Efficient synthesis of double dye-labeled oligodeoxyribonucleotide probes and their application in a real time PCR assay.

A fast cleaving non-nucleosidic tetramethylrhodamine dye-labeled support has been developed for automated synthesis of double dye-labeled oligodeoxyribonucleotides in high yield. A mixture (1:1:2) of t-butylamine:methanol:water is used for cleavage and deprotection of dye-labeled oligodeoxyribonucleotides without any degradation or modification of dyes and nucleobases. The cleavage rate of oligodeoxyribonucleotides is significantly increased by using a diglycolate ester linkage instead of the commonly used succinate linkage. These double dye-labeled probes are used in PCR for real time detection of a specific PCR product. Using a 5'-exonuclease assay, detected on the ABI PRISM 7700 Sequence Detection System, there was no distinguishable difference in performance of probes synthesized using the dye-labeled support compared with traditional post-synthetic attachment of rhodamine.     

Synthesis of Oligodeoxyribonucleotides Containing Oleylamine Moieties

A method for directional introduction of oleylamine residues to any position of oligodeoxyribonucleotides during their automated synthesis was developed. The presence of oleylamine residues in 3"- or 5"-terminal nucleotides was shown to have no effect on the thermodynamic stability of DNA duplexes formed by such oligonucleotides and the complementary sequences. The rate of hydrolysis of oligonucleotides containing oleylamine residues in the 3"-terminal units by the snake venom phosphodiesterase was shown to be markedly lower than that of natural oligonucleotides.     

Comparative hybrid arrest by tandem antisense oligodeoxyribonucleotides or oligodeoxyribonucleoside methylphosphonates in a cell-free system.

Antisense oligonucleotides containing either anionic diester or neutral methylphosphonate internucleoside linkages were prepared by automated synthesis, and were compared for their ability to arrest translation of human dihydrofolate reductase (DHFR) mRNA in a nuclease treated rabbit reticulocyte lysate. In the case of oligodeoxyribonucleotides, tandem targeting of three 14-mers resulted in synergistic and complete selective inhibition of DHFR synthesis at a total oligomer concentration of 25 microM. Hybrid arrest by three or six tandem oligodeoxyribonucleoside methylphosphonates was dramatically less effective. This difference does not result from preferential recognition of hybrids involving oligodeoxyribonucleotides by endogenous RNaseH activity. A ribonuclease protection assay demonstrated that antisense oligodeoxyribonucleoside methylphosphonates bind selectively to target RNA sequences, but with 275 fold lower affinity than the corresponding oligodeoxyribonucleotides. This low binding affinity results in poor arrest of translation, and may be related to the stereochemistry of the methylphosphonate linkage.     

Use of 1,2,4-dithiazolidine-3,5-dione (DtsNH) and 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) for synthesis of phosphorothioate-containing oligodeoxyribonucleotides.

Previous methods for the preparation of phosphorothioate-containing oligodeoxyribonucleotides rely on the reaction of phosphite triesters with sulfurizing reagents such as tetraethylthiuram disulfide (TETD) and 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage reagent). However, these and other sulfurizing reagents suffer from several disadvantages, and there is great impetus for the development of improved methods for sulfur transfer that are fully compatible with standard automated DNA synthesis. The present report describes the use of 1,2,4-dithiazolidine-3,5-dione (DtsNH) and 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) as effective sulfurizing reagents that meet these needs. Both reagents are easily prepared, and are stable upon prolonged room temperature storage in acetonitrile solution. The reagents are used at low concentrations (0.05 M) and for short reaction times (30 s). The methodology has been proven for the automated synthesis on 0.2-1.0 micromol scales of oligodeoxyribonucleotides, of length 6-20 bases, containing the phosphorothioate substitution at either a single site or at all positions.     

Automated synthesis of oligodeoxyribonucleotides with terminal phosphate groups

3'- and 5'-phosphorylated oligodeoxyribonucleotides have been synthesized on the "Victoria-4M" automatic synthesizer by phosphoramidite method. Two approaches have been suggested: introduction of a terminal ribo-unit as a potential source of phosphate group or the use of hydroxyl-containing polymer supports which loose the end product of the synthesis via beta-elimination reaction. Yields of oligonucleotides obtained according to both schemes proved to be almost identical. Using the first approach, oligonucleotides containing units with altered configuration of the sugar (xylo-thymidine and arabino-uridine) have been obtained.     

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.     

An efficient synthesis of nucleotides via the phosphoramidite method using a triflic acid salt of an imidazole-related compound as a promoter.

N-Phenylimidazolium triflate and N-methylbenzimidazolium triflate, new imidazole-related compound/triflic acid-complex type of promoters in the phosphoramidite method, has been developed. These reagents are, particularly, useful for internucleotide-bond formation with lowly reactive reactants and have allowed an efficient, high-yield synthesis of oligodeoxyribonucleotides both in a solution phase and on a solid supports.     

Synthesis of RNA using T7 RNA polymerase and immobilized DNA in a stream type reactor]

The DNA ligase-induced assembly of synthetic oligodeoxyribonucleotides on polymer supports was used to obtain immobilized DNA, containing the T7 RNA polymerase promoter and coding for a 14-membered oligoribonucleotide. The obtained template can carry out RNA synthesis in a flowing-type reactor. Sepharose 4B and Toyopearl HW-55 were used as supports.     

Synthesis of oligodeoxyribonucleotides containing oleylamine moieties]

A method for directional introduction of oleylamine residues to any position of oligodeoxyribonucleotides during their automated synthesis was developed. The presence of oleylamine residues in 3'- or 5'-terminal nucleotides was shown to have no effect on the thermodynamic stability of DNA duplexes formed by such oligonucleotides and the complementary sequences. The rate of the snake venom phosphodiesterase hydrolysis of oligonucleotides containing oleylamine residues in the 3'-terminal units was shown to be markedly lower than that of natural oligonucleotides.     

Use of Long Oligonucleotides in Gene Synthesis: Chemical Synthesis and Cloning of a Gene for Salmon Calcitonin

Abstract

The design, chemical synthesis and cloning of a gene for salmon calcitonin I-gly(33) consisting of two long oligodeoxyribonucleotides (109- and 117-mer) are described. Synthesizing both of the oligonucleotides on CPG supports with pore sizes of 500 or 1000 A respectively, a superior performance of the 1000 A material was observed.     

Synthesis and hydrolysis of oligodeoxyribonucleotides containing 2-aminopurine.

A new method is reported for the synthesis of oligodeoxyribonucleotides containing 2-aminopurine residues at selected sites. This method involves protection of the 2-aminopurine ribonucleoside, reduction to the deoxyribonucleoside and standard preparation of the 5'-0- (4,4'-dimethoxytrityl)-3'-O-(2-cyanoethyl)-N,N- diisopropylphosphoramidite. The 2-aminopurine phosphoramidite prepared by this method couples with high efficiency and is stable under standard automated synthesis conditions. The presence and location of the 2-aminopurine residue is easily verified by treatment of the oligodeoxyribonucleotide with hot piperidine. The mechanism for selective hydrolysis of the 2-aminopurine residue in alkaline solution is predominantly direct cleave of the glycosidic bond.     

Improvements in the phosphoramidite procedure for the synthesis of oligodeoxyribonucleotides.

The paper describes an improved method for the synthesis of oligodeoxyribonucleotides using phosphoramidite chemistry. Our procedure relies on novel phosphoramidite intermediates, the deoxyribonucleoside-3'-morpholine-methoxyphosphins. These compounds are extremely stable and can be purified readily. Condensation reactions during solid-phase synthesis can thus be performed with high efficiency and result in a high yield synthesis of long chain oligodeoxyribonucleotides.     

Cleavage of oligodeoxyribonucleotides from controlled-pore glass supports and their rapid deprotection by gaseous amines.

A novel method for the deprotection of oligodeoxyribonucleotides has been developed. Gaseous amines such as ammonia or methylamine were employed under pressure to achieve mild and rapid deprotection conditions. For example, oligodeoxyribonucleotides having a (tert-butyl)phenoxyacetyl group for the protection of the exocyclic amino function of cytosine, adenine and guanine were released from controlled-pore glass supports and fully deprotected by ammonia or methylamine under gas phase conditions, at room temperature, within 35 or 2 min respectively.     

Automated 3'-H-phosphonate synthesis of oligodeoxyribonucleotides using amidine protected purine synthons

Side reaction during phosphitylation of 5'-O-dimethoxytrityl-N2-isobutyryl-2'-deoxyguanosine was observed. As a suitable dG synthon, 5'-O-dimethoxytrityl-N2-dimethylaminomethyl-ene-3'-H-phosphonate was developed and used, along with 3'-H-phosphonates of 5'-O-dimethoxytrityl derivatives of dT, N4--benzoyl-dC and N6-dimethylaminoethylidene-dA, in automated synthesis of several oligodeoxyribonucleotides containing 30-40 bases.     

A new linkage for solid phase synthesis of oligodeoxyribonucleotides.

An aryl diisocyanate has been used to attach an appropriately protected 2'-deoxyribonucleoside bearing a free 3'-hydroxyl group, to a long chain alkylamine controlled pore glass support via a urethane moiety, in a simple two step procedure. This obviates the need for the preparation and short column chromatographic purification of the 2'-deoxyribonucleoside-3'-O-succinates required for preparation of the widely used succinyl linked supports. The greater stability of the urethane bond compared to an ester bond led to substantially higher yields of oligodeoxyribonucleotides prepared by the solid phase phosphotriester method. More than twenty oligodeoxyribonucleotides have already been synthesized on the glass support bearing the new linkage.     

The preparative synthesis of oligodeoxyribonucleotides using RNA ligase.

The synthesis of nmol quantities of defined sequences of oligodeoxyribonucleotides using T4 RNA ligase has been demonstrated. Reacting using from 18 to 200 nmol of substrates in which a single 2'-deoxyribonucleoside 3',5'-bisphosphate was added to an oligodeoxyribonucleotide resulted in yields from 13 to 95%. When two oligodeoxyribonucleotides were similarly joined using RNA ligase, the yields ranged from 10 to 50%. Although the reactions contained high concentrations of enzyme and were incubated from 5 to 21 days, there was little degradation of either substrates or products. We have also characterized an unusual product which arises when 3'-phosphate terminated oligodeoxyribonucleotides are incubated with RNA ligase and high concentrations of ATP. This product has an adenylyl group linked to the 3'-phosphate by an anhydride bond. The mechanistic and synthetic implications of forming this product are discussed.     

Rapid automated synthesis on paper disks of oligodeoxyribonucleotides constituting the promoter fragment of the vaccinia virus genome

For automation of segmental solid-phase synthesis a simple approach leading to the optimal scheme of synthesis of a large numbers of oligonucleotides in one reaction vessel has been proposed. An advantage of the scheme as compared with synthesis in four reaction vessels is a lower number of condensation steps and increased economy of the process. Sixteen oligodeoxyribonucleotides constituting promoter fragment of the viral genome have been synthesised by the modified segmental method on "Victoriya-2" synthesizer according to the optimal scheme.     

Further optimization of detritylation in solid-phase oligodeoxyribonucleotide synthesis

Various conditions for optimum detritylation (i.e., the removal of 5'-O-trityl protecting groups) during solid-phase synthesis of oligodeoxyribonucleotides were investigated. Di- and tri-chloroacetic acids of variable concentrations were used to study the removal of the 4,4'-dimethoxytrityl (DMTr) group. It was found that the DMTr group could be completely removed under much milder acidic conditions than what are currently used for automated solid-phase synthesis. The 2,7-dimethylpixyl (DMPx) is proposed as an alternative and more readily removable group for the protection of the 5'-OH functions both in solid- and solution-phase synthesis. The improved detritylation conditions are expected to minimize the waste and offer a protocol for incorporation of acid sensitive building-blocks in oligonucleotides.     

Rapid synthesis of oligodeoxyribonucleotides. IV. Improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.

A phosphotriester solid phase method on a polyamide support has been used to prepare oligodeoxyribonucleotides up to 12 units long. Compared to solid phase phosphodiester synthesis the new methodology is quicker, more flexible and gives 10-60-fold better overall yields.     

Further Optimization of Detritylation in Solid-Phase Oligodeoxyribonucleotide Synthesis

Various conditions for optimum detritylation (i.e., the removal of 5′-O-trityl protecting groups) during solid-phase synthesis of oligodeoxyribonucleotides were investigated. Di- and tri-chloroacetic acids of variable concentrations were used to study the removal of the 4,4′-dimethoxytrityl (DMTr) group. It was found that the DMTr group could be completely removed under much milder acidic conditions than what are currently used for automated solid-phase synthesis. The 2,7-dimethylpixyl (DMPx) is proposed as an alternative and more readily removable group for the protection of the 5′-OH functions both in solid- and solution-phase synthesis. The improved detritylation conditions are expected to minimize the waste and offer a protocol for incorporation of acid sensitive building-blocks in oligonucleotides.