7-S RNA, the immediate precursor of 5.8-S ribosomal RNA, from the yeast Saccharomyces carlsbergensis were determined by analyzing the nucleotide sequences of the products obtained after complete digestion of 7-S RNA with RNase T1. The results show that 7-S RNA contains approximately 150 non-ribosomal nucleotides. The majority (90%) of the 7-S RNA molecules was found to have the same 5'-terminal pentadecanucleotide sequence as mature 5.8-S rRNA. The remaining 10% exhibited 5'-terminal sequences identical to those of 5.9-S RNA, which has the same primary structure as 5.8-S rRNA except for a slight extension at the 5' end [Rubin, G.M. (1974) Eur. J. Biochem. 41, 197--202]. These data show that the non-ribosomal nucleotides present in 7-S RNA are all located 3'-distal to the mature 5.8-S rRNA sequence. Moreover, it can be concluded that 5.9-S RNA is a stable rRNA rather than a precursor of 5.8-S rRNA. The 3'-terminal sequence of 5.8-S rRNA (U-C-A-U-U-UOH) is recovered in a much longer oligonucleotide in the T1 RNase digest of 7-S RNA having the sequence U-C-A-U-U-U-(C-C-U-U-C-U-C)-A-A-A-C-A-(U-U-C-U)-Gp. The sequences enclosed in brackets are likely to be correct but could not be established with absolute certainty. The arrow indicates the bond cleaved during processing. The octanucleotide sequence -A-A-A-C-A-U-U-C- located near the cleavage site shows a remarkable similarity to the 5'-terminal octanucleotide sequence of 7-S RNA (-A-A-A-C-U-U-U-C-). We suggest that these sequences may be involved in determining the specificity of the cleavages resulting in the formation of the two termini of 5.8-S rRNA.     

Site specific enzymatic cleavage of RNA.

The hybridization of a DNA oligonucleotide a specific tetramer or longer) will direct a cleavage by RNase H (EC 3.1.4.34) to a specific site in RNA. The resulting fragments can then be labeled at their 5' or 3' ends, purified, and sequenced directly. This procedure is demonstrated with two RNA molecules of known sequence: 5.8S rRNA from yeast (158 nucleotides) and satellite tobacco necrosis virus (STNV) RNA (1240 nucleotides).     

Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs and more unpaired bases than that of the HeLa 5.8S rRNA. These structural features may be essential for those 5.8S rRNAs which interact with 28S rRNAs containing the hidden break to form a stable complex.     

Effect of point mutations on 5.8S ribosomal ribonucleic acid secondary structure and the 5.8S--28S ribosomal ribonucleic acid junction

Naturally occurring differences in the nucleotide sequences of 5.8S ribosomal ribonucleic acids (rRNAs) from a variety of organisms have been used to study the role of specific nucleotides in the secondary structure and intermolecular interactions of this RNA. Significant differences in the electrophoretic mobilities of free 5.8S RNAs and the thermal stabilities of 5.8S--28S rRNA complexes were observed even in such closely related sequences as those of man, rat, turtle, and chicken. A single base transition from a guanylic acid residue in position 2 in mammalian 5.8S rRNA to an adenylic acid residue in turtle and chicken 5.8S rRNA results both in a more open molecular conformation and in a 5.8S--28S rRNA junction which is 3.5 degrees C more stable to thermal denaturation. Other changes such as the deletion of single nucleotides from either the 5' or the 3' terminals have no detectable effect on these features. The results support secondary structure models for free 5.8S rRNA in which the termini interact to various degrees and 5.8S--28S rRNA junctions in which both termini of the 5.8S molecule interact with the cognate high molecular weight RNA component.     

The structure of rat 28S ribosomal ribonucleic acid inferred from the sequence of nucleotides in a gene.

The nucleotide sequence of a rat 28S rRNA gene was determined. The 28S rRNA encoded in the gene contains 4718 nucleotides and the molecular weight estimated from the sequence is 1.53 x 10(6). The guanine and cytosine content is 67%. The sequence of rat 28S rRNA diverges appreciably from that of Saccharomyces carlsbergensis 26S rRNA (about 50% identity), but more closely approximates that of Xenopus laevis 28S rRNA (about 75% identity). Rat 28S rRNA is larger than the analogous nucleic acids from yeast (3393 nucleotides) and X, laevis (4110 nucleotides) ribosomes. The additional bases are inserted in specific regions and tend to be rich in guanine and cytosine. 5.8S rRNA can interact with 28S rRNA by extensive hydrogen bonding at two sites near the 5' end of the latter.     

Two distinct recognition signals define the site of endonucleolytic cleavage at the 5''-end of yeast 18S rRNA.

Three of the four eukaryotic ribosomal RNA molecules (18S, 5.8S and 25-28S rRNA) are transcribed as a single precursor, which is subsequently processed into the mature species by a complex series of cleavage and modification reactions. Early cleavage at site A1 generates the mature 5'-end of 18S rRNA. Mutational analyses have identified a number of upstream regions in the 5' external transcribed spacer (5' ETS), including a U3 binding site, which are required in cis for processing at A1. Nothing is known, however, about the requirement for cis-acting elements which define the position of the 5'-end of the 18S rRNA or of any other eukaryotic rRNA. We have introduced mutations around A1 and analyzed them in vivo in a genetic background where the mutant pre-rRNA is the only species synthesized. The results indicate that the mature 5'-end of 18S rRNA in yeast is identified by two partially independent recognition systems, both defining the same cleavage site. One mechanism identifies the site of cleavage at A1 in a sequence-specific manner involving recognition of phylogenetically conserved nucleotides immediately upstream of A1 in the 5' ETS. The second mechanism specifies the 5'-end of 18S rRNA by spacing the A1 cleavage at a fixed distance of 3 nt from the 5' stem-loop/pseudoknot structure located within the mature sequence. The 5' product of the A1 processing reaction can also be identified, showing that, in contrast to yeast 5.8S rRNA, the 5'-end of 18S rRNA is generated by endonucleolytic cleavage.     

Specific cleavage of ribosomal RNA caused by alpha sarcin.

Alpha sarcin causes the specific cleavage of RNA from 80S ribosomes and 60S subunits of yeast, but not from the 40S subunits to produce a small RNA fragment. The fragment was also produced on treatment of the 60S subunits of wheat germ ribosomes. The fragment has a molecular weight of 100,000 and is a cleavage product of the large RNA species in the 60S subunits. The fragment is not derived from the 5'end of the yeast 25S RNA nor does it bind to 5.8S RNA and we propose that the fragment represents the 3' terminal 320 nucleotides of 25S rRNA. The ability to produce fragment could not be separated from the ability of alpha sarcin to inhibit protein synthesis. Alpha sarcin also causes the specific cleavage of the 23S RNA of the E. coli subunit to produce a smaller fragment of RNA than that produced from eukaryote ribosomes.     

Sequence and secondary structure of mouse 28S rRNA 5''terminal domain. Organisation of the 5.8S-28S rRNA complex.

We present the sequence of the 5' terminal 585 nucleotides of mouse 28S rRNA as inferred from the DNA sequence of a cloned gene fragment. The comparison of mouse 28S rRNA sequence with its yeast homolog, the only known complete sequence of eukaryotic nucleus-encoded large rRNA (see ref. 1, 2) reveals the strong conservation of two large stretches which are interspersed with completely divergent sequences. These two blocks of homology span the two segments which have been recently proposed to participate directly in the 5.8S-large rRNA complex in yeast (see ref. 1) through base-pairing with both termini of 5.8S rRNA. The validity of the proposed structural model for 5.8S-28S rRNA complex in eukaryotes is strongly supported by comparative analysis of mouse and yeast sequences: despite a number of mutations in 28S and 5.8S rRNA sequences in interacting regions, the secondary structure that can be proposed for mouse complex is perfectly identical with yeast's, with all the 41 base-pairings between the two molecules maintained through 11 pairs of compensatory base changes. The other regions of the mouse 28S rRNA 5'terminal domain, which have extensively diverged in primary sequence, can nevertheless be folded in a secondary structure pattern highly reminiscent of their yeast' homolog. A minor revision is proposed for mouse 5.8S rRNA sequence.     

Gene heterogeneity: a basis for alternative 5.8S rRNA processing

Two bands of 5.8S rRNA were observed when the total RNA isolated from rat or mouse tissue was separated by electrophoresis on high-resolution polyacrylamide gels under denaturing conditions. The minor form, with a lower mobility, represented 15-35% of the total 5.8S rRNA, depending on the source of the tissue. Sequence analysis and the kinetics of formation showed that this minor form is elongated at the 5' end and is not a precursor. The sequence of the minor form was found to be p(C)CGAUA[CG-, five or six nucleotides longer than the major form. The minor 5.8S rRNA constituent also formed a more stable junction complex with 28S rRNA than the shorter major sequence. The rat DNA sequence that corresponds to the additional nucleotides at the 5' end of 5.8S rRNA has been reported to be -CCGTACG-[Subrahmanyam, C. S., Cassidy, B., Busch, H., & Rothblum, L. I. (1982) Nucleic Acids Res. 10, 3667-3680], a sequence which does not contain the extra adenylic acid residue at position 4 found in the minor form. This suggests that the rodent rRNA genes are heterogeneous and that the insertion of an A residue in the ribosomal precursor RNA can generate an alternate processing site.     

Effect of 2''-O-methylation on the structure of mammalian 5.8S rRNAs and the 5.8S-28S rRNA junction

The mammalian 5.8S rRNA contains a partially 2'-O-methylated uridylic acid residue at position 14 which is largely or entirely methylated in the cytoplasm (Nazar, R.N., Sitz, T.O. and Sommers, K.D. (1980) J. Mol. Biol. 142, 117-121). The effect of this methylation on the 5.8S RNA structure and 5.8-28S rRNA junction was investigated using both chemical and physical approaches. Electrophoretic studies indicated that the free 5.8S rRNA can take on at least two different conformations and that the 2'-O-methylation at U14 restricts the molecule to the more hydrodynamically open form. Structural studies using limited pancreatic or T1 ribonuclease digestion indicated that the methylated conformation was more susceptible to digestion, consistent with a more open tertiary structure. Modification-exclusion studies indicated that the first 29 nucleotides at the 5' end and residues 140 through 158 at the 3' end affect the 5.8S-28S rRNA interaction, supporting previous suggestions that the 5.8S RNA interacts with its cognate high molecular weight component through its termini. These results also suggested that the 2'-O-methylated uridylic acid residue plays a role in the 5.8S-28S rRNA interaction and thermal denaturation studies confirmed this by showing that methylation destabilizes the 5.8S-28S rRNA junction. The 5.8-28S rRNA interaction appears to be more complex than previously believed.     

Binding of ribosomes to the 5' leader sequence (N = 258) of RNA 3 from alfalfa mosaic virus.

RNA 3 of alfalfa mosaic virus (AlMV) contains information for two genes: near the 5' end an active gene coding for a 35 Kd protein and, near the 3' end, a silent gene coding for viral coat protein. We have determined a sequence of 318 nucleotides which contains the potential initiation codon for the 35 Kd protein at 258 nucleotides from the 5' end. This long leader sequence can form initiation complexes containing three 80 S ribosomes. A shorter species of RNA, corresponding to a molecule of RNA 3 lacking the cap and the first 154 nucleotides (RNA 3') has been isolated. The remaining leader sequence of 104 nucleotides in RNA 3' forms a single 80 S initiation complex with wheat germ ribosomes. The location of the regions of the leader sequence of RNA 3 involved in initiation complex formation with 80 S ribosomes is reported.