Ribavirin enhances interferon-γ levels in patients with chronic hepatitis C treated with interferon-α

Some patients with chronic hepatitis C respond to interferon (IFN)-alpha treatment, and the efficiency can be improved by combining it with ribavirin. The mechanism of this improvement is unknown. To investigate the effects of these two regimens on the immune responses in 51 patients with chronic hepatitis C, we examined the hepatitis C core antigen-specific proliferative response and cytokine production profiles, natural killer (NK) cell cytotoxicity and cytotoxic T cell function during treatment. The results are as follows: (1) both viral clearance and biochemical normalization occurred more frequently in patients receiving combination therapy; (2) the function of NK cells increased after treatment in the responders of both groups (p < 0.05); (3) the level of IFN-gamma produced by hepatitis C core antigen-stimulated peripheral blood mononuclear cells was higher in patients receiving combination therapy, especially in responders; (4) the core antigen-specific proliferative response decreased after treatment, and (5) in addition, the core-specific cytotoxic T cell activities of five responder patients also increased significantly after therapy. In conclusion, enhancement of immune responses, especially those related to type-1 T helper cell activity, may contribute to better efficacy in combining ribavirin with IFN-alpha for treatment of chronic hepatitis C.     

Oncostatin M synergistically inhibits HCV RNA replication in combination with interferon-α

Oncostatin M (OSM), a member of the interleukin-6 family, possesses various functions, including hepatocyte differentiation and suppression of melanoma cell growth. Here, we report anti-hepatitis C virus (HCV) activity of OSM as a new function of this cytokine. OSM possessed marked anti-HCV activity (50% effective concentration: 0.71 ng/ml) in an HCV RNA replication cell culture system. The most striking finding is that OSM exhibited synergistic inhibitory activity on interferon (IFN)-α even at a low concentration with weak anti-HCV activity, such as 25 pg/ml. OSM is a candidate anti-HCV reagent and may improve the current IFN therapy for patients with chronic hepatitis C.     

Decrease in the phagocytic activity of peripheral monocytes in patients treated with human interferon-α

Summary The influence of daily intramuscular injections of 3×10⁶ units of interferon- (IFN-) on the phagocytic activity of peripheral monocytes was studied in 28 tumor patients. One day after initiation of IFN therapy no major change in the capacity of monocytes to ingest yeast particles was observed. After 1 week, 3 months, 6 months, and 9 months of treatment, monocyte phagocytosis had decreased in the majority of the patients tested. In patients where natural killer (NK) cell activity was measured simultaneously with monocyte phagocytosis, a correlation between the degree of enhancement of NK activity and the degree of decrease in monocyte phagocytosis was observed.     

An evolutionarily conserved alternate metal ligand is important for activity in α-isopropylmalate synthase from Mycobacterium tuberculosis

Members of the DRE-TIM metallolyase superfamily rely on an active-site divalent cation to catalyze various reactions involving the making and breaking of carbon–carbon bonds. While the identity of the metal varies, the binding site is well-conserved at the superfamily level with an aspartic acid and two histidine residues acting as ligands to the metal. Previous structural and bioinformatics results indicate that the metal can adopt an alternate architecture through the addition of an asparagine residue as a fourth ligand. This asparagine residue is strictly conserved in all members of the DRE-TIM metallolyase superfamily except fungal homocitrate synthase (HCS-lys) where it is replaced with isoleucine. The role of this additional metal ligand in α-isopropylmalate synthase from Mycobacterium tuberculosis (MtIPMS) has been investigated using site-directed mutagenesis. Substitution of the asparagine ligand with alanine or isoleucine results in inactive enzymes with respect to α-isopropylmalate formation. Control experiments suggest that the substitutions have not drastically affected the enzyme's structure indicating that the asparagine residue is essential for catalysis. Interestingly, all enzyme variants retained acetyl CoA hydrolysis activity in the absence of α-ketoisovalerate, similar to the wild-type enzyme. In contrast to the requirement of magnesium for α-isopropylmalate formation, hydrolytic activity could be inhibited by the addition of magnesium chloride in wild-type, D81E, and N321A MtIPMS, but not in the other variants studied. Attempts to rescue loss of activity in N321I MtIPMS by mimicking the fungal HCS active site through the D81E/N321I double variant were unsuccessful. This suggests epistatic constraints in evolution of function in IPMS and HCS-lys enzymes.     

Long-term treatment with low doses of interleukin-2 and interferon-α: immunological effects in advanced renal cell cancer

We aimed to determine the immunological effects of low doses of recombinant interleukin-2 (rIL-2) and recombinant interferon-α (rIFN-α) in patients bearing advanced renal cell carcinoma. Methods: Twenty-seven patients received therapeutic cycles consisting of subcutaneous rIL-2 for 5 days per week and intramuscular rIFN-α twice weekly, for 4 consecutive weeks. The cycle was repeated indefinitely at regular 4-month intervals, for all patients. rIL-2 (1 × 10⁶ IU/m²) was administered every 12 h on days 1 and 2 and once a day on days 3–5 of each week; rIFN-α (1.8 × 10⁶ IU/m²) was given on days 3 and 5. In the enrolled patients, total and differential white blood cell counts, phenotypic analysis of some lymphocyte subsets, and soluble IL-2 receptor (sIL-2R), were investigated before and after each of the first six cycles of therapy (about 24 months of follow-up). Results: The cycles of immunotherapy induced a significant increase of total lymphocytes (37%, P < 0.001), eosinophils (222%, P < 0.001), CD25+ cells (27%, P=0.004), sIL-2R (174%, P < 0.001) and natural killer (NK) cells (CD3-CD56+) (61%, P < 0.001); the subset that expresses CD56 with high density (CD56+ bright) expanded more (233%, P < 0.001) than the subset expressing the same marker with low density (CD56+ dimmer) (15%, P=0.043). Unlike the previous subsets, the treatment decreased significantly T-lymphocytes with NK cell marker (CD3+ CD56+) (28%, P=0.011). No significant differences of effectiveness were found among the subsequent treatment cycles, except for CD25+ cells and sIL-2R (P=0.036 and P=0.005, respectively): the increase induced by immunotherapy was maximum after the first cycle and decreased progressively thereafter. Conclusions: Long-term repeated cycles of low-dose immunotherapy induced repeated and significant expansion of one of the most important lymphocyte subsets for the non-MHC-restricted immune response to the tumour mass: CD3–CD56+ cells. Received: 8 November 2000 / Accepted: 11 January 2001     

Th1 and Th2 cytokines are elevated in HCV-infected SVR(−) patients treated with interferon-α

Interferon-α-based treatment is a standard therapy to cure hepatitis C virus-infected patients. However, the reasons for the failure of interferon-α treatment in some patients have not been fully elucidated. We evaluated the differences in the expression levels of various cytokines among patients with and without sustained viral response (SVR). We found that the chemokines (MIG and IP-10) and inflammation-related cytokines (IL-6) were transiently elevated in patients with SVR(+) before interferon-α treatment and in the early phase of treatment (week 2), indicating that these cytokines may be related to viral clearance. Furthermore, higher serum levels of Th1 and Th2 cytokines (IL-2, IL-4, IL-5, IL-10, tumor necrosis factor, and IFN-γ) were observed in SVR(−) than in SVR(+) patients, indicating that they may be associated with ineffective anti-HCV immune response. Our data revealed that the patterns of cytokines varied greatly between SVR(+) and SVR(−) patients before and after IFN-α treatment.     

Immunological evaluation of patients with hematological malignancies receiving ambulatory cytokine-mediated immunotherapy with recombinant human interferon-α2a and interleukin-2

Summary Immunological parameters were evaluated in patients treated with cytokine-mediated immunotherapy (CMI) consisting of low doses of recombinant human interferon 2a (rIFN) and recombinant human interleukin-2 (rIL-2) administered either concomitantly or sequentially by subcutaneous self-injections in an outpatient setting. Twenty-six patients with hematological malignancies and 2 metastatic melanoma patients in a progressive stage were enrolled in this clinical trial. Of the 26 patients, 24 were at a stage of minimal residual disease, including 14 patients who had received autologous bone marrow transplantation (ABMT) 2–5 months previously, 7 chronic myelogenous leukemia (CML) and 3 acute myeloid leukemia (AML) patients. Two patients (1 CML and 1 mult. myeloma) were treated at a stage of progressive disease. Non-MHC-restricted cytotoxicity directed against natural-killer(NK)-resistant (Daudi) and NK-sensitive (K562) target cells was assessed before, during and after CMI, either in fresh peripheral blood samples (spontaneous activity) or after in vitro rIL-2 activation (induced activity). Spontaneous killing activity was low prior to treatment, but increased upon termination of treatment in 10/15 evaluated cycels. rIL-2-activated cytotoxicity in vitro was markedly elevated in 8/12 and 6/8 patients after one and two cycles, respectively, of sequential treatment, as well as in 3/8 CML and 5/6 patients after one and two cycles, respectively, of concomitant treatment Activation of the T cell mitogenic response was demonstrated in 6/9 patients after concomitant CMI, while no such effect was observed throughout a sequential treatment in lymphoma and leukemia patients after ABMT. Although a direct correlation between immune stimulation and the in vivo antitumor response cannot yet be determined, our clinical observations support a beneficial therapeutic effect in a substantial number of patients. These results indicated that the ambulatory CMI protocol of rIL-2 and rIFN could stimulate the host defense immune system and may be helpful in mediating the in vivo antitumor response in patients with minimal residual disease.     

The roles of the conserved tyrosine in the β2-α2 loop of the prion protein

ABSTRACT

Prions cause neurodegenerative diseases for which no cure exists. Despite decades of research activities the function of the prion protein (PrP) in mammalians is not known. Moreover, little is known on the molecular mechanisms of the self-assembly of the PrP from its monomeric state (cellular PrP, PrP^C) to the multimeric state. The latter state includes the toxic species (scrapie PrP, PrP^Sc) knowledge of which would facilitate the development of drugs against prion diseases. Here we analyze the role of a tyrosine residue (Y169) which is strictly conserved in mammalian PrPs. Nuclear magnetic resonance (NMR) spectroscopy studies of many mammalian PrP^C proteins have provided evidence of a conformational equilibrium between a 3₁₀-helical turn and a type I β turn conformation in the β2-α2 loop (residues 165–175). In vitro cell-free experiments of the seeded conversion of PrP^C indicate that non-aromatic residues at position 169 reduce the formation of proteinase K-resistant PrP. Recent molecular dynamics (MD) simulations of monomeric PrP and several single-point mutants show that Y169 stabilizes the 3₁₀-helical turn conformation more than single-point mutants at position 169 or residues in contact with it. In the 3₁₀-helical turn conformation the hydrophobic and aggregation-prone segment 169-YSNQNNF-175 is buried and thus not-available for self-assembly. From the combined analysis of simulation and experimental results it emerges that Y169 is an aggregation gatekeeper with a twofold role. Mutations related to 3 human prion diseases are interpreted on the basis of the gatekeeper role in the monomeric state. Another potential role of the Y169 side chain is the stabilization of the ordered aggregates, i.e., reduction of frangibility of filamentous protofibrils and fibrils, which is likely to reduce the generation of toxic species.     

Evidence of vitamin D and interferon-β cross-talk in human osteoblasts with 1α,25-dihydroxyvitamin D3 being dominant over interferon-β in stimulating mineralization

It is well established that 1α-25-dihydroxyvitamin D3 (1,25D3) regulates osteoblast function and stimulates mineralization by human osteoblasts. The aim of this study was to identify processes underlying the 1,25D3 effects on mineralization. We started with gene expression profiling analyses of differentiating human pre-osteoblast treated with 1,25D3. Bioinformatic analyses showed interferon-related and -regulated genes (ISG) to be overrepresented in the set of 1,25D3-regulated genes. 1,25D3 down-regulated ISGs predominantly during the pre-mineralization period. This pointed to an interaction between the vitamin D and IFN signaling cascades in the regulation of osteoblast function. Separately, 1,25D3 enhances while IFNβ inhibits mineralization. Treatment of human osteoblasts with 1,25D3 and IFNβ showed that 1,25D3 completely overrules the IFNβ inhibition of mineralization. This was supported by analyses of extracellular matrix gene expression, showing a dominant effect of 1,25D3 over the inhibitory effect of IFNβ. We identified processes shared by IFNβ- and 1,25D3-mediated signaling by performing gene expression profiling during early osteoblast differentiation. Bioinformatic analyses revealed that genes being correlated or anti-correlated with interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) were associated with osteoblast proliferation. In conclusion, the current study demonstrates a cross talk between 1,25D3 and IFNβ in osteoblast differentiation and bone formation/mineralization. The interaction is complex and depends on the process but importantly, 1,25D3 stimulation of mineralization is dominant over the inhibitory effect of IFNβ. These observations are of potential clinical relevance considering the impact of the immune system on bone metabolism in conditions such as rheumatoid arthritis.     

A phase II study of combined administration of dacarbazine and carboplatin with home therapy of recombinant interleukin-2 and interferon-α2a in patients with advanced malignant melanoma

Chemotherapy and interleukin-2 (IL-2) and/or interferon (IFN) produce objective responses in a proportion of patients with advanced malignant melanoma. The duration of response to chemotherapy is usually less than 4 months, and immunotherapy has resulted in longlasting remissions in a small number of patients with metastatic melanoma. The current study was conducted to improve the antitumor efficacy and the interactions between recombinant (r) IL-2, rIFN2a and chemotherapy. A total of 16 evaluable patients with metastatic malignant melanoma were entered into a phase-II study designed to assess the response rate and therapeutic efficacy of dacarbazine and carboplatin followed by rIL-2 and rIFN2a. Patients received 750 mg/m² dacarbazine with 400 mg/m² carboplatin each by intravenous bolus on days 1 and 22. Recombinant IL-2 and IFN2a were administered on an outpatient basis (home therapy) subcutaneously for 6 consecutive weeks: 4.8×10⁶ IU/m² rIL-2 daily, 5 days a week; 6.0×10⁶ IU/m² rIFN2a thrice weekly. There were responses in 6 of the 16 enrolled patients with an overall response rate of 37.5% (95% confidence interval: 14%–61%). All responding patients had partial responses. The median survival time of the responding patients was significantly better than that of patients with progressive and stable disease (P=0.03). The median duration of response was 11 months (range 2–24 months). Responses in lung, liver, soft tissue and lymph-node sites were noted.     

Interaction of synthetic analogues of distamycin and netropsin with nucleic acids. Does curvature of ligand play a role in distamycin-DNA interactions?

Distamycin and netropsin, a class of minor groove binding nonintercalating agents, are characterized by their B-DNA and A-T base-specific interactions. To understand the conformational and chemical basis of the above specificities, the DNA-binding characteristics of a novel synthetic analogue of distamycin have been studied. The analogue, mPD derivative, has the requisite charged end groups and a number of potential hydrogen-bonding loci equal to those of distamycin. The difference in the backbone curvatures of the ligands, distamycin, the mPD derivative, and NSC 101327 (another structurally analogous compound), is a major difference between these ligands. UV and CD spectroscopic studies reported here show the following salient features: The mPD derivative recognizes only B-DNA, to which it binds via the minor groove. On the other hand, unlike distamycin, it binds with comparable affinities to A-T and G-C base pairs in a natural DNA. These DNA-binding properties are compared with those reported earlier for distamycin and NSC 101327 [Zimmer, Ch., & Wahnert, U. (1986) Prog. Biophys. Mol. Biol. 47, 31-112]. The backbone structures of these three ligands were compared to show the progressive decrease in curvatures in the order distamycin, mPD derivative, and NSC 101327. The plausible significance of the backbone curvature vis-à-vis the characteristic B-DNA and AT-specific binding of distamycin is discussed. To our knowledge, this is the first attempt (with a model synthetic analogue) to probe the possible influence of backbone curvature upon the specificity of interactions of the distamycin class of groove-binding ligands with DNA.     

Inhibition of interferon- γ and interleukin-2 production from lymphocytes stimulated with food antigens by an anti-allergic drug,Tranilast, in patients with food-sensitive atopic dermatitis

N(3, 4-dimethoxycinnamoyl) anthranilic acid (Tranilast) inhibits antibody-mediated hypersensitivity reactions, and is an effective drug for patients with bronchial asthma or allergic rhinitis. Interferon- (IFN-) production of ovalbumin (OA)-stimulated peripheral blood mononuclear cells (PBMCs) from hen's egg-sensitive patients with atopic dermatitis (AD) was significantly higher than those of healthy controls. Tranilast inhibited this IFN- production. Moreover, interleukin-2 (IL-2) production of OA-stimulated PBMCs from hen's egg-sensitive patients with AD was also inhibited by Tranilast. Our results suggest that Tranilast can be used to the patients with food sensitive AD.Abbreviations PBMCs peripheral blood mononuclear cells - OA ovalbumin - BSA bovine serum albumin - AD atopic dermatitis - IL-2 interleukin-2 - IFN- interferon- - Tranilast N(3, 4-dimethoxycinnamoyl) anthranilic acid - IL-4 interleukin 4 - IL-5 interleukin 5     

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X_4–5-C-X_22–23-H-X₁-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.     

Induction of parturition in the mare with prostaglandin F2α

Thirty-one mares of Quarter Horse and Thoroughbred breeding were utilized in two experiments to evaluate the efficacy of prostaglandin F₂α (PGF₂α)_for induction of equine parturition and to monitor the effects of this treatment on viability of the resulting foals.Three of five mares given 5 mg PGF₂α (im) on day 338 of gestation foaled 19.6 ± 8.2 hr postinjection. In the second experiment immediately following 3 daily injections of 10 mg estradiol cypionate (ECP) given on days 326, 327 and 328 of gestation, seven mares were infused (iv) with PGF₂α at the rate of 1.3 mg/hr for 24 hr or until parturition occurred. Four of the seven mares foaled in 8.8 ± 1.8 hr after the start of infusion. Side effects including sweating, hypothermia, increased respiration rate and diarrhea were evident in both injected and infused mares, but effects were transient. Neither the injection, nor infusion route of administration of PGF₁α adversely affected the viability of foals. However, some mares induced to foal 12 days prior to expected parturition had foals with slightly weaker pasterns than those of control mares.     

Role of interleukin-2 and interferon-γ in induction of activated natural killer cells from mice primed in vivo and subsequently challenged in vitro with the streptococcal preparation OK432

Summary The natural-killer(NK)-cell-mediated cytotoxicity to syngeneic tumor cells can be augmented by in vivo priming and subsequent in vitro challenge with the streptococcal preparation OK432. Supernatants of cocultures of spleen cells with OK432 contained interleukin-2 (IL-2) and interferon (IFN), mainly IFN-. As the anti-(mouse IFN-) monoclonal antibody but not anti-(mouse IFN-) antibody inhibited the induction of activated NK cells with OK432, the IFN- participated in this response. The enhancement of NK cell activity and production of IL-2 were partially inhibited by the pretreatment of spleen cells with mitomycin C or irradiation, and were completely abolished by pretreatment with actinomycin D. The IL-2 activity after treatment with various metabolic inhibitors ran parallel to the NK activity in a system augmented with OK432. The activity of incubated spleen cells with IL-2 receptors was increased by OK432 treatment, and the NK cell and IFN activities of supernatants were also abrogated by the treatment with anti-(mouse IL-2 receptor) monoclonal antibody, to block the interaction between IL-2 and these receptors of effector cells. The panning method clarified that the incubated spleen cells with IL-2 receptors are responsible for the production of IFN-. These results suggest that IL-2 plays a major role in inducing the activated NK cells from murine spleen cells primed in vivo and subsequently challenged in vitro with OK432, by the production of IFN-.     

Control of glycoprotein synthesis: substrate specificity of rat liver UDP-GlcNAc:Manα3R β2-N-acetylglucosaminyl-transferase I using synthetic substrate analogues

UDP-GlcNAc: Man3R 2-N-acetylglucosaminyltransferase I (GlcNAc-T I; EC 2.4.1.101) is the key enzyme in the synthesis of complex and hybrid N-glycans. Rat liver GlcNAc-T I has been purified more than 25,000-fold (M _r 42,000). TheV _max for the pure enzyme with [Man6(Man3)Man6](Man3)Man4GlcNAc4GlcNAc-Asn as substrate was 4.6 µmol min^–1 mg^–1. Structural analysis of the enzyme product by proton nuclear magnetic resonance spectroscopy proved that the enzyme adds anN-acetylglucosamine (GlcNAc) residue in 1–2 linkage to the Man3Man-terminus of the substrate. Several derivatives of Man6(Man3)Man-R, a substrate for the enzyme, were synthesized and tested as substrates and inhibitors. An unsubstituted equatorial 4-hydroxyl and an axial 2-hydroxyl on the -linked mannose of Man6(Man3)Man-R are essential for GlcNAc-T I activity. Elimination of the 4-hydroxyl of the 3-linked mannose (Man) of the substrate increases theK _M 20-fold. Modifications on the 6-linked mannose or on the core structure affect mainly theK _M and to a lesser degree theV _max, e.g., substitutions of the Man6 residue at the 2-position by GlcNAc or at the 3- and 6-positions by mannose lower theK _M, whereas various other substitutions at the 3-position increase theK _M slightly. Man6(Man3)4-O-methyl-Man4GlcNAc was found to be a weak inhibitor of GlcNAc-T I.Abbreviations BSA Bovine serum albumin - Bn benzyl - Fuc, F l-fucose - Gal, G d-galactose - GalNAc, GA N-acetyl-d-galactosamine - Glc d-glucose - GlcNAc, Gn N-acetyl-d-glucosamine - HPLC high performance liquid chromatography - Man, M d-mannose - mco 8-methoxycarbonyl-octyl, (CH₂)₈ COOOCH₃ - Me methyl - MES 2-(N-morpholino)ethanesulfonate - NMR nuclear magnetic resonance - PMSF phenylmethylsulfonylfluoride - pnp p-nitrophenyl - SDS sodium dodecyl sulfate - T transferase - Tal d-talose - Xyl d-xylose; - {0, 2 + F} Man6 (GlcNAc2Man3) Man4GlcNAc4 (Fuc6) GlcNAc - {2, 2} GlcNAc2Man6 (GlcNAc2Man3) Man4GlcNAc4GlcNAc; M₅-glycopeptide, Man6 (Man3) Man6 (Man3) Man4 GlcNAc4GlcNAc-Asn Enzymes: GlcNAc-transferase I, EC 2.4.1.101; GlcNAc-transferase II, EC 2.4.1.143; GlcNAc-transferase III, EC 2.4.1.144; GlcNAc-transferase IV, EC 2.4.1.145; GlcNAc-transferase V, UDP-GlcNAc: GlcNAc2 Man6-R (GlcNAc to Man) 6-GlcNAc-transferase; GlcNAc-transferase VI, UDP-GlcNAc: GlcNAc6(GlcNAc2) Man6-R (GlcNAc to Man) 4-GlcNAc-transferase; Core 1 3-Gal-transferase, EC 2.4.1.122; 4-Gal-transferase, EC 2.4.1.38; 3-Gal-transferase, UDP-Gal: GlcNAc-R 3-Gal-transferase; blood group i 3-GlcNAc-transferase, EC 2.4.1.149; blood group I 6-GlcNAc-transferase, UDP-GlcNAc: GlcNAc3Gal-R (GlcNAc to Gal) 6-GlcNAc-transferase.     

Pregnancy and fetal development in hamsters treated with prostaglandin F2α

The influence of PGF_2α on pregnancy and fetal outcome was investigated in the hamster. Following subcutaneous treatment with 50, 100, 200, 400, and 800 μg PGF_2α prenatal loss was significantly increased only at the highest dose level. The offspring of the treated animals were all alive and normal. Fetal weight was not affected. However, following intravenous injection of 100 and 200 μg PGF_2α there was a significant reduction in fetal weight, and at the 400 μg dose level an increase in fetal resorptions. All fetuses recovered were alive and normal. These results indicate that PGF_2α is not teratogenic in hamsters despite the apparent greater sensitivity of the hamster embryo to prostaglandin.     

Abortion after PGF2α in heifers with multiple pregnancies following superovulation with FSH and PGF2α

Multiple ovulations were induced with follicle stimulating hormone and estrus was synchronized with prostaglandin F_2α (PGF_2α) in 23 Holstein heifers. In 19 heifers which responded to the treatments, an average of 1.8 corpora lutea were formed after the induced estrus and 6 of 19 heifers conceived (total of ten fetuses at 39 days gestation) to artificial insemination at 60 and 84 hr after the PGF_2α injection. Injection of 33 mg PGF_2α Tham salt into the six pregnant heifers on day 40 of gestation caused abortion between 54 and 66 hr after treatment in all heifers.