An NMR Study of the Polymorphous Behavior of the Mismatched DNA Octamer d(m5C-G-m5C-G-T-G-m5C-G) in Solution. The B,Z, and Hairpin Forms

Abstract

The polymorphism exhibited by the mismatched octamer d(m ⁵C-G-m⁵C-G-T-G-m⁵C-G), as a function of the temperature, DNA concentration and ionic strength, was investigated by means of NMR spectroscopy.

It is shown that this partly self-complementary DNA fragment, under conditions of low DNA concentration (0.4 mM) and low ionic strength, exclusively prefers to adopt a monomeric hairpin form, which consists of a stem of three Watson-Crick-type base pairs and a loop of only two residues. This in striking contrast with earlier intimations in literature, which postulated that in oligonucleotides loop formations containing only two residues are sterically impossible. Moreover, the hairpin form displays an unusual stability in comparison with previously reported hairpins. AT_m of 332 K and a ΔH° of—130 kj · mol^?1 were calculated for the hairpin to random coil transition.

At high DNA concentration (8 mM)and/or upon the addition of sodium chloride the hairpin form occurs in slow exchange with a B-DNA dimer structure (approximately 20% at 270 K, no added salt), which comprises two central GxT-mismatched base pairs with the bases as major tautomers.

At higher ionic strength (> 100 mM NaCI), or upon the addition of methanol, a third species appears, which is in slow exchange with both the B dimer and the hairpin form. This third species could be identified with a Z DNA form, comprising two GxT mismatches with the bases as major tautomers, with the guanine bases syn and the cytosine and thymine bases anti.     

An NMR study of polymorphous behaviour of the mismatched DNA octamer d(m5C-G-m5C-G-A-G-m5C-G) in solution. The B-duplex and hairpin forms

By means of one- and two-dimensional NMR spectroscopy the solution structures of the partly self-complementary octamer d(m5C-G-m5C-G-A-G-m5C-G) were investigated. It is shown that this DNA fragment, under conditions of high DNA concentration (8 mM DNA) and/or high ionic strength prefers to adopt a duplex structure. At low DNA concentration (0.4 mM DNA), the duplex exists in a 1:1 slow equilibrium with a monomeric hairpin form. Addition of salt destabilizes the hairpin structure in favour of the dimer. At high temperatures the hairpin form, as well as the dimer structure, exist in a fast equilibrium with the random-coil form. For the hairpin/random-coil equilibrium a Tm of 329 K and a delta H degree of -121 kJ.mol-1 were deduced. These thermodynamic parameters are independent of the DNA concentration, as is expected for a monomeric structure. For the dimer to coil transition a Tm of 359 K (1 M DNA) and a delta H degree of -285 kJ.mol duplex-1 were derived. The thermodynamic data of the hairpin-coil transition mutually agree with those recently reported for the hairpin to random coil equilibrium of the DNA octamer d(m5C-G-m5C-G-T-G-m5C-G) [Orbons, L. P. M., van der Marel, G. A., van Boom, J. H. & Altona, C. (1987) J. Biomol. Struct. Dyns. 4, 939-963]. It is demonstrated that the dimer structure exhibits B-DNA characteristics, as is witnessed by the NOESY experiments and the analysis of the proton-proton coupling data. It is shown that the base-pair formation of the G x A mismatches is anti-anti. A comparison of 1H and 31P chemical-shift data of the title compound with those of a well-characterized B-DNA structure reveals large differences in the dm5C(3)-dG(4)-dA(5) part of the mismatched dimer structure. These differences apparently indicate some major local structural changes due to the incorporation of the G x A mismatches. Under the most extreme conditions used (i.e. up to 3 M NaCl or 75% CH3OH in the presence of 10 mM MgCl2) no Z-DNA structure was observed. It is shown that the structural features of the hairpin form of the title compound mimic those of the hairpin structure of d(m5C-G-m5C-G-T-G-m5C-G). An energy-minimized model of the hairpin form is given.     

Conformational consequences of the incorporation of arabinofuranosylcytidine in DNA. An NMR study of the DNA fragments d(CGCTAGCG) and d(CGaCTAGCG) in solution

The self-complementary octamers d(CGCTAGCG) and d(CGaCTAGCG) (aC, arabinofuranosylcytidine) were studied by means of NMR spectroscopy. It is shown that d(CGaCTAGCG), under suitable conditions of oligonucleotide concentration, ionic strength and temperature, exclusively adopts a hairpin structure. However, under the same experimental conditions (5 mM DNA, no added salt, 295 K) d(CGCTAGCG) mainly adopts a B-DNA-type duplex. At lower temperatures (less than or equal to 290 K) the hairpin form of d(CGaCTAGCG) occurs in slow exchange with an intact B-DNA-type duplex. When the DNA concentration of d(CGCTAGCG) is dramatically reduced (less than or equal to 0.5 mM) the hairpin form becomes highly favoured at the expense of the dimer. Moreover, proton-chemical-shift considerations indicate that the structural features of the hairpin structure of d(CGCTAGCG) mimic, in part, those of the modified octamer d(CGaCTAGCG), i.e. a loop comprising only the two central residues with the thymine located into the minor groove (Pieters, J. M. L., de Vroom, E., van der Marel, G. A., van Boom, J. H., Koning, T. M. G., Kaptein, R. and Altona, C. unpublished results). Thermodynamic analysis of d(CGCTAGCG) yields an average Tmd value of 342 K (1 M DNA) and a delta Hod value of -266 kJ/mol for the dimer/coil transition and an average Tmh value of 321 K and delta Hoh - 102 kJ/mol for the hairpin/coil equilibrium. For the duplex/coil equilibrium of d(CGaCTAGCG) an average Tmd value of 336 K (1 M DNA) and delta Hod value of -253 kJ/mol are deduced. The hairpin/coil transition of d(CGaCTAGCG) is characterized by a delta Hoh value of -104 kJ/mol and an average Tmh value of 331 K. It is concluded that incorporation of an arabinofuranosylcytidine in the octamer d(CGaCTAGCG) results in stabilization of the hairpin form, whereas the dimer is destablized by two aC.dG base pairs.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), and CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA.TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A.T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in two different structures are reported.     

The formation of adjacent triplex-duplex domainsin DNA.

The ability of single-stranded DNA oligomers to form adjacent triplex and duplex domains with two DNA structural motifs was examined. Helix-coil transition curves and a gel mobility shift assay were used to characterize the interaction of single-stranded oligomers 12-20 nt in length with a DNA hairpin and with a DNA duplex that has a dangling end. The 12 nt on the 5'-ends of the oligomers could form a triplex structure with the 12 bp stem of the hairpin or the duplex portion of the DNA with a dangling end. The 3'-ends of the 17-20 nt strands could form Watson-Crick pairs to the five base loop of the hairpin or the dangling end of the duplex. Complexes of the hairpin DNA with the single-stranded oligomers showed two step transitions consistent with unwinding of the triplex strand followed by hairpin denaturation. Melting curve and gel competition results indicated that the complex of the hairpin and the 12 nt oligomer was more stable than the complexes involving the extended single strands. In contrast, results indicated that the extended single-stranded oligomers formed Watson-Crick base pairs with the dangling end of the duplex DNA and enhanced the stability of the adjacent triplex region.     

NMR solution structure of the L 9.1a region of Tetrahymena group I intron.

The solution structure of 20 mer RNA contained of the loop 9.1a region of Tetrahymena group I intron was studied by NMR. This RNA oligomer has hairpin and duplex structures at high concentration (1 mM) of the sample even at low NaCl concentration (5 mM). In the hairpin structure, GC base pairs by the loop-loop interaction are formed. As study of NOESY measurements, and by the compared with the sequence, this loop region is presumed to interact with the loop 5c.     

The effect of cross-links on the conformational dynamics of duplex DNA.

The base pair lifetimes and apparent dissociation constants of a 21 base DNA hairpin and an analog possessing a disulfide cross-link bridging the 3'- and 5'-terminal bases were determined by measuring imino proton exchange rates as a function of exchange catalyst concentration and temperature. A comparison of the lifetimes and apparent dissociation constants for corresponding base pairs of the two hairpins indicates that the cross-link neither increases the number of base pairs involved in fraying nor alters the lifetime, dissociation constant, or the opened structure from which exchange occurs for the base pairs that are not frayed. The cross-link does, however, stabilize the frayed penultimate base pair of the stem duplex. Significantly, it appears that the disulfide cross-link is more effective at preventing fraying of the penultimate base pair than is the 5 base hairpin loop. Because this disulfide cross-link can be incorporated site specifically, and does not adversely affect static or dynamic properties of DNA, it should prove very useful in studies of nucleic acid structure and function.     

DNA hairpin structures in solution: 500-MHz two-dimensional 1H NMR studies on d(CGCCGCAGC) and d(CGCCGTAGC)

A hairpin structure contains two conformationally distinct domains: a double-helical stem with Watson-Crick base pairs and a single-stranded loop that connects the two arms of the stem. By extensive 1D and 2D 500-MHz 1H NMR studies in H2O and D2O, it has been demonstrated that the DNA oligomers d(CGCCGCAGC) and d(CGCCGTAGC) form hairpin structures under conditions of low concentration, 0.5 mM in DNA strand, and low salt (20 mM NaCl, pH 7). From examination of the nuclear Overhauser effect (NOE) between base protons H8/H6 and sugar protons H1' and H2'/H2", it was concluded that in d(CGCCGCAGC) and d(CGCCGTAGC) all the nine nucleotides display average (C2'-endo,anti) geometry. The NMR data in conjunction with molecular model building and solvent accessibility studies were used to derive a working model for the hairpins.     

Effect of base-pair sequence on the conformations and thermally induced transitions in oligodeoxyribonucleotides containing only AT base pairs

Tm curves, CD spectra, and kinetics results of the self-complementary DNA dodecamers d(A6T6), d(A3T3A3T3), d(A2T2A2T2A2T2), d(ATATATATATAT), and d(T6A6) demonstrate that the thermal transitions of these oligomers at low salt concentration involve a hairpin intermediate. At high salt concentrations (greater than 0.1 M Na+) only a duplex to denatured-strand transition appears to occur. The temperature and salt-concentration regions of the transitions are very sequence dependent. Alternating-type AT sequences have a lower duplex stability and a greater tendency to form hairpins than sequences containing more nonalternating AT base pairs. Of the two nonalternating sequences, d(T6A6) is significantly less stable than d(A6T6). Both oligomers have CD curves that are very similar to the unusual CD spectrum of poly(dA).poly(dT). The Raman spectra of these two oligomers are also quite similar, but at low temperature, small intensity differences in two backbone modes and three nucleoside vibrations are obtained. The hairpin to duplex transition for the AT dodecamers was examined by salt-jump kinetics measurements. The transition is faster than transitions for palindromic-sequence oligomers containing terminal GC base pairs. Stopped-flow kinetics studies indicate that the transition is second order and has a relatively low activation energy. The reaction rate increases with increasing ionic strength. These results are consistent with a three-step mechanism for the hairpin to duplex reaction: (i) fraying of the hairpin oligomers' terminal base pairs, (ii) a rate-determining bimolecular step involving formation of a cruciform-type intermediate from two hairpin oligomers with open terminal base pairs, and (iii) base-pair migration and formation in the intermediate to give the duplex.     

Interaction of Topotecan,DNA Topoisomerase I Inhibitor,with Double-Stranded Polydeoxyribonucleotides. 5. Topotecan is Capable of Producing Single- and Double-Strand Breaks in Circular Supercoiled DNA in the Absence of the Enzyme

A study was made of the temperature, concentration, and time dependences for the emergence of breaks in the sugar-phosphate backbone of a circular supercoiled DNA (scDNA) in the presence of a campto-thecin derivative topotecan (TPT) and in the absence of DNA topoisomerase I (topo I). The experiments were carried out in low ionic strength solutions (10 mM sodium cacodylate) at neutral pH (6.8). The incubation time necessary for the appearance of double-strand breaks in scDNA in the presence of TPT correlated with the time of formation of strong TPT–DNA complex. This is the first demonstration that molecules of the camptothecin family can cause double-strand breaks in scDNA in the absence of the enzyme. A model is suggested for the complex composed of two crossed DNA duplexes bound through a bridge of two dimers of the TPT lactone form. According to this model, two carbonyl groups of D rings of different TPT dimers form hydrogen bonds with 2-amino groups of guanines located in the neighboring base pairs of different strands of one DNA duplex. At the same time, two other carbonyl groups of D rings of TPT dimers form hydrogen bonds with 2-amino groups of guanines 5 bp apart in one and the same strand of the second DNA duplex.     

Conformational and model-building studies of the hairpin form of the mismatched DNA octamer d(m5C-G-m5C-G-T-G-m5C-G)

The hairpin form of the mismatched octamer d(m5C-G-m5C-G-T-G-m5C-G) was studied by means of NMR spectroscopy. In a companion study it is shown that the hairpin form of this DNA fragment consists of a structure with a stem of three Watson-Crick-type base pairs and a loop consisting of only two nucleotides. The non-exchangeable proton resonances were assigned by means of two-dimensional correlation spectroscopy and two-dimensional nuclear Overhauser effect spectroscopy. Proton-proton coupling constants were used for the conformational analysis of the deoxyribose ring and for some of the backbone torsion angles. From the two-dimensional NMR spectra and the coupling-constant analysis it is concluded that: (i) the stem of the hairpin exhibits B-DNA characteristics; (ii) the sugar rings are not conformationally pure, but display a certain amount of conformational flexibility; (iii) the stacking interaction in the stem of the hairpin is elongated from the 3'-side in a more or less regular fashion with the two loop nucleotides; (iv) at the 5'-side of the stem a stacking discontinuity occurs between the stem and the loop; (v) at the 5'-side of the stem the loop is closed by means of a sharp backbone turn which involves unusual gamma' and beta+ torsion angles in residue dG(6). The NMR results led to the construction of a hairpin-loop model which was energy-minimized by means of a molecular-mechanics program. The results clearly show that a DNA hairpin-loop structure in which the loop consists of only two nucleotides bridging the minor groove in a straightforward fashion, (i) causes no undue steric strain, and (ii) involves well-known conformational principles throughout the course of the backbone. The hairpin form of the title compound is compared with the hairpin form of d(A-T-C-C-T-A-T4-T-A-G-G-A-T), in which the central -T4- part forms a loop of four nucleotides. Both models display similarities as far as stacking interactions are concerned.     

The duplex-hairpin conformational transition of d(CGCGCGATCGCGCG) and d(CGCGCGTACGCGCG): a thermodynamic and kinetic study

We have studied the duplex-hairpin conformational transition in two perfectly palindromic sequences, d(CGCGCGATCGCGCG)(I) and d(CGCGCGTACGCGCG)(II), by means of UV-melting, electrophoretic and T-jump experiments. Both tetradecamers exhibit biphasic thermal profiles. The lower temperature transition is concentration dependent whereas the higher temperature transition is not. The former transition has been characterized by gel electrophoresis and shows two distinct bands, whose intensity depends on temperature. This behavior is due to the occurrence of a slow premelting interconversion between the duplex and hairpin forms in both tetradecamers. The kinetics of hairpin formation from the duplex is studied by T-jump experiments. Relaxation spectra are well reproduced by a single relaxation time with rate constants characterized by a high temperature coefficient. In 10 mM NaCl, the duplex-hairpin conversion of I is characterized by an apparent activation energy of 96 +/- 6 kcal/mol, a value rather close to the expected denaturation enthalpy. In 1 mM NaCl a value slightly lower has been obtained. The rate of duplex-hairpin interconversion has been found to decrease as the salt concentration is raised. These data suggest that the transformation from the duplex to the hairpin form should imply a transition state with a simultaneous breaking of most base pairs, if not total strand separation.     

The Duplex-Harpin Conformational Transition of d(CGCGCGATCGCGCG) and d(CGCGCGTACGCGCG): A Thermodynamic and Kinetic Study

Abstract

We have studied the duplex-hairpin conformational transition in two perfectly palindromic sequences, d(CGCGCGATCGCGCG)(I) and d(CGCGCGTACGCGCG)(II), by means of UV-melting, electrophoretic and T-jump experiments. Both tetradecamers exhibit biphasic thermal profiles. The lower temperature transition is concentration dependent whereas the higher temperature transition is not. The former transition has been characterized by gel electrophoresis and shows two distinct bands, whose intensity depends on temperature. This behavior is due to the occurrence of a slow premelting interconversion between the duplex and hairpin forms in both tetradecamers. The kinetics of hairpin formation from the duplex is studied by T-jump experiments. Relaxation spectra are well reproduced by a single relaxation time with rate constants characterized by a high temperature coefficient. In 10 mM NaCl, the duplex-hairpin conversion of I is characterized by an apparent activation energy of 96 ± 6 kcal/mol, a value rather close to the expected denaturation enthalpy. In 1 mM NaCl a value slightly lower has been obtained. The rate of duplex-hairpin interconversion has been found to decrease as the salt concentration is raised. These data suggest that the transformation from the duplex to the hairpin form should imply a transition state with a simultaneous breaking of most base pairs, if not total strand separation.     

Free energy of imperfect nucleic acid helices. II. Small hairpin loops

Physical studies of enzymically synthesized oligonucleotides of defined sequence are used to evaluate quantitatively the stability of small RNA hairpin loops and helices. The series (Ap)₄G(pC) _N(pU)₄, N = 4, 5 or 6, exists as monomolecular hairpin helices when N ≥ 5, and as imperfect dimer helices when N ≤ 4. In this size range, hairpin loops become more favorable (less destabilizing thermodynamically) as they increase in size from 3 to 4 to 5 unbonded nucleotides. Very small hairpin loops are particularly destabilizing; molecules whose base sequence would imply a hairpin loop of three nucleotides will generally exist with a loop of five, including a broken terminal base pair.Thermodynamic parameters for base pair and loop formation are calculated by a method which makes unnecessary the use of measured enthalpies of polynucleotide melting. Literature data on oligonucleotide double helices yield estimates of the free energy contribution from each of the six types of stacking interactions between three possible neighboring base pairs. The advantage of this approach is that the properties of oligonucleotides are used in predicting the stability of small RNA helices, avoiding the long extrapolation from the properties of high polymers.We provide Tables of temperature-dependent free energies that allow one to predict the stability and thermal transition temperature of many simple RNA secondary structures (applicable to ~1 m-Na⁺ concentration). As an example, we apply the rules to an isolated fragment of tRNA^Ser (yeast) (Coutts, 1971), whose properties were not used in calculating the free-energy parameters. The experimental melting temperature of 88 °C is predicted with an error margin of 5 deg. C.     

Length-dependent formation of parallel-stranded DNA in alternating AT segments

Parallel-stranded DNA can be formed from alternating AT segments and is not restricted exclusively to homooligomeric AT sequences. DNA oligonucleotides 3'-d(AT)nxC4(AT)n-3' (where x indicates the location of the 5'-5' phosphodiester linkage) form parallel-stranded hairpin structures at micromolar strand concentration for n = 4 or 5 but not for n = 6, 7. The spectral properties of the parallel-stranded structures are similar to those of the hairpin structures containing homooligomeric AT stems. However, parallel-stranded structures formed in alternating AT segments are significantly less stable than either their corresponding antiparallel control or the homooligomeric parallel AT hairpins as evidenced by their lower helix-coil transition enthalpy, melting temperature, and stability constant. This results in a remarkable polymorphism which is most pronounced for 3'-d(AT)5xC4(AT)5-3'. This oligonucleotide can exist as a parallel-stranded hairpin, coil, or concatameric antiparallel structure(s), depending on temperature and strand concentration. These results suggest simple guidelines for the design of parallel-stranded DNA. In addition, we present a model for the assessment of the stability of parallel-stranded duplex structures formed from AT base pairs based on their sequence.     

Duplex-hairpin transitions in DNA: NMR studies on CGCGTATACGCG.

Two dimensional NMR methods have been used to assign proton resonances in the high salt (greater than or equal to 100mM Na+), low temperature duplex form of the self-complementary DNA dodecamer d(CGCGTATACGCG). At low salt (less than or equal to 10mM Na+) and higher temperature marked changes in the two-dimensional spectrum, and in the one-dimensional spectrum reported by others, indicate that the molecule converts to an alternate conformation. Using saturation transfer methods, many of the resonances of this new conformation have been assigned, and the kinetics of the interconversion of the two forms has been studied. The linewidth, correlation time, and concentration dependence of the formation of this alternate conformation support the idea that it is a unimolecular hairpin. Observation of chemical shifts and NOEs in the hairpin conformation allow some preliminary structural characterization. Examination of the energetics of the interconversion suggests that the exchange between forms does not proceed through a single stranded intermediate, but rather through another pathway, probably involving a cruciform structure.     

Influence of N6-methylation of residue A(5) on the conformational behaviour of d(C-C-G-A-A-T-T-C-G-G) in solution studied by 1H-NMR spectroscopy. 2. The hairpin form

The solution conformations of the oligonucleotides d(C-C-G-A-A-T-T-C-G-G) and d(C-C-G-A-m6A-T-T-C-G-G) as a function of temperature and sample concentration were investigated by means of 1H-NMR spectroscopy. The NMR spectra revealed that, at certain combinations of temperature and low sample and salt concentration, both compounds exist as a B-DNA-type duplex slowly (on the 1H-NMR time scale) interconverting with a monomeric species. From chemical shift data and imino-proton spectra, it is concluded that the monomeric species consists of a mixture of a hairpin form in rapid equilibrium with the random-coil form. The double-helical stem of the hairpin is formed by the six terminal cytidine and guanine residues, whereas the four core residues, -A-(m6)A-T-T-, partake in the loop. Thermodynamic analysis of the chemical shift of the resonances of the monomeric species vs temperature profiles of the two decamers and mutual comparison of these profiles indicate the following: the influence of N6-methylation of residue A(5) upon the local structure of the hairpin must be small; methylation decreases the stability of the duplex relative to the monomeric species: the temperature at which the fraction duplex equals 0.5 was found to be 312 K for the parent compound and 305 K for the methylated decamer at 2 mM sample concentration; methylation does not significantly alter the stability of the hairpin form relative to the random coil form: the Tm of the hairp----n equilibrium random-coil equilibrium is 308 K for the parent compound and 306 K for the methylated decamer. A higher fraction hairpin-like structure for the N6-methylated compound is observed under identical conditions of temperature and sample concentration: at 300 K, 2 mM sample concentration, the fraction hairpin form is 0.12 for d(C-C-G-A-A-T-T-C-G-G) and 0.20 for d(C-C-G-A-m6A-T-T-C-G-G). This finding appears to be a consequence of the reduced stability of the methylated dimeric species relative to the monomeric species, and to depend upon the sodium-ion concentration: it becomes more pronounced under low-salt conditions.     

The purine-rich trinucleotide repeat sequences d(CAG)15 and d(GAC)15 form hairpins.

The structures of single-stranded (ss) oligonucleotides containing (CAG)15 [ss(CAG)15] or (GAC)15 [ss(GAC)15] were examined. At 10 degrees C, the electrophoretic mobilites of the two DNAs were similar to ss(CTG)15, a DNA that forms a hairpin containing base paired and/or stacked thymines. At 37 degrees C in 50 mM NaCl, single-strand-specific P1 nuclease cleaved the G33-G36 phosphodiesters of ss(GAC)15, and the G32-A34, G35-C36 phosphodiesters of ss(CAG)15 (where the loop apex of both DNAs = A34). Electrophoretic mobility melting profiles indicated that the melting temperature (Tm) of ss(CAG)15 in low (approximately 1 mM Na+) ionic strength was 38 degrees C. In contrast, the Tm of ss(GAC)15 was 49 degrees C, a value similar to the Tm of ss(CTG)15. These results provide evidence that ss(GAC)15 and ss(CAG)15 form similar, but distinguishable hairpin structures.     

Proton exchange and base pair opening in a DNA triple helix

Nuclear magnetic resonance spectroscopy has been used to characterize opening reactions and stabilities of individual base pairs in two related DNA structures. The first is the triplex structure formed by the DNA 31-mer 5'-AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT-3'. The structure belongs to the YRY (or parallel) family of triple helices. The second structure is the hairpin double helix formed by the DNA 20-mer 5'-AGAGAGAACCCCTTCTCTCT-3' and corresponds to the duplex part of the YRY triplex. The rates of exchange of imino protons with solvent in the two structures have been measured by magnetization transfer from water and by real-time exchange at 10 degrees C in 100 mM NaCl and 5 mM MgCl2 at pH 5.5 and in the presence of two exchange catalysts. The results indicate that the exchange of imino protons in protonated cytosines is most likely limited by the opening of Hoogsteen C+G base pairs. The base pair opening parameters estimated from imino proton exchange rates suggest that the stability of individual Hoogsteen base pairs in the DNA triplex is comparable to that of Watson-Crick base pairs in double-helical DNA. In the triplex structure, the exchange rates of imino protons in Watson-Crick base pairs are up to 5000-fold lower than those in double-helical DNA. This result suggests that formation of the triplex structure enhances the stability of Watson-Crick base pairs by up to 5 kcal/mol. This stabilization depends on the specific location of each triad in the triplex structure.