Synthesis of 2'-end-modified 2'-5'-oligoadenylates

Analogs of 2'5'-oligiadenylates (2-5As) have been prepared on the basis of the recently developed internucleotide-linkage formation via selective hydroxyl activation of N-unprotected nucleosides. The analogs synthesized include the trimeric cores having 2'-deoxyadenosine, cordycepin (3'-deoxyadenosine), and 2',3'-bisdeoxyadenosine at the 2' termini, and the tetramer with 2'-end 2'-deoxyadenosine.     

Preparation of 2'-deoxyribonucleosides with an identically 2H/13C-labeled sugar residue.

Thymidine with the stereoselectively 2H/13C-Labeled sugar moiety, (2'R)(5'S)-[1',2',3',4',5'-(13)C5;2',5'-(2)H2]-thymidine, was synthesized from uniformly 13C-labeled glucose, via the selectively deuterated ribose derivative prepared by the stereo-controlled deuteride transfer reactions. The labeled sugar moiety of the thymidine was then transferred to 2'-deoxyadenosine, 2'-deoxyguanosine, and 2'-deoxyuridine, by the enzymatic transglycosylation reactions by purine and pyrimidine nucleoside phosphorylases, in good yields. Labeled 2'-deoxyuridine was chemically converted to 2'-deoxycytidine. Consequently, all of the 2'-deoxynucleosides prepared by this method has the identically labeled sugar moiety. By using DNA oligomers containing the identically labeled sugar residue for NMR studies, any possible complexity in NMR data analyses expected to be observed for DNA oligomers containing variously labeled nucleosides can be minimized.     

Chemical synthesis and biological characterization of phosphorothioate analogs of 2', 5'-3'-deoxyadenylate trimer.

In continued studies to elucidate the requirements for binding to and activation of the 2',5'-oligoadenylate (2-5A) dependent endoribonuclease (RNase L), four 2-5A trimer analogs were examined to evaluate the effect of chirality of phosphorothioate substitution on biological activity. The chemical syntheses and purification of the four isomers of P-thio-3'-deoxyadenylyl-(2'-5')-P-thio-3'- deoxyadenylyl-(2'-5')-3'-deoxyadenosine, by the phosphoramidite approach, is described. The isolated intermediates were characterized by elemental and spectral analyses. The fully deblocked compounds were characterized by 1H and 31P NMR and HPLC analyses. The 2',5'-(3'dA)3 cores with either Rp or Sp chirality in the 2',5'-internucleotide linkages will bind to but will not activate RNase L. This is in contrast to 2',5'-A3 core analogs with either RpRp or SpRp phosphorothioate substitution in the 2',5'-internucleotide linkages which can bind to and activate RNase L. There are also marked differences in the ability of the 2',5'-A3 analogs to activate RNase L following introduction of the 5'-monophosphate. For example, the 5'monophosphates of 2',5'-(3'dA)3-RpRp and 2',5'-(3'dA)3-SpRp can bind to and activate RNase L, whereas the 5'-monophosphates of 2',5'-(3'dA)3-RpSp and 2',5'-(3'dA)3-SpSp can bind to but can not activate RNase L.     

Synthesis of 5'-functionalized nucleosides: S-Adenosylhomocysteine analogues with the carbon-5' and sulfur atoms replaced by a vinyl or halovinyl unit

Adenosine and uridine analogues functionalized with alkenyl or fluoroalkenyl chain at C5' were prepared employing cross-metathesis, Negishi couplings, and Wittig reactions. Metathesis of the protected 5'-deoxy-5'-methyleneadenosine or uridine analogues with six-carbon amino acids (homoallylglycines) in the presence of Grubbs catalysts gave nucleoside analogues with the C5'-C6' double bond. Alternatively, the Pd-catalyzed cross-coupling between the protected 5'-deoxy-5'-(iodomethylene) nucleosides and suitable alkylzinc bromides also provided analogues with alkenyl unit. Stereoselective Pd-catalyzed monoalkylation of 5'-(bromofluoromethylene)-5'-deoxyadenosine with alkylzinc bromides afforded adenosylhomocysteine analogues with a 6'-(fluoro)vinyl motif. The vinylic adenine nucleosides produced time-dependent inactivation of the S-adenosyl-l-homocysteine hydrolases.     

Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation

Previous experiments have identified numerous RNA ligase deoxyribozymes, each of which can synthesize either 2',5'-branched RNA, linear 2'-5'-linked RNA, or linear 3'-5'-linked RNA. These products may be formed by reaction of a 2'-hydroxyl or 3'-hydroxyl of one RNA substrate with the 5'-triphosphate of a second RNA substrate. Here the inherent propensities for nucleophilic reactivity of specific hydroxyl groups were assessed using RNA substrates related to the natural sequences of spliceosome substrates and group II introns. With the spliceosome substrates, nearly half of the selected deoxyribozymes mediate a ligation reaction involving the natural branch-point adenosine as the nucleophile. In contrast, mostly linear RNA is obtained with the group II intron substrates. Because the two sets of substrates differ at only three nucleotides, we conclude that the location of the newly created ligation junction in DNA-catalyzed branch formation depends sensitively on the RNA substrate sequences. During the experiment that led primarily to branched RNA, we abruptly altered the selection strategy to demand that the deoxyribozymes create linear 3'-5' linkages by introducing an additional selection step involving the 3'-5'-selective 8-17 deoxyribozyme. Although no 3'-5' linkages (相似文献   

Montmorillonite,Oligonucleotides, RNA and Origin of Life

Na-montmorillonite prepared from Volclay by the titration method facilitates the self-condensation of ImpA, the 5'-phosphorimidazolide derivative of adenosine. As was shown by AE-HPLC analysis and selective enzymatic hydrolysis of products, oligo(A)s formed in this reaction are 10 monomer units long and contain 67% 3',5'-phosphodiester bonds (Ferris and Ertem, 1992a). Under the same reaction conditions, 5'-phosphorimidazolide derivatives of cytidine, uridine and guanosine also undergo self-condensation producing oligomers containing up to 12-14 monomer units for oligo(C)s to 6 monomer units for oligo(G)s. In oligo(C)s and oligo(U)s, 75-80% of the monomers are linked by 2',5'-phosphodiester bonds. Hexamer and higher oligomers isolated from synthetic oligo(C)s formed by montmorillonite catalysis, which contain both 3',5'- and 2',5'-linkages, serve as catalysts for the non-enzymatic template directed synthesis of oligo(G)s from activated monomer 2-MeImpG, guanosine 5'-phospho-2-methylimidazolide (Ertem and Ferris, 1996). Pentamer and higher oligomers containing exclusively 2',5'-linkages, which were isolated from the synthetic oligo(C)s, also serve as templates and produce oligo(G)s with both 2',5'- and 3',5'-phosphodiester bonds. Kinetic studies on montmorillonite catalyzed elongation rates of oligomers using the computer program SIMFIT demonstrated that the rate constants for the formation of oligo(A)s increased in the order of 2-mer < 3-mer < 4-mer ... < 7-mer (Kawamura and Ferris, 1994). A decameric primer, dA(pdA)8pA bound to montmorillonite was elongated to contain up to 50 monomer units by daily addition of activated monomer ImpA to the reaction mixture (Ferris, Hill and Orgel, 1996). Analysis of dimer fractions formed in the montmorillonite catalyzed reaction of binary and quaternary mixtures of ImpA, ImpC, 2-MeImpG and ImpU suggested that only a limited number of oligomers could have formed on the primitive Earth rather than equal amounts of all possible isomers (Ertem and Ferris, 2000). Formation of phosphodiester bonds between mononucleotides by montmorillonite catalysis is a fascinating discovery, and a significant step forward in efforts to find out how the first RNA-like oligomers might have formed in the course of chemical evolution. However, as has been pointed out in several publications, these systems should be regarded as models rather than a literal representation of prebiotic chemistry (Orgel, 1998; Joyce and Orgel, 1999; Schwartz, 1999).     

Radiation chemistry of a dinucleoside monophosphate and its sequence isomer

A combination of high-performance liquid chromatography (HPLC) and nuclear magnetic resonance (NMR) spectroscopy was used to analyze the products of X-irradiated aqueous solutions of the dinucleoside monophosphate thymidylyl(3'-5')-2'-deoxyadenosine, d(TpA), and its sequence isomer 2'-deoxyadenylyl(3'-5')thymidine, d(ApT). The products of d(TpA) include both bases and nucleotides and a variety of thymine modifications of d(TpA) including the two cis and two trans glycol stereoisomers, two cis monohydroxy derivatives, an N-formamide derivative, and the hydroxymethyl derivative. Attention is focused on using NMR spectral features to distinguish among the various stereoisomers. The radiation chemistry of d(ApT) is also explored and differences in product formation compared with d(TpA) are described, particularly the formation of two products involving modification of adenine base. The potential of the HPLC-NMR approach to the study of radiation chemistry in DNA model compounds is discussed.     

Non-enzymatic template-directed synthesis on RNA random copolymers. Poly(C, U) templates

Poly(C, U) random copolymer templates direct the oligomerization of 2-MeImpG and 2-MeImpA, resulting in the production of a variety of oligo/(G,A)s. The efficiency of monomer incorporation into newly synthesized oligomers is greater for 2-MeImpG than for 2-MeImpA, and decreases for both monomers as the uracil content of the template increases. The relatively poor incorporation of adenine is partly due to an intrinsically less efficient incorporation reaction, and partly due to the masking of uracil sites by G X U non-complementary pairing. The efficiency of adenine incorporation can be improved by decreasing the concentration of 2-MeImpG and increasing the concentration of 2-MeImpA in the reaction mixture. The oligomeric product distribution can be characterized in detail using high-pressure liquid chromatography on an RPC-5 column. Oligomers are separated on the basis of chain length, base composition, and phospho-diester-linkage isomerism. The 3'----5' regiospecificity of monomer addition to template-bound oligomers is lower for 2-MeImpA than for 2-MeImpG. The presence of an adenine residue at the 2'(3') terminus of the acceptor strand lowers the regiospecificity of 2-MeImpA addition even further.     

New dinucleoside analogues via cross-coupling metathesis

Synthesis of 3'-3', 5-5', and 3'-5' dimeric thymidine, linked by an olefinic chain between glycosidic moieties is described. Cross metathesis reaction of 3' or 5' O-allyl analogues of thymidine led to the expected 3'-3' and 5'-5' dimeric compounds, respectively. In order to obtain the 3'-5' dimer, 5'-O-allyl and 3'-O-allyl monomers were first linked by their free 3' OH and 5' OH groups through a glutaryl spacer; ring closing metathesis was then operated upon this temporary dimer, followed by glutaryl removal.     

Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups.

Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates.     

Cordycepin analogs of ppp5'A2'p5'A2'p5'A (2-5A) inhibit protein synthesis through activation of the 2-5A-dependent endonuclease

Analogs of the triphosphate 2'-5'-linked adenylate trimer (ppp5'A2'p5'A2'p5'A, called 2-5A) which contain 3'-deoxyadenosine (cordycepin) instead of adenosine either in positions one and two, or in all three positions, are 10-100-fold less potent than is parent 2-5A in inhibition of protein synthesis in intact cells, when utilizing calcium co-precipitation techniques to introduce the 5'-triphosphate oligonucleotides into the cells. That the inhibition of protein synthesis was a consequence of activation of the 2-5A-dependent endonuclease by the 3'-deoxyadenosine analogs of 2-5A was demonstrated in obtaining the ribosomal RNA cleavage pattern that is characteristic of endonuclease activation by parent 2-5A. Additional results (i.e. lack of activity by the dimer species ppp5'(3'dA)2'p5'-(3'dA) or the monomer 3'dA) as well as kinetic analysis both in intact cells and in cell-free extracts provided further evidence that the inhibition of protein synthesis observed with these 3'-deoxyadenosine 2-5A analogs was not due to their degradation to the antimetabolite monomer unit 3'-deoxyadenosine.     

Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages

We report Zn(2+)-dependent deoxyribozymes that ligate RNA. The DNA enzymes were identified by in vitro selection and ligate RNA with k(obs) up to 0.5 min(-)(1) at 1 mM Zn(2+) and 23 degrees C, pH 7.9, which is substantially faster than our previously reported Mg(2+)-dependent deoxyribozymes. Each new Zn(2+)-dependent deoxyribozyme mediates the reaction of a specific nucleophile on one RNA substrate with a 2',3'-cyclic phosphate on a second RNA substrate. Some of the Zn(2+)-dependent deoxyribozymes create native 3'-5' RNA linkages (with k(obs) up to 0.02 min(-)(1)), whereas all of our previous Mg(2+)-dependent deoxyribozymes that use a 2',3'-cyclic phosphate create non-native 2'-5' RNA linkages. On this basis, Zn(2+)-dependent deoxyribozymes have promise for synthesis of native 3'-5'-linked RNA using 2',3'-cyclic phosphate RNA substrates, although these particular Zn(2+)-dependent deoxyribozymes are likely not useful for this practical application. Some of the new Zn(2+)-dependent deoxyribozymes instead create non-native 2'-5' linkages, just like their Mg(2+) counterparts. Unexpectedly, other Zn(2+)-dependent deoxyribozymes synthesize one of three unnatural linkages that are formed upon the reaction of an RNA nucleophile other than a 5'-hydroxyl group. Two of these unnatural linkages are the 3'-2' and 2'-2' linear junctions created when the 2'-hydroxyl of the 5'-terminal guanosine of one RNA substrate attacks the 2',3'-cyclic phosphate of the second RNA substrate. The third unnatural linkage is a branched RNA that results from attack of a specific internal 2'-hydroxyl of one RNA substrate at the 2',3'-cyclic phosphate. When compared with the consistent creation of 2'-5' linkages by Mg(2+)-dependent ligation, formation of this variety of RNA ligation products by Zn(2+)-dependent deoxyribozymes highlights the versatility of transition metals such as Zn(2+) for mediating nucleic acid catalysis.     

Incorporation of alpha- and beta-LNA (locked nucleic acid) monomers in oligodeoxynucleotides with polarity reversals.

The thymidine monomers of LNA with both alpha- and beta-configuration are incorporated with polarity reversals (i.e., with 3'-3' and 5'-5' junctions) in oligodeoxynucleotides with beta- and alpha-configuration, respectively. A 5'-O-phosphoramidite of the beta-LNA monomer is synthesised. Large destabilisations of duplexes with both complementary DNA and RNA are observed for oligodeoxynucleotides containing the alpha-LNA monomer, whereas a duplex with complementary RNA of an alpha-oligodeoxynucleotide containing the beta-LNA monomer is not destabilised.     

Design, synthesis, and antiviral evaluation of some 3'-carboxymethyl-3'-deoxyadenosine derivatives

3'-Carboxymethyl-3'-deoxyadenosine derivatives were prepared from 2'-O-TBDMS-3'-[(ethoxycarbonyl)methyl]-3'-deoxyadenosine (1) via simple and efficient procedures. Conversion of 1 to its 5'-azido-5'-deoxy derivative 5 was accomplished via a novel one-pot method employing 5'-activation (TosCl) followed by efficient nucleophilic displacement with tetramethylguanidinium azide. Compound 5 was converted to 5'-[(N-methylcarbamoyl)amino] derivative 8 via one-pot reduction/acylation employing H(2)/Pd-C followed by treatment with p-nitrophenyl N-methylcarbamate. N(6)-phenylcarbamoyl groups were introduced by treatment with phenylisocyanate, and an efficient new method for lactonization of 2'-O-TBDMS-3'-[(ethoxycarbonyl)methyl]-3'-deoxyadenosines to give corresponding 2',3'-lactones was also developed. Target compounds were evaluated for anti-HIV and anti-HIV integrase activities, but were not active at the concentrations tested.     

A convenient synthesis of adenylyl-(2'----5')-adenylyl-(2'----5')-adenosine (2-5A core)

A simple synthesis of adenylyl-(2'----5')-adenylyl (2'----5')-adenosine (2-5A core) has been achieved on the basis of selective 3'-O-silylation of 5'-O-p-monomethoxytrityladenosine and chemo-selective formation of the 2'-5' internucleotide linkage using N-unprotected nucleosides.     

3'-Deoxy-3'-fluoro analogs of core trimers of 2-5A: effect on lytic activity of human NK-lymphocytes]

The effect of core trimers, (2'-5')-analogues of oligoadenylic acid containing 9-(3-deoxy-3-fluoro-beta-D-xylofuranosyl)adenine (AF) and 3'-deoxy-3'-fluoroadenosine (AF) in various positions of the oligomer chain, on the lytic activity of human natural killer cells (NK cells) was studied in three different ways. The cellular cytotoxicity was determined using a highly sensitive nonradioactive approach employing a chelate europium-diethylenetriamino-pentaacetic acid complex (Eu-DTPA). It was shown that all fluorodeoxyanalogues enhance the lytic activity of intact NK lymphocytes, which follows from the lysis rate constant k2. At the same time, the substitution of either the central adenosine fragment or (to a greater extent) the 5'-terminal residue of (2'-5')A3 with AF causes a decrease in the number of active NK cells, which, unlike the case of the natural core trimer, leads to a loss of the capacity to increase the activity of NK. By contrast, isomeric ribo-analogues. (2'-5')(AF)A2 and (2'-5')A(AF)A, and trimers with the 2'(3')-terminal nucleotide substituted by AF or AF increased the activity of NK cells with an effectiveness close to or higher than the natural trimer (2'-5')A3. Inasmuch as isomeric xylo- and ribo-3'-deoxy-3'-fluoroanalogues of (2'-5')A3 are stereochemically modified oligomers, the data unambiguously suggest that the spatial structure of these trimers affects the increase in the lytic activity of NK cells.     

Non-enzymatic, template-directed ligation of 2'-5' oligoribonucleotides. Joining of a template and a ligator strand.

Decauridylate containing exclusively a 2'-5' phospho-diester bond ([2'-5']U10) served as a template for the synthesis of oligoadenylates [oligo(A)s] from the 5'-phosphorimidazolide of 2'-5' diadenylate (ImpA-2'p5'A). Joining of [2'-5']U10and ImpA2'p5'A also took place in substantial amounts to yield long-chain oligoribonucleotides in the template-directed reaction. An unusual CD spectrum ascribed to helix formation between [2'-5']U10and [2'-5'](pA)2was observed under the same conditions as that of the template-directed reaction. The 3'-5' linked decauridylate ([3'-5']U10) also promoted the template-directed synthesis of oligo(A)s from ImpA2'p5'A, but more slowly compared with [2'-5']U10. The results indicate that short-chain RNA oligomers with a 2'-5' phosphodiester bond could lead to longer oligoribonucleotides by template-directed chain elongation.     

Chemical synthesis of DNA oligomers containing cytosine arabinoside.

The solid phase phospite triester synthesis of oligodeoxynucleotides containing cytosine arabinoside (araC) is described. A protected araC phosphoramadite was prepared for the introduction of araC residues at 5'termini and internucleotide positions in DNA oligomers. These oligomers were utilized to demonstrate the formation of correct 3'-5' linkages, to test for alkaline lability at the araC site, and to study the stability of duplexes containing araC-G base pairs. For the introduction of araC residues at 3' terminal positions, a protected derivative of araC was coupled to functionalized silica. This material was used to prepare a test oligomer which was characterized enzymatically.     

Effects of 8-chlorodeoxyadenosine on DNA synthesis by the Klenow fragment of DNA polymerase I

8-chloro-2'-deoxyadenosine (8-Cl-dAdo) was incorporated into synthetic DNA oligonucleotides to determine its effects on DNA synthesis by the 3'-5' exonuclease-free Klenow fragment of Escherichia coli DNA Polymerase I (KF-). Single nucleotide insertion experiments were used to determine the coding potential of 8-Cl-dAdo in a DNA template. KF- inserted TTP opposite 8-Cl-dAdo in the template, but with decreased efficiency relative to natural deoxyadenosine. Running-start primer extensions with KF- resulted in polymerase pausing at 8-Cl-dAdo template sites during DNA synthesis. The 2'-deoxyribonucleoside triphosphate analogue, 8-Cl-dATP, was incorporated opposite thymidine (T) approximately two-fold less efficiently than dATP.     

Activation of ribonuclease L by (2'-5')(A)4-poly(L-lysine) conjugates in intact cells

Molecular hybrids were synthesized by coupling (2'-5')(A)n oligoadenylates or 2-5A, an intracellular mediator involved in antiviral activity of interferons (IFNs), with poly(L-lysine) used as a membrane carrier. (2'-5')(A)n in its free form was not taken up by cells, probably because of its ionic character. Conjugation with the polypeptide carrier overcame this problem and enabled its pharmacological properties to be developed. The alpha-glycol group of individual (2'-5')(A)n oligomers was oxidized by periodate oxidation and conjugated by an amino reductive reaction to poly(L-lysine), Mr 14 000, in a molar ratio of 5:1. These hybrid molecules left the biologically active 5' end moiety of the (2'-5')(A)n molecule unchanged, and in particular its triphosphate group, and stabilized the molecule by increasing its resistance to phosphodiesterase hydrolysis. A dose-dependent inhibition of virus growth was observed on concomitant incubation of (2'-5')(A)n-poly(L-lysine) conjugates with vesicular stomatitis virus infected L1210 cell cultures. This was a result of the activation of the (2'-5')(A)n-dependent endoribonuclease (RNase L) by intracellularly delivered (2'-5')(A)n as in some IFN-treated virus-infected cells. Indeed, (2'-5')(A)n-poly(L-lysine) conjugates bind RNase L effectively as can be seen from their ability to compete with authentic (2'-5')(A)n in a cell-free radiobinding assay. Moreover, (2'-5')(A)n-poly(L-lysine) conjugates promote transient inhibition of protein synthesis and a characteristic cleavage pattern of ribosomal RNAs in intact cells.(ABSTRACT TRUNCATED AT 250 WORDS)