Characterization of a parallel-stranded DNA hairpin

Recently we have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure [van de Sande et al. (1988) Science (Washington, D.C.) 241, 551-557]. In the present study, we have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3'-d(T)8C4(A)8-3' and the related antiparallel (APS) hairpin 5'-d(T)8C4(A)8-3'. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5'-5' phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. 31P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. However, the small chemical shift dispersion observed in proton NMR spectra of the PS hairpin suggests that the stem of this hairpin is more regular than that of the APS hairpin. On the basis of NOESY measurements, we find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2'-endo range.(ABSTRACT TRUNCATED AT 250 WORDS)     

Induction of parallel human telomeric G-quadruplex structures by Sr(2+)

Human telomeric DNA forms G-quadruplex secondary structures, which can inhibit telomerase activity and are targets for anti-cancer drugs. Here we show that Sr(2+) can induce human telomeric DNA to form both inter- and intramolecular structures having characteristics consistent with G-quadruplexes. Unlike Na(+) or K(+), Sr(2+) facilitated intermolecular structure formation for oligonucleotides with 2 to 5 5'-d(TTAGGG)-3' repeats. Longer 5'-d(TTAGGG)-3' oligonucleotides formed exclusively intramolecular structures. Altering the 5'-d(TTAGGG)-3' to 5'-d(TTAGAG)-3' in the 1st, 3rd, or 4th repeats of 5'-d(TTAGGG)(4)-3' stabilized the formation of intermolecular structures. However, a more compact, intramolecular structure was still observed when the 2nd repeat was altered. Circular dichroism spectroscopy results suggest that the structures were parallel-stranded, distinguishing them from similar DNA sequences in Na(+) and K(+). This study shows that Sr(2+), promotes parallel-stranded, inter- and intramolecular G-quadruplexes that can serve as models to study DNA substrate recognition by telomerase.     

The hydrogen-bonding structure in parallel-stranded duplex DNA is reverse Watson-Crick

Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5'-d-[(A)10TAATTTTAAATATTT]-3' (D1) and 5'-d[(T)10ATTAAAATTTATAAA]-3' (D2) in H2O and D2O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5'-d(AAATATTTAAAATTA-(T)10]-3' (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly[d(A)].poly[d(T)] and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due to changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region (1600-1700 cm-1) implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent wtih formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogenous sequence and high A,T content are observed at 843 and 1092 cm-1 in the spectra of the parallel-stranded duplex. The 843-cm-1 band is due to the presence of a sizable population of furanose rings in the C2'-endo conformation. Significant changes observed in the regions from 1150 to 1250 cm-1 and from 1340 to 1400 cm-1 in the spectra of the parallel-stranded duplex are attributed to variations in backbone torsional and glycosidic angles and base stacking.     

Parallel self-associated structures formed by T,C-rich sequences at acidic pH

Oligonucleotides of nonregular heteropyrimidine sequences incorporating or not incorporating purine residues 5'-d(ACTCCCTTCTCCTCTCTA), 5'-d(ACTCCCTGGTCCTCTCTA), 5'-d(TCTCTCCTGGTCCCTCC), and 5'-d(TCTCTCCTCTTCCCTCC) can form self-associated parallel-stranded (ps) structures at pH 4-5.5. The ps structures were identified by studying at neutral and acidic pH UV melting transitions, FTIR spectra, and fluorescence of pyrene-labeled oligonucleotides as well as by chemical joining of 5'-phosphorylated oligonucleotides. A gel electrophoresis run for oligonucleotides 5'-d(TCTCTCCTCTTCCCTCC) and 5'-d(ACTCCCTTCTCCTCTCTA) has shown the formation of homoduplexes at low DNA strand concentrations. Ps structures are held by C-C(+) base pairs and have N- and S-types of sugar puckering as detected by FTIR spectroscopy in the millimolar concentration range. Guanine inserts as well as thymine and purine inserts into an oligomeric cytosine sequence make the formation of the tetraplex i-motif unfavorable. MvaI restriction endonuclease, which recognizes the CCT/AGG sequence in DNA, does not cleave parallel pseudosubstrates.     

Circular dichroism and UV melting studies on formation of an intramolecular triplex containing parallel T*A:T and G*G:C triplets: netropsin complexation with the triplex.

We have used circular dichroism and UV absorption spectroscopy to characterize the formation and melting behaviour of an intramolecular DNA triple helix containing parallel T*A:T and G*G:C triplets. Our approach to induce and to stabilize a parallel triplex involves the oligonucleotide 5'-d(G4A4G4[T4]C4T4C4-[T4]G4T4G4) ([T4] represents a stretch of four thymine residues). In a 10 mM sodium cacodylate, 0.2 mM disodium EDTA (pH 7) buffer, we have shown the following significant results. (i) While in the absence of MgCl2 this oligonucleotide adopts an intramolecular hairpin duplex structure prolonged by the single strand extremity 5'-d([T4]G4T4G4), the presence of millimolar concentrations of MgCl2generates an intramolecular triplex (via double hairpin formation). (ii) In contrast to the antiparallel triplex formed by the oligonucleotide 5'-d(G4T4G4[T4]G4A4G4[T4]C4T4C4), the parallel triplex melts in a biphasic manner (a triplex to duplex transition followed by a duplex to coil transition) and is less stable than the antiparallel one. The enthalpy change associated with triplex formation (-37 kcal/mol) is approximately half that of duplex formation (-81 kcal/mol). (iii) The parallel triple helix is disrupted by increasing the concentration of KCl(>10 mM), whereas, under the same conditions, the antiparallel triplex remains stable. (iv) Netropsin, a natural DNA minor groove-binding ligand, binds to the central site A4/T4of the duplex or triplex in an equimolar stoichiometry. Its association constant K is smaller for the parallel triplex ( approximately 1 x 10(7) M-1) than for the antiparallel one ( approximately 1 x 10(8) M-1). In contrast to the antiparallel structure, netropsin binding has no apparent effect on thermal stability of the parallel triple helix.     

Binding of bis-linked netropsin derivatives in the parallel-stranded hairpin form to DNA

Cis-diammine Pt(II)- bridged bis-netropsin and oligomethylene-bridged bis-netropsin in which two monomers are linked in a tail-to-tail manner bind to the DNA oligomer with the sequence 5'-CCTATATCC-3' in a parallel-stranded hairpin form with a stoichiometry 1:1. The difference circular dichroism (CD) spectra characteristic of binding of these ligands in the hairpin form are similar. They differ from CD patterns obtained for binding to the same duplex of another bis-netropsin in which two netropsin moieties were linked in a head-to-tail manner. This reflects the fact that tail-to-tail and head-to-tail bis-netropsins use parallel and antiparallel side-by-side motifs, respectively, for binding to DNA in the hairpin forms. The binding affinity of cis-diammine Pt(II)-bridged bis-netropsin in the hairpin form to DNA oligomers with nucleotide sequences 5'-CCTATATCC-3' (I), 5'-CCTTAATCC-3' (II), 5'-CCTTATTCC-3' (III), 5'-CCTTTTTCC-3' (IV) and 5'-CCAATTTCC-3' (V) decreases in the order I = II > III > IV > V . The binding of oligomethylene-bridged bis-netropsin in the hairpin form follows a similar hierarchy. An opposite order of sequence preferences is observed for partially bonded monodentate binding mode of the synthetic ligand.     

Parallel double stranded helices and the tertiary structure of nucleic acids

Thermal denaturation of four oligonucleotides, viz. 3'-d(AT)5pO(CH2)6Opd(AT)5-3'(par(AT], 3'-d(AT)5pO(CH2)6Opd(AT)5-5'(anti(AT],3'-d(A)10pO(CH2) 6Op(T)10-3'(par(A-T], and 3'-d(A)10pO(CH2)6Opd(T)10-5' (anti(A-T], was studied in 0.01 M phosphate buffer, pH 7, in the presence of 0.1, 0.25, 0.5 and 1.0 M NaCl. All the oligomers were found to exist at a lower temperature (0 to 20 degrees C) as complexes composed either of two oligomer molecules (a canonical duplex) or of more oligomer molecules whereas, at a higher temperature (30 to 70 degrees C), they formed hairpins with a parallel (par(AT) and par(A-T] or antiparallel (anti(AT) and anti(A-T) orientation of the chains. Melting curves (A260(T] were used to calculate thermodynamic parameters for the formation of hairpins and "low-temperature" duplexes. Experiments on ethidium bromide binding to the oligonucleotides have shown that the oligomer anti(A-T) exists, at a low ionic strength, as a four stranded complex ("quadruplex") contains two antiparallel helices, d(A).d(T), which have a parallel orientation and are bound to one another owing to the formation of additional hydrogen bonds between nucleic acid bases. The possible biological function of quadruplexes is discussed.     

Drug recognition of a DNA single strand break: nogalamycin intercalation between coaxially stacked hairpins.

Two DNA hairpin motifs (5'-GCGAAGC-3' and 5'-ACGA AGT-3'), both stabilized by a 5'-GAA loop, have been used to design novel intramolecular double hairpin structures (5'-GCGAAGCACGAAGT-3' and 5'-ACGAAGTGCG AAGC-3') in which coaxial stacking of the two hairpin components generates a double-stranded stem region effectively with a single-strand break in the middle of the sequence at either the TG or CA step between unconnected 3' and 5' terminal bases. We have investigated by NMR the conformation and dynamics of the DNA at the strand break site. We show that mutual stacking significantly enhances the stability of each hairpin. Further, the anthracycline antibiotic nogalamycin binds cleanly to the 5'-TG (5'-CA) site formed by the mutually stacked hairpins despite the break in the sugar-phosphate backbone on one strand. The complex resembles the structure of nogalamycin-DNA complexes with the drug bound at 5'-TG sites in intact duplex sequences, with pi-stacking interactions probably the single dominant stabilizing interaction.     

Sequence specificity of inter- and intramolecular G-quadruplex formation by human telomeric DNA

Human telomeric DNA consists of tandem repeats of the sequence 5'-d(TTAGGG)-3'. Guanine-rich DNA, such as that seen at telomeres, forms G-quadruplex secondary structures. Alternative forms of G-quadruplex structures can have differential effects on activities involved in telomere maintenance. With this in mind, we analyzed the effect of sequence and length of human telomeric DNA on G-quadruplex structures by native polyacrylamide gel electrophoresis and circular dichroism. Telomeric oligonucleotides shorter than four, 5'-d(TTAGGG)-3' repeats formed intermolecular G-quadruplexes. However, longer telomeric repeats formed intramolecular structures. Altering the 5'-d(TTAGGG)-3' to 5'-d(TTAGAG)-3' in any one of the repeats of 5'-d(TTAGGG)(4)-3' converted an intramolecular structure to intermolecular G-quadruplexes with varying degrees of parallel or anti-parallel-stranded character, depending on the length of incubation time and DNA sequence. These structures were most abundant in K(+)-containing buffers. Higher-order structures that exhibited ladders on polyacrylamide gels were observed only for oligonucleotides with the first telomeric repeat altered. Altering the sequence of 5'-d(TTAGGG)(8)-3' did not result in the substantial formation of intermolecular structures even when the oligonucleotide lacked four consecutive telomeric repeats. However, many of these intramolecular structures shared common features with intermolecular structures formed by the shorter oligonucleotides. The wide variability in structure formed by human telomeric sequence suggests that telomeric DNA structure can be easily modulated by proteins, oxidative damage, or point mutations resulting in conversion from one form of G-quadruplex to another.     

Oligonucleotide--minor groove binder 1:2 conjugates: side by side parallel minor groove binder motif in stabilization of DNA duplex

Synthetic polycarboxamides consisting of N-methylpyrrole (Py), N-methylimidazole (Im), N-methyl-3-hydroxypyrrole (Hp) and beta-alanine (beta) show strong and sequence-specific interaction with the DNA minor groove when they form hairpin structures with side-by-side antiparallel motifs. In the present paper, new conjugates containing two ligands linked to the same terminal phosphate of DNA strand were constructed. The paper describes optimized synthesis and properties of oligonucleotide-linked polyamide strands that insert into the minor groove of a duplex in a parallel or antiparallel orientation. Strong stabilization of DNA duplexes by two attached minor groove ligands is demonstrated by the thermal denaturation method. The unmodified duplex 5'-CGTTTATTp-3'/5'-AATAAACG-3' melts at 20 degrees C. When one tetra(Py) residue was attached to the first strand of this duplex, denaturation temperature was increased to 46 degrees C; attachment of the second tetra(Py) in a parallel orientation resulted in denaturation temperature of 60 degrees C. It is even higher than in case of "classic" octapyrrole hairpin ligand (Tm = 58 degrees C). Sequence-specific character of stabilization by two conjugated ligands was demonstrated for G:C-containing oligonucleotides attached to tetracarboxamide and octacarboxamide ligands constructed from Py, Im and beta units according to established recognition rules (deltaTm = 20 degrees C). The two-strand parallel minor groove binder constructions attached to addressing oligonucleotides could be considered as site-specific ligands recognizing single- and double-stranded DNA similarly to already described hairpin MGB structures with antiparallel orientation of carboxamide units.     

Parallel double helix and tertiary structure of nucleic acids

The thermal denaturation of four oligonucleotides, viz. 3'-d(AT)5pO(CH2)6Opd(AT)5-3' (parAT), 3'-d(AT)5pO(CH2)5Opd(AT)5-5' (antiAT), 3'-d(A)10pO(CH2)6Op(T)10-3' (parA-T) and 3'd(A)10pOX X (CH2)6Opd(T)10-5' (antiA-T) in 0.01 M phosphate buffer at pH 7 in presence 0.1, 0.25, 0.5 and 1.0 M NaCl have been studied. It was shown that at lower temperature (0-20 degrees C) all oligomeres exist as complexes of two (canonic duplex) or four (eight) molecules of oligonucleotides, but at higher temperature (30-70 degrees C)- as hairpins with parallel (parAT and parA-T) of antiparallel (antiAT and antiA-T) orientation of chains. Thermodinamic parameters of separated strands-hairpins and hairpins--"low temperature complexes" transition were computated from the melting curves [A260 (T)] by nonlinear regression. AntiA-T was shown by ethidium bromide binding to exist at low strength (0.01 M phosphate buffer without NaCl) as four-stranded complex from two antiparallel double stranded helices parallely oriented and bonded by satisfy hydrogen-bond of groups not involved in WC-pairing. At higher ionic strength the two of such tetramers was conjugated by hydrophobic interaction into octamers. We speculate that four-stranded complexes serves to bring together, and zipper up two antiparallel double stranded helices at replication of DNA, cross-over of gomologues chromosomes and other biochemically important processes.     

Structure of d(GT)n repeating sequences with parallel and antiparallel chains]

The ability of oligonucleotides 3'-d(GT)5pO(CH2)5Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[d(GT)]) to form hairpins and higher associates is studied. Optical methods of thermal denaturation and circular dichroism as well as the fluorescence of ethidium bromide and acridine orange bound to oligonucleotides were used. At room temperatures the formation of hairpin structure with parallel and antiparallel strands is possible. Thermodynamic parameters of par[d(GT)] and anti[d(GT)] are similar and equal to delta H = -15 kcal/mol, delta S = -50 cal/mol. deg. In the temperature range 3-10 degrees C par[d(GT)] and anti[d(GT)] form four-stranded structures with parallel chains, in which layers of four G-residues alternate with unpaired T-residues being bulged out easily. On comparison of occurrence of alternating (GT)n, (GC)n and (G)n sequences in genome it can be stated that (GT)n biological functions could be connected with conformational possibilities of the four-stranded parallel structures with unpaired T-residues.     

Oligodeoxynucleotides having a loop consisting of 3'-deoxy-4'-C-(2-hydroxyethyl)thymidines form stable hairpins

Components that form stable hairpin loops are highly useful for the development of functional DNA and RNA molecules. We have designed and synthesized a sugar-modified thymidine analogue, 3'-deoxy-4'-C-(2-hydroxyethyl)thymidine (X), as a nucleosidic loop component stabilizing the hairpin structure. The ODNs I-1-4, 5'-d[CGAACG-X(n)-CGTTCG]-3' (I-1, n = 1; I-2, n = 2; I-3, n = 3; I-4, n = 4), forming the hairpin loop structures, of which the loop moiety consisted of the analogue X, and also the corresponding unmodified ODNs II-1-4, 5'-d[CGAACG-T(n)-CGTTCG]-3' (II-1, n = 1; II-2, n = 2;II-3, n = 3; II-4, n = 4), having a thymidine loop, were synthesized by the phosphoramidite method. The melting temperatures (T(m)) of the ODNs I-1-4 containing X in the loop moiety at 5 microM were 67.1, 68.1, 73.0, and 69.3 degrees C, respectively, and those of the control natural ODNs II-1-4 were 65.3, 67.0, 69.2, and 68.8 degrees C, respectively. Thus, the ODNs I-1-4 formed a more thermally stable hairpin than the corresponding unmodified ODNs II-1-4 having an equal number of loop residues. The hairpin structures of the modified ODNs I-1-4 and the unmodified ODNs II-1-4 were investigated by CD spectroscopy and molecular mechanics calculations. These results showed that the 4'-branched nucleoside X can stabilize hairpin structures when it is present in the loop moiety, probably due to the flexibility of the one-carbon-elongated 4'-branched structure.     

Parallel-stranded DNA with Hoogsteen base pairing stabilized by a trans-[Pt(NH3)2]2+ cross-link: characterization and conversion into a homodimer and a triplex

The oligonucleotides 5'-d(TTTTCTTTTG) and 5'-d(AAAAGAAAAG) were cross-linked with a trans-[Pt(NH3)2]2+ entity via the N7 positions of the 3'-end guanine bases to give parallel-stranded (ps) DNA. At pH 4.2, CD and NMR spectroscopy indicate the presence of Hoogsteen base pairing. In addition, temperature-dependent UV spectroscopy shows an increase in melting temperature for the platinated duplex (35 degrees C) as compared to the non-platinated, antiparallel-stranded duplex formed from the same oligonucleotides (21 degrees C). A monomer-dimer equilibrium for the platinated 20mer is revealed by gel electrophoresis. At pH 4.2, addition of a third strand of composition 5'-d(AGCTTTTCTTTTAG) to the ps duplex leads to the formation of a triple helix with two distinct melting points at 38 degrees C (platinum cross-linked Hoogsteen part) and 21 degrees C (Watson-Crick part), respectively.     

Phosphate coordination and movement of DNA in the Tn5 synaptic complex: role of the (R)YREK motif

Bacterial DNA transposition is an important model system for studying DNA recombination events such as HIV-1 DNA integration and RAG-1-mediated V(D)J recombination. This communication focuses on the role of protein-phosphate contacts in manipulating DNA structure as a requirement for transposition catalysis. In particular, the participation of the nontransferred strand (NTS) 5' phosphate in Tn5 transposition strand transfer is analyzed. The 5' phosphate plays no direct catalytic role, nonetheless its presence stimulates strand transfer approximately 30-fold. X-ray crystallography indicates that transposase-DNA complexes formed with NTS 5' phosphorylated DNA have two properties that contrast with structures formed with complexes lacking the 5' phosphate or complexes generated from in-crystal hairpin cleavage. Transposase residues R210, Y319 and R322 of the (R)YREK motif coordinate the 5' phosphate rather than the subterminal NTS phosphate, and the 5' NTS end is moved away from the 3' transferred strand end. Mutation R210A impairs the 5' phosphate stimulation. It is posited that DNA phosphate coordination by R210, Y319 and R322 results in movement of the 5' NTS DNA away from the 3'-end thus allowing efficient target DNA binding. It is likely that this role for the newly identified RYR triad is utilized by other transposase-related proteins.     

A probe for the mutagenic activity of the carcinogen 4-aminobiphenyl: synthesis and characterization of an M13mp10 genome containing the major carcinogen-DNA adduct at a unique site

The duplex genome of Escherichia coli virus M13mp10 was modified at a unique site to contain N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG8-ABP), the major carcinogen-DNA adduct of the human bladder carcinogen 4-aminobiphenyl. A tetradeoxynucleotide containing a single dG8-ABP residue was synthesized by reacting 5'-d(TpGpCpA)-3' with N-acetoxy-N-(trifluoracetyl)-4-aminobiphenyl, followed by high-performance liquid chromatography purification of the principal reaction product 5'-d(TpG8-ABPpCpA)-3' (yield 15-30%). Characterization by fast atom bombardment mass spectrometry confirmed the structure as an intact 4-aminobiphenyl-modified tetranucleotide, while 1H nuclear magnetic resonance spectroscopy established the site of substitution and the existence of ring stacking between the carcinogen residue and DNA bases. Both 5'-d(TpG8-ABPpCpA)-3' and 5'-d(TpGpCpA)-3' were 5'-phosphorylated by use of bacteriophage T4 polynucleotide kinase and were incorporated into a four-base gap uniquely positioned in the center of the recognition site for the restriction endonuclease PstI, in an otherwise duplex genome of M13mp10. In the case of the adducted tetranucleotide, dG8-ABP was located in the minus strand at genome position 6270. Experiments in which the tetranucleotides were 5' end labeled with [32P]phosphate revealed the following: the adducted oligomer, when incubated in a 1000-fold molar excess in the presence of T4 DNA ligase and ATP, was found to be incorporated into the gapped DNA molecules with an efficiency of approximately 30%, as compared to the unadducted d(pTpGpCpA), which was incorporated with 60% ligation efficiency; radioactivity from the 5' end of each tetranucleotide was physically mapped to a restriction fragment that contained the PstI site and represented 0.2% of the genome; the presence of the lesion within the PstI recognition site inhibited the ability of PstI to cleave the genome at this site; in genomes in which ligation occurred, T4 DNA ligase was capable of covalently joining both modified and unmodified tetranucleotides to the gapped structures on both the 5' and the 3' ends with at least 90% efficiency. Evidence also is presented showing that the dG8-ABP-modified tetranucleotide was stable to the conditions of the recombinant DNA techniques used to insert it into the viral genome.(ABSTRACT TRUNCATED AT 400 WORDS)     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

A triple-stranded "clip" from the oligonucleotide 3'-(dA)10-pO(Ch2Ch2O)3p-(dT)10-pO(CH2CH2O)3-p-(dT)10(-5)]

The temperature dependence of the UV- and CD-spectra of the oligonucleotides 3'-d(A)10-L-(T)10-5' [anti(AT)], 3'-d(A)10-L-d(T)10-3' [par(AT)] and 3'-d(A)10-L-(dT)10-L-(dT)10-5' [tripl(ATT)] (L = -PO(CH2CH2O) 3p-) in the phosphate buffer at pH 7 under different concentrations of NaCL and in the presence or absence of 0.01 M MgCl2 was studied. All registered structural changes are the result of intramolecular processes if the concentrations of the oligonucleotides is low (about 2.2.10(-5) M). Par(AT) and anti(AT) exist in the only two forms, transforming into each other: under low temperatures they exist as hairpins with the parallel or antiparallel orientation of chains accordingly which transform into unfolded chains when the temperature increased. In contrast trip(ATT) exists in the three different forms depending on the temperature and ion conditions. They are: the three- stranded clip, the two-stranded hairpin with a single stranded "tail" and completely unfolded chain. For the first time this work presents thermodynamic parameters of the triplex formation from deoxyoligonucleotides depending on NaCl concentration. We have registered the CD spectra to one-, two-, and three-stranded forms. Ethidium bromide binding to three-stranded "clip" was investigated, and it was established that molecules of the dye may intercalate into the "clip" with formation of stable complexes (the constant of association 10(6) M-1). It is maximum three molecules of ethidium bromid which may bound to one molecule of the three-stranded clip. It has been shown that the suggested synthetic model (three oligonucleotide blocks combined by hydroxyalkyl chains) is the most convenient for physico-chemical investigations of triplexes today.     

DNA-based biosensor for monitoring pH in vitro and in living cells

DNA is a promising material for the construction of a biosensor or bioindicator because its structure is sensitive to the binding of cofactors. In the current studies, we found that a combination of two DNA oligonucleotides, 5'-TCTTTCTCTTCT-3' and 5'-AGAAAGAGAAGA-3', exhibit a novel structural transition from a Watson-Crick antiparallel duplex to a parallel Hoogsteen duplex as the pH changes from pH 7.0 to 5.0. By labeling this DNA for fluorescence resonance energy transfer, we were able to develop a sensitive pH indicator that can detect changes between pH 7.0 and 5.0. Moreover, using DNA-based hairpin parallel-stranded duplex in conjunction with fluorescence microscopy, we were able to observe the pH changes in living cells during apoptosis as an easily detected change in color. These results indicate that the DNA-based pH indicator should be useful for detecting pH changes between pH 7.0 and 5.0 in living cells.