Synthesis of oligodeoxyribonucleotides bearing a functional group at 2'-position by post-synthetic modification.

A novel 2'-thio-2'-deoxyuridine derivative bearing a reactive ester at 2'-position was synthesized and incorporated into oligodeoxyribonucleotides (ODNs) for the post-synthetic modification of ODNs. This ODNs was reacted with several amines to give ODNs having a functional group at 2'-position.     

Use of 2-diphenylmethylsilylethyl (DPSE) protecting group in oligonucleotide synthesis via phosphoramidite approach

2-Diphenylmethylsilylethyl (DPSE) is a new protecting group for the internucleotidic bonds in the synthesis of deoxyribooligonucleotides by the phosphoramidite approach. This group is stable to acidic conditions and can be removed under mild conditions using aqueous ammonium hydroxide.     

Efficient synthesis of rhodamine conjugates through the 2'-position

Reaction of substrates containing primary amines with rhodamine 2'-esters cleanly produces fluorescent rhodamine 2'-amide conjugates at ambient temperature. Only primary amines react with the esters under these conditions. Chemoselectivity can thus be achieved in substrates containing different types of amines.     

Synthesis of oligonucleotide prodrugs bearing N-acetyl nucleobases

N-Acetyl oligonucleotides and their prodrugs were synthesized on photolabile solid support. Tm studies showed a decrease of hydridization for N-acetyl A and G and an increase for N-acetyl C. In cells extract, acetyl groups were hydrolysed.     

2-(2-Pyridyl)ethyl group: new type protecting group in the synthesis of DNA via phosphoramidite intermediates

2-(2-Pyridyl)ethyl group is a new type P-O protecting group for the synthesis of oligodeoxyribonucleotides by the phosphite triester method. This group is stable to alkali and acid conditions, and to be removed from internucleotidic bonds under mild conditions via two step procedures without any side reactions. Further we have found that bis(diisopropylamino)chlorophosphine is much more effective for the preparation of bis(diisopropylamino)alkoxyphosphines than various dichlorophosphines.     

Synthesis of oligonucleotide derivatives with dansyl group at sugar fragment.

The method for introduction of dansyl group into the 2'-position of oligonucleotides is described. The dansyl group was introduced to 2'-position of uridine by the reaction of dansyl chloride with 2'-amino-2'-deoxyuridine, which was then converted to the 5'-dimethoxytrityl phosphorobisdiethylamidite derivative, (4). This reagent was used for the solid-phase synthesis of the oligonucleotide-dansyl conjugate, 5'-ACTCU(DNS)AGAGG. The conjugate could be purified by reversed-phase HPLC. The nucleoside composition of the conjugate was verified by the enzymatic digestion analysis.     

Oligonucleotide synthesis using the 2-(levulinyloxymethyl)-5-nitrobenzoyl group for the 5'-position of nucleoside 3'-phosphoramidite derivatives.

A comparative study on the utility of 2-(levulinyloxymethyl)-5-nitrobenzoyl (LMNBz) and 2-(levulinyloxymethyl)benzoyl (LMBz) protecting groups for the 5'-positions of nucleoside 3'-phosphoramidite derivatives in the oligonucleotide synthesis is presented in terms of the syntheses of TpTpT, TpTpTpT, and UpCpApGpUpUpGpG. In addition we describe the synthesis, using the LMNBz protecting group, of the CpCpA terminus triplet of tRNAs bearing exocyclic amino groups with 15N-labeling, and the trimer Gp[A*]pG containing 2'-O-(beta-D-ribofuranosyl)adenosine ([A*]), the latter of which is found at position 64 in the yeast initiator tRNA(Met).     

Synthesis of a 2'-amino-alpha-1-LNA-T phosphoramidite

A convergent route to 2'-amino-alpha-L-LNA-T phosphoramidite building block 16 has been developed. Key steps include 1) introduction of a C2-azido group prior to nucleobase-coupling, 2) tandem Staudinger and intramolecular nucleophilic substitution reaction, and 3) separation of alpha-L- and beta-L-configured intermediates.     

Improved synthesis of 2'-amino-2'-deoxyguanosine and its phosphoramidite

2'-Amino-2'-deoxynucleosides and oligonucleotides containing them have proven highly effective for an array of biochemical applications. The guanosine analogue and its phosphoramidite derivatives have been accessed previously from 2'-amino-2'-deoxyuridine by transglycosylation, but with limited overall efficiency and convenience. Using simple modifications of known reaction types, we have developed useful protocols to obtain 2'-amino-2'-deoxyguanosine and two of its phosphoramidite derivatives with greater convenience, fewer steps, and higher yields than reported previously. These phosphoramidites provide effective synthons for the incorporation of 2'-amino-2'-deoxyguanosine into oligonucleotides.     

Synthesis and characterization of oligonucleotide conjugates bearing electroactive labels

Oxime bond formation has been applied to the preparation of oligonucleotides labeled with electrochemical ferrocene and viologen labels. Aminooxy functionalized ferrocene and viologen derivatives were prepared by a straightforward route and efficiently conjugated with aldehyde containing oligonucleotides either at 3′ or 5′ end. Both labels were found to not disturb the recognition properties of the oligonucleotide. The versatility of the method was further demonstrated by preparing bi-functionalized conjugates with a disulfide at 3′ end and an electrochemical label at 5′ end.     

Synthesis of oligonucleotide building blocks of 2'-deoxyguanosine bearing a C8-arylamine modification

C8-Arylamine-dG adducts were synthesized by palladium-catalyzed cross-coupling reactions. The corresponding 5'-O-DMTr-3'-O-phosphoramidite-C8-arylamine-dG adducts were synthesized as potential building blocks for the automated synthesis of site-specifically modified oligonucleotides.     

Synthesis and use of labelled nucleoside phosphoramidite building blocks bearing a reporter group: biotinyl, dinitrophenyl, pyrenyl and dansyl.

The synthesis of protected nucleoside phosphoramidites bearing various markers such as biotinyl, dinitrophenyl, dansyl and pyrenyl groups are reported. These labelled deoxynucleosides phosphoramidites were used for solid phase oligonucleotide synthesis in the same way than the usual protected phosphoramidities without any change in the synthetic cycle and the deprotection step. The new labelled building blocks described herein have been used in conjunction with the labile base protected phosphoramidites ('PAC phosphoramidites') which allowed mild ammonia deprotection, especially recommended for the dinitrophenyl-labelled oligonucleotides. Multiple labelling (i.e. 10 to 20 biotins) can be efficiently and easily performed, on the same oligonucleotide which results in an increase of sensitivity. The polylabelled oligonucleotides are chemically well defined and gave increased signal and low background coloration for in situ hybridisation. The modified oligonucleotides can still be kinased in the normal way as the reporter groups are on the heterocycles.     

Synthesis of modified nucleotide building blocks containing electrophilic groups in the 2'-position

Chemical syntheses of 2'-O-(allyloxycarbonyl)methyladenosine, 2'-O-(methoxycarbonyl)methyladenosine and 2'-O-(2,3-dibenzoyloxy)propyluridine 3'-2-cyanoethyl-N,N-diisopropyl phosphoramidite building blocks are described. These monomers were used successfully to incorporate carboxylic acid, 1,2-diol and aldehyde functionalities into synthetic oligonucleotides.     

Preparation of 6-thioguanosine phosphoramidite for oligoribonucleotide synthesis

6-Thioguanosine phosphoramidite was prepared, using 2,4-dinitrophenyl as protection group for thio-function, and its stability towards conditions of RNA synthesis was investigated. The results show that the monomer was stable under the conditions of RNA synthesis and suitable for incorporation of thioguanine into oligoribonucleotides.     

Synthesis and properties of halogenated 7-deaza-2'-deoxyxanthosine and protected derivatives for oligonucleotide synthesis

The 7-bromo- (4a) and 7-iodo- (4b) derivatives of 7-deaza-2'-deoxyxanthosine (5) are prepared. Furthermore, the building blocks 6-8 of 7-deaza-2'-deoxyxanthosine (5) are synthesized and tested for their usage in oligonucleotide synthesis.     

Improvements in the phosphoramidite procedure for the synthesis of oligodeoxyribonucleotides.

The paper describes an improved method for the synthesis of oligodeoxyribonucleotides using phosphoramidite chemistry. Our procedure relies on novel phosphoramidite intermediates, the deoxyribonucleoside-3'-morpholine-methoxyphosphins. These compounds are extremely stable and can be purified readily. Condensation reactions during solid-phase synthesis can thus be performed with high efficiency and result in a high yield synthesis of long chain oligodeoxyribonucleotides.     

Synthesis of oligonucleotides using the 2-(levulinyloxymethyl)-5-nitrobenzoyl group for the 5'-position of nucleoside 3'-H-phosphonate and -H-phosphonothioate derivatives.

Synthetic studies on phosphodiester, phosphorothioate, and phosphorodithioate-linked oligonucleotides in terms of 2-(levulinyloxymethyl)-5-nitrobenzoyl (LMNBz) group as the base-labile protecting group for the 5'-hydroxyl groups of nucleoside 3'-H-phosphonate and -H-phosphonothioate derivatives, are described.     

Ribo-, xylo-, and arabino-configured adenine-based nucleoside phosphonates: synthesis of monomers for solid-phase oligonucleotide assembly

Adenine-based, regioisomeric nucleoside phosphonates with ribo, xylo and arabino configuration were synthesized in the protected form suitable for the phosphotriester-like, solid-phase synthesis of oligonucleotides. Phosphonate moiety was protected by 4-methoxy-1-oxido-2-picolyl group and the furanose hydroxyl by the dimethoxytrityl group.     

Synthesis and biochemical studies of analogs of platelet-activating factor bearing a methyl group at C2 of the glycerol backbone

Two platelet-activating factor (PAF) analogs containing a methyl group at C2 of the glycerol moiety were synthesized, and some of their biochemical properties were investigated. 1-O-Hexadecyl-2-C,O-dimethyl-rac-glycero-3-phosphocholine (2-methyl-2-methoxy PAF) was prepared in a synthetic scheme beginning with the etherification of 2-methylpropen-1-ol. A reaction sequence involving hydroxylation, tritylation, alkylation, and detritylation afforded 1-O-hexadecyl-2-C,O-dimethyl-rac-glycerol, which was converted into the phosphocholine. A 2-lyso derivative of this PAF analog (2-methyl-lyso PAF) was synthesized from 1-O-hexadecyl-2-C-methyl-3-O-trityl-rac-glycerol. Benzylation followed by detritylation gave 1-O-hexadecyl-2-C-methyl-2-O-benzyl-rac-glycerol, which was converted into the phosphocholine compound. Hydrogenolysis afforded 1-O-hexadecyl-2-C-methyl-rac-glycero-3-phospholine (2-methyl-lyso PAF). The 2-methyl-lyso PAF analog served as a substrate for the acetyl-CoA-dependent acetyltransferase that acetylates 1-O-alkyl-2-lyso-sn-glycero-3-phosphocholine. However, 2-methyl-lyso PAF did not have a significant effect on the activities of a CoA-independent transacylase or of the acetylhydrolase that inactivates PAF, and thus does not appear to be a substrate or an inhibitor, respectively, for these enzymes. In addition, this analog exhibited only one-half of the antitumor activity of rac-1-O-alkyl-2-methoxy-rac-glycero-3-phosphocholine in human leukemic (HL-60) cells, and elicited no hypotensive response in rats and no platelet-activating activity.(ABSTRACT TRUNCATED AT 250 WORDS)     

5''-Levulinyl and 2''-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.