Modelling topoisomerase I inhibition by minor groove binders

Topoisomerase inhibition is an extremely useful target for anticancer and antimicrobial drugs, and an undesirable side effect of some drugs targeting other proteins. Published modelling studies are sparse, and have used small data sets with relatively low molecular diversity. Given the important role of minor groove binding in the mechanism of topoisomerase I inhibition, we have conducted the first 3D QSAR study of topoisomerase I inhibition of a large, diverse set of minor groove binders using the minor groove binding conformation as the alignment template. The highly significant QSAR models resulting from this alignment identify the roles played by molecular features, most importantly the hydrogen bond donor properties.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.     

Out-of-shape DNA minor groove binders: induced fit interactions of heterocyclic dications with the DNA minor groove

DB921 and DB911 are benzimidazole-biphenyl isomers with terminal charged amidines. DB911 has a central meta-substituted phenyl that gives it a shape similar to those of known minor groove binding compounds. DB921 has a central para-substituted phenyl with a linear conformation that lacks the appropriate radius of curvature to match the groove shape. It is thus expected that DB911, but not DB921, should be an effective minor groove binder, but we find that DB921 not only binds in the groove but also has an unusually high binding constant in SPR experiments (2.9 x 10(8) M(-)(1), vs 2.1 x 10(7) M(-)(1) for DB911). ITC thermodynamic analysis with an AATT sequence shows that the stronger binding of DB921 is due to a more favorable binding enthalpy relative to that of DB911. CD results support minor groove binding for both compounds but do not provide an explanation for the binding of DB921. X-ray crystallographic analysis of DB921 bound to AATT shows that an induced fit structural change in DB921 reduces the twist of the biphenyl to complement the groove, and places the functional groups in position to interact with bases at the floor of the groove. The phenylamidine of DB921 forms indirect contacts with the bases through a bound water. The DB921-water pair forms a curved binding module that matches the shape of the minor groove and provides a number of strong interactions that are not possible with DB911. This result suggests that traditional views of compound curvature required for minor groove complex formation should be reevaluated.     

Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation

Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.     

Stabilization of DNA double and triple helices by conjugation of minor groove binders to oligonucleotides

New conjugates containing two parallel or antiparallel carboxamide minor groove binders (MGB) attached to the same terminal phosphate of one oligonucleotide strand were synthesized. The conjugates interact with their target DNA stronger than the individual components. Effect of conjugated MGB on DNA duplex and triplex stability and their sequence specificity was demonstrated on the short oligonucleotide duplexes and on the triplex formed by model 16-mer oligonucleotide with HIV polypurine tract.     

Dissociation of minor groove binders from DNA: insights from metadynamics simulations

We have used metadynamics to investigate the mechanism of noncovalent dissociation from DNA by two representatives of alkylating and noncovalent minor groove (MG) binders. The compounds are anthramycin in its anhydrous form (IMI) and distamycin A (DST), which differ in mode of binding, size, flexibility and net charge. This choice enables to evaluate the influence of such factors on the mechanism of dissociation. Dissociation of IMI requires an activation free energy of approximately 12 kcal/mol and occurs via local widening of the MG and loss of contacts between the drug and one DNA strand, along with the insertion of waters in between. The detachment of DST occurs at a larger free energy cost, approximately 16.5 or approximately 18 kcal/mol depending on the binding mode. These values compare well with that of 16.6 kcal/mol extracted from stopped-flow experiments. In contrast to IMI, an intermediate is found in which the ligand is anchored to the DNA through its amidinium tail. From this conformation, binding and unbinding occur almost at the same rate. Comparison between DST and with kinetic models for the dissociation of Hoechst 33258 from DNA uncovers common characteristics across different classes of noncovalent MG ligands.     

Effect of structural factors on the stability of duplexes formed by oligonucleotide conjugates with minor groove binders

The effect of structural factors on the stability of duplexes formed by DNA minor groove binders conjugated with oligonucleotide mono- or diphosphoramidates of the general formula Oligo-MGB_m (where Oligo is an oligonucleotide; m = 1 or 2; MGB is -L(Py)₂R, -L(Py)₄R, -L(Im)₄R, or -L(Py)₄NH(CH₂)₃CO(Py)₄R; Py is a 4-aminopyrrole-2-carboxylic acid residue; L is a -aminobutyric acid or an -aminocaproic acid residue, R = OEt, NH(CH₂)₆NEt₂, or NH(CH₂)₆N⁺Me₃) was studied by the method of thermal denaturation. The mode of binder interaction with the minor groove depends on the conjugate structure; it may be of the parallel head to head type for bisphosphoramidates and of the antiparallel head to tail type for monophosphoramidates of a hairpin structure. The effects of the duplexes with parallel orientation (bisphosphoramidates, MGB is L(Py)₄R, m = 2) and those of the hairpin structure with the antiparallel orientation (monophosphoramidates, MGB is L(Py)₄(CH₂)₃CO(Py)₄R, m = 1) on T _m values were close. The influence of the linker (L) and substituent (R) structures upon T _m was more pronounced for monophosphoramidate (MGB is L(Py)_nR, m = 1) than for bisphosphoramidate (MGB is L(Py)_nR, m = 2). No more than two oligopyrrolecarboxamide residues (either in parallel or antiparallel orientations) can be incorporated into the duplex minor groove. Moreover, it was shown by the example of monophosphoramidates (Oligo-L(Py)₄R and Oligo-L(Py)₄NH(CH₂)₃CO(Py)₄R) that the addition of a second ligand capable of incorporation into the minor groove increased T _m of the corresponding duplex in comparison with the duplex formed by the starting monophosphoramidate. At the same time, the introduction of a ligand incapable of incorporating decreased the T _m value. The mode of interaction of the conjugated binder with the oligonucleotide duplex is determined by its structure. For example, dipyrrolecarboxamide containing an ethoxy group at the binder C-end stabilizes the duplex due to stacking interaction with the terminal A · T pair, whereas tetrapyrrolecarboxamides stabilize the duplex by incorporation into the minor groove.__________Translated from Bioorganicheskaya Khimiya, Vol. 31, No. 2, 2005, pp. 159–166.Original Russian Text Copyright © 2005 by Ryabinin, Butorin, Elen, Denisov, Pyshnyi, Sinyakov.     

Enhancement and alteration of bleomycin-catalyzed site-specific DNA cleavage by distamycin A and some minor groove binders.

The effects of compounds which bind in the DNA minor groove of A.T rich sequences, on bleomycin-catalyzed site-specific DNA cleavage were investigated by a DNA sequencing technique. Distamycin A enhanced bleomycin-catalyzed DNA cleavage in G.C rich sequences such as 5'-GGGGC-3' (under scoring; the cleaved nucleotide). The cleavage in such a sequence in the presence of distamycin A was greater than that in the absence of distamycin A by as much as about 100 times. Neither Hoechst 33258, 4',6-diamidino-2-phenylindole (DAPI) nor berenil caused extensive enhancement. The results suggest that the distamycin-induced conformational changes of DNA through interactions other than the DNA minor groove binding in A.T-rich sequences are specifically suitable for the bleomycin action.     

Interaction of lambda cro repressor with synthetic operator OR3 studied by competition binding with minor groove binders.

In the present work, we employ a combination of CD spectroscopy and gel retardation technique to characterize thermodynamically the binding of lambda phage cro repressor to a 17 base pair operator OR3. We have found that three minor groove-binding antibiotics, distamycin A, netropsin and sibiromycin, compete effectively with the cro for binding to the operator OR3. Among these antibiotics, sibiromycin binds covalently to DNA in the minor groove at the NH2 of guanine, whereas distamycin A and netropsin interact preferentially with runs of AT base pairs and avoid DNA regions containing guanine bases in the two polynucleotide strands. Only subtle DNA conformation changes are known to take place upon binding of these antibiotics. Both the CD spectral profiles and the results of the gel retardation experiments indicate that distamycin A and netropsin can displace cro repressor from the operator OR3. The binding of cro repressor to the OR3 is accompanied by considerable changes in CD in the far-UV region which appear to be attributed to a DNA-dependent structural transition in the protein. Spectral changes are also induced in the wavelength region of 270-290 nm. The CD spectral profile of the cro-OR3 mixture in the presence of distamycin A can be represented as a sum of the CD spectrum of the repressor-operator complex and spectrum of distamycin-DNA complex at the appropriate molar ratio of the bound antibiotic to the operator DNA (r). When r tends to the saturation level of binding the CD spectrum in the region of 270-360 nm approaches a CD pattern typical of complexes of the antibiotic with the free DNA oligomer. This suggests that simultaneous binding of cro repressor and distamycin A to the same DNA oligomer is not possible and that distamycin A and netropsin can be used to determine the equilibrium affinity constant of cro repressor to the synthetic operator from competition-type experiments. The binding constant of cro repressor to the OR3 is found to be (6 +/- 1).10(6)M-1 at 20 degrees C in 10 mM sodium cacodylate buffer (pH 7.0) in the presence of 0.1 M NH4F.     

Ligand‐based pharmacophore modelling and screening of DNA minor groove binders targeting Staphylococcus aureus

The recognition of DNA by small molecules is of special importance in the design of new drugs. Many natural and synthetic compounds have the ability to interact with the minor groove of DNA. In the present study, identification of minor groove binding compounds was attained by the combined approach of pharmacophore modelling, virtual screening and molecular dynamics approach. Experimentally reported 32 minor groove binding compounds were used to develop the pharmacophore model. Based on the fitness score, best three pharmacophore hypotheses were selected and used as template for screening the compounds from drug bank database. This pharmacophore‐based screening provides many compounds with the same pharmacological properties. All these compounds were subjected to four phases of docking protocols with combined Glide‐quantum‐polarized ligand docking approach. Molecular dynamics results indicated that selected compounds are more active and showed good interaction in the binding site of DNA. Based on the scoring parameters and energy values, the best compounds were selected, and antibacterial activity of these compounds was identified using in vitro antimicrobial techniques. Copyright © 2014 John Wiley & Sons, Ltd.     

DNA binding properties of minor groove binders and their influence on the topoisomerase II cleavage reaction

We present titrations of the human δβ-globin gene region with DNA minor groove binders netropsin, bisnetropsin, distamycin, chromomycin and four bis-quaternary ammonium compounds in the presence of calf thymus topoisomerase II and DNase I. With increasing ligand concentration, stimulation and inhibition of enzyme activity were detected and quantitatively evaluated. Additionally we show a second type of stimulation, the appearance of strong new topoisomerase II cleavage sites at high ligand concentrations. The specific binding sites of the minor groove binders of the DNA sequence and their microscopic binding constants were determined from DNase I footprints. A binding mechanism for minor groove binders is proposed in order to explain these results especially when ligand concentration is increased. © 1998 John Wiley & Sons, Ltd.     

Characterization of a protein recognizing minor groove binders-damaged DNA.

By using electromobility shift assay (EMSA), we have identified a protein able to recognize the DNA only if it was previously reacted with minor groove binders. This protein binds with very high affinity AT containing DNA treated with minor groove binders such as distamycin A, Hoechst 33258 and 33342, CC-1065 and ethidium bromide minor groove intercalator, but not with major groove binders such as quinacrine mustard, cisplatin or melphalan, or with topoisomerase I inhibitor camptothecin or topoisomerase II inhibitor doxorubicin. This protein was found to be present in different extracts of human, murine and hamster cells, with the human protein which appears to have a molecular weight slightly lower than that of the other species. This protein was found to be expressed both in cancer and normal tissues. By using molecular ultrafiltration techniques as well as southwestern analysis it was estimated that the apparent molecular weight is close to 100 kDa. We can exclude an identity between this protein and other proteins, with a similar molecular weight previously reported to be involved in DNA damage recognition/repair, such as topoisomerase I, mismatch repair activities such as the prokaryotic MutS protein and its human homologue hMSH2 or proteins of the nucleotide excision repair system such as ERCC1, -2, -3 and -4.     

Modeling DNA deformations induced by minor groove binding proteins

Molecular modeling is used to demonstrate that the major structural deformations of DNA caused by four different minor groove binding proteins, TBP, SRY, LEF-1, and PurR, can all be mimicked by stretching the double helix between two 3'-phosphate groups flanking the binding region. This deformation reproduces the widening of the minor groove and the overall bending and unwinding of DNA caused by protein binding. It also reproduces the principal kinks associated with partially intercalated amino acid side chains, observed with such interactions. In addition, when protein binding involves a local transition to an A-like conformation, phosphate neutralization, via the formation of protein-DNA salt bridges, appears to favor the resulting deformation.     

DNA recognition by lexitropsins,minor groove binding agents

Consideration is given to alternative approaches to the development of DNA sequences selective binding agents because of their potential applications in diagnosis and treatment of cancer as well as in molecular biology. The concept of lexitropsins, or information-reading molecules, is introduced within the antigene strategy as an alternative to, and complementary with, the antigene approach for cellular intervention and gene control The chemical, physical and paharmacological factors involved in the design of effective lexitropsins are discussed and illustrated with experimental results. Among the factors contributing to the molecular recognition processes are: the presence and disposition of hydrogen bond accepting and donating groups, ligand shape, chirality, stereochemistry, flexibility and charge. For longer ligands, such as are required to target unique sequences in biological systems (14–16 base pairs), the critical feature is the phasing or spatial corresponding between repeat units in the ligand and receptor. The recently discovered 2:1 lexitropsin-DNA binding motif provides a further refinement in molecular recognition in permitting discrimination between GC and CG base pairs. The application of these factors in the design and synthesis of novel agents which exhibits anticancer, antiviral and antitretroviral properties, and inhibition of critical cellular enzymes including topoisomerases is discussed. The emerging evidence of a relationship between sequence selectivity of the new agents and the biological responses they invoke is also described.     

DNA ligases ensure fidelity by interrogating minor groove contacts

DNA ligases, found in both prokaryotes and eukaryotes, covalently link the 3′-hydroxyl and 5′-phosphate ends of duplex DNA segments. This reaction represents a completion step for DNA replication, repair and recombination. It is well established that ligases are sensitive to mispairs present on the 3′ side of the ligase junction, but tolerant of mispairs on the 5′ side. While such discrimination would increase the overall accuracy of DNA replication and repair, the mechanisms by which this fidelity is accomplished are as yet unknown. In this paper, we present the results of experiments with Tth ligase from Thermus thermophilus HB8 and a series of nucleoside analogs in which the mechanism of discrimination has been probed. Using a series of purine analogs substituted in the 2 and 6 positions, we establish that the apparent base pair geometry is much more important than relative base pair stability and that major groove contacts are of little importance. This result is further confirmed using 5-fluorouracil (FU) mispaired with guanine. At neutral pH, the FU:G mispair on the 3′ side of a ligase junction is predominantly in a neutral wobble configuration and is poorly ligated. Increasing the solution pH increases the proportion of an ionized base pair approximating Watson–Crick geometry, substantially increasing the relative ligation efficiency. These results suggest that the ligase could distinguish Watson–Crick from mispaired geometry by probing the hydrogen bond acceptors present in the minor groove as has been proposed for DNA polymerases. The significance of minor groove hydrogen bonding interactions is confirmed with both Tth and T4 DNA ligases upon examination of base pairs containing the pyrimidine shape analog, difluorotoluene (DFT). Although DFT paired with adenine approximates Watson–Crick geometry, a minor groove hydrogen bond acceptor is lost. Consistent with this hypothesis, we observe that DFT-containing base pairs inhibit ligation when on the 3′ side of the ligase junction. The NAD⁺-dependent ligase, Tth, is more sensitive to the DFT analog on the unligated strand whereas the ATP-dependent T4 ligase is more sensitive to substitutions in the template strand. Electrophoretic gel mobility-shift assays demonstrate that the Tth ligase binds poorly to oligonucleotide substrates containing analogs with altered minor groove contacts.