Sequence-dependent variation in DNA minor groove width dictates orientational preference of Hoechst 33258 in A-tract recognition: solution NMR structure of the 2:1 complex with d(CTTTTGCAAAAG)(2)

The solution structure of the dodecamer duplex d(CTTTTGCAAAAG)₂ and its 2:1 complex with the bis-benzimidazole Hoechst 33258 has been investigated by NMR and NOE-restrained molecular dynamics (rMD) simulations. Drug molecules are bound in each of the two A-tracts with the bulky N-methylpiperazine ring of each drug located close to the central TG (CA) step, binding essentially to the narrow minor groove of each A-tract. MD simulations over 1 ns, using an explicit solvation model, reveal time-averaged sequence-dependent narrowing of the minor groove from the 3′-end towards the 5′-end of each TTTT sequence. Distinct junctions at the TpG (CpA) steps, characterised by large positive roll, low helical and propeller twists and rapid AT base pair opening rates, add to the widening of the groove at these sites and appear to account for the bound orientation of the two drug molecules with the N-methylpiperazine ring binding in the wider part of the groove close to the junctions. Comparisons between the free DNA structure and the 2:1 complex (heavy atom RMSD 1.55 Å) reveal that these sequence-dependent features persist in both structures. NMR studies of the sequence d(GAAAAGCTTTTC)₂, in which the A-tracts have been inverted with the elimination of the TpG junctions, results in loss of orientational specificity of Hoechst 33258 and formation of multiple bound species in solution, consistent with the drug binding in a number of different orientations.     

Structural insights into the effect of hydration and ions on A-tract DNA: a molecular dynamics study

DNA structure is known to be sensitive to hydration and ionic environment. To explore the dynamics, hydration, and ion binding features of A-tract sequences, a 7-ns Molecular dynamics (MD) study has been performed on the dodecamer d(CGCAAATTTGCG)(2). The results suggest that the intrusion of Na(+) ion into the minor groove is a rare event and the structure of this dodecamer is not very sensitive to the location of the sodium ions. The prolonged MD simulation successfully leads to the formation of sequence dependent hydration patterns in the minor groove, often called spine of hydration near the A-rich region and ribbon of hydration near the GC regions. Such sequence dependent differences in the hydration patterns have been seen earlier in the high resolution crystal structure of the Drew-Dickerson sequence, but not reported for the medium resolution structures (2.0 approximately 3.0 A). Several water molecules are also seen in the major groove of the MD simulated structure, though they are not highly ordered over the extended MD. The characteristic narrowing of the minor groove in the A-tract region is seen to precede the formation of the spine of hydration. Finally, the occurrence of cross-strand C2-H2.O2 hydrogen bonds in the minor groove of A-tract sequences is confirmed. These are found to occur even before the narrowing of the minor groove, indicating that such interactions are an intrinsic feature of A-tract sequences.     

Molecular dynamics investigation of the interaction between DNA and distamycin

The complex of the minor groove binding drug distamycin and the B-DNA oligomer d-(CGCAAATTTGCG) was investigated by molecular dynamics simulations. For this purpose, accurate atomic partial charges of distamycin were determined by extended quantum chemical calculations. The complex was simulated without water but with hydrated counterions. The oligomer without the drug was simulated in the same fashion and also with 1713 water molecules and sodium counterions. The simulations revealed that the binding of distamycin in the minor groove induces a stiffening of the DNA helix. The drug also prevents a transition from B-DNA to A-DNA that was found to occur rapidly (30 ps) in the segment without bound distamycin in a water-free environment but not in simulations including water. In other simulations, we investigated the relaxation processes after distamycin was moved from its preferred binding site, either radially or along the minor groove. Binding in the major groove was simulated as well and resulted in a bound configuration with the guanidinium end of distamycin close to two phosphate groups. We suggest that, in an aqueous environment, tight hydration shells covering the DNA backbone prevent such an arrangement and thus lead to distamycin's propensity for minor groove binding.     

Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations

Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the observed water and ion atmosphere around the DNA sequences is the MD simulation is in good agreement with experimental observations.     

NMR studies of the interaction of the antibiotic nogalamycin with the hexadeoxyribonucleotide duplex d(5'-GCATGC)2

1H resonance assignments in the NMR spectra of the self-complementary hexadeoxyribonucleoside pentaphosphate d(5'-GCATGC)2 and its complex with the antibiotic nogalamycin, together with interproton distance constraints obtained from two-dimensional nuclear Overhauser effect (NOE) spectra, have enabled us to characterize the three-dimensional structure of these species in solution. In the complex described, two drug molecules are bound per duplex, in each of two equivalent binding sites, with full retention of the dyad symmetry. Twenty-eight NOE distance constraints between antibiotic and nucleotide protons define the position and orientation of the bound drug molecule. Nogalamycin intercalates at the 5'-CA and 5'-TG steps with the major axis of the anthracycline chromophore aligned approximately at right angles to the major axes of the base pairs. The nogalose sugar occupies the minor groove of the helix and makes many contacts with the deoxyribose moieties of three nucleotides along one strand of the duplex in the 5'-TGC segment. The charged dimethylamino group and hydroxyl functions of the bicyclic sugar lie in the major groove juxtaposed to the guanine base, the bridging atoms of the bicyclic sugar making contacts with the methyl group of the thymine. Thus the antibiotic is not symmetrically disposed in the intercalation site but is in close contact in both grooves with atoms comprising the 5'-TGC strand. The intercalation cavity is wedge-shaped, the major axes of the base pairs forming the site being tilted with respect to one another. All base-pair hydrogen-bonding interactions are maintained in the complex, and there is no evidence for Hoogsteen pairing. The free duplex adopts a regular right-handed B-type conformation in which all glycosidic bond angles are anti and all sugar puckers lie in the C2'-endo range. In the complex the glycosidic bond angles and the sugar puckers deviate little from those observed for the duplex alone. The presence of two bound nogalamycin molecules substantially slows the "breathing" motions of the base pairs forming the intercalation cavity, and the observation of two downfield-shifted resonances in the 31P NMR spectrum of the complex suggests a pronounced local helix unwinding at the drug binding site. The footprinting data of Fox and Waring [Fox, K.R., & Waring, M.J. (1986) Biochemistry 25, 4349-4356] imply that the highest affinity binding sites of nogalamycin have the sequence 5'-GCA (or 5'-TGC).(ABSTRACT TRUNCATED AT 400 WORDS)     

Long-residency hydration, cation binding, and dynamics of loop E/helix IV rRNA-L25 protein complex

Molecular dynamics simulations of RNA-protein complex between Escherichia coli loop E/helix IV (LE/HeIV) rRNA and L25 protein reveal a qualitative agreement between the experimental and simulated structures. The major groove of LE is a prominent rRNA cation-binding site. Divalent cations rigidify the LE major groove geometry whereas in the absence of divalent cations LE extensively interacts with monovalent cations via inner-shell binding. The HeIV region shows bistability of its major groove explaining the observed differences between x-ray and NMR structures. In agreement with the experiments, the simulations suggest that helix-alpha1 of L25 is the least stable part of the protein. Inclusion of Mg2+ cations into the simulations causes perturbation of basepairing at the LE/HeIV junction, which does not, however, affect the protein binding. The rRNA-protein complex is mediated by a number of highly specific hydration sites with long-residing water molecules and two of them are bound throughout the entire 24-ns simulation. Long-residing water molecules are seen also outside the RNA-protein contact areas with water-binding times substantially enhanced compared to simulations of free RNA. Long-residency hydration sites thus represent important elements of the three-dimensional structure of rRNA.     

Molecular dynamics simulations of DNA in solutions with different counter-ions

Molecular dynamics simulations of the [d(ATGCAGTCAG]2 fragment of DNA, in water and in the presence of three different counter-ions (Li+, Na+ and Cs+) are reported. Three-dimensional hydration structure and ion distribution have been calculated using spatial distribution functions for a detailed picture of local concentrations of ions and water molecules around DNA. According to the simulations, Cs+ ions bind directly to the bases in the minor groove, Na+ ions bind prevailing to the bases in the minor groove through one water molecule, whereas Li+ ions bind directly to the phosphate oxygens. The different behavior of the counter-ions is explained by specific hydration structures around the DNA and the ions. It is proposed how the observed differences in the ion binding to DNA may explain different conformational behavior of DNA. Calculated self-diffusion coefficients for the ions agree well with the available NMR data.     

Anthracycline antibiotic arugomycin binds in both grooves of the DNA helix simultaneously: an NMR and molecular modelling study.

Perturbations to the 1H and 31P chemical shifts of DNA resonances together with twenty-four intermolecular nuclear Overhauser effects show that the anthracycline antibiotic arugomycin intercalates between the basepairs of the hexamer duplex d(5'-GCATGC)2 at the 5'-CpA and 5'-TpG binding sites. In the complex two drug molecules are bound per duplex with full retention of the dyad symmetry. Arugomycin adopts a threaded binding orientation with chains of sugars positioned in both the major and minor groove of the helix simultaneously. The complex is stabilized by hydrogen bonding, electrostatic and van der Waals interactions principally in the major groove and involving substituents on the rigidly oriented bicycloamino-glucose sugar of the antibiotic. A specific hydrogen bond is identified between the C2'-hydroxyl and the guanine N7 at the intercalation site. Together, interactions in the major groove appear to account for the intercalation specificity of arugomycin that requires both a guanine and thymine at the intercalation site. We are unable to identify any sequence specific interactions between the minor groove and the arugarose sugar (S1) which binds only weakly, through van der Walls contacts, over the d(GCA).d(TGC) trinucleotide sequence. The data indicate that the sugar chains of arugomycin are flexible and play little part in the interaction of the antibiotic with DNA. The intensity of sequential internucleotide NOEs identifies the intercalation site as being assymmetric. A family of conformers computed using restrained energy minimisation and molecular dynamics indicate that basepair buckling is a feature of the anthracycline intercalation site that may serve to maximise intermolecular van der Waals interactions by wrapping the basepairs around the antibiotic chromophore.     

DNA-drug interactions. The crystal structures of d(TGTACA) and d(TGATCA) complexed with daunomycin

The anticancer drug daunomycin has been co-crystallized with the hexanucleotide duplex sequences d(TGTACA) and d(TGATCA) and single crystal X-ray diffraction studies of these two complexes have been carried out. Structure solution of the d(TGTACA) and d(TGATCA) complexes to 1.6 and 1.7 Angstrom resolution, respectively, shows two daunomycin molecules bound to the DNA hexamer. Binding occurs via intercalation of the drug chromophore at the d(TpG) step, and hydrogen bonding interactions involving the drug, DNA and solvent molecules. The daunomycin sugar is located in the minor groove of the DNA hexamer and is stabilized by hydrogen bonds between the amino group of the sugar and functional groups on the floor of the groove. The amino sugar of the d(TGATCA) duplex interacts directly with the DNA sequence, while in the d(TGTACA) duplex, the interaction is via solvent molecules. Two other complexes d(CGTACG)-daunomycin and d(CGATCG)-daunomycin have previously been structurally characterized. Comparison of the four structures with daunomycin bound to the triplet sequences 5'TGT, 5'TGA, 5'CGT and 5'CGA reveals changes in the conformation of both the DNA hexamer and the daunomycin upon complexation, as well as the hydrogen bonding and van der Waals' interactions.     

A molecular dynamics simulation study of an aminoglycoside/A-site RNA complex: conformational and hydration patterns

Aminoglycoside antibiotics interfere with the translation mechanism by binding to the tRNA decoding site of the 16S ribosomal RNA. Crystallographic structures of aminoglycosides bound to A-site systems clarified many static aspects of RNA-ligand interactions. To gain some insight on the dynamic aspects of recognition phenomena, we conducted molecular dynamics simulations of the aminoglycoside paromomycin bound to a eubacterial ribosomal decoding A-site oligonucleotide. Results from 25 ns of simulation time revealed that: (i) the neamine part of the antibiotic represents the main anchor for binding, (ii) additional sugar rings provide limited and fragile contacts, (iii) long-resident water molecules present at the drug/RNA interface are involved in the recognition phenomena. The combination of MD simulations together with systematic structural information offers striking insights into the molecular recognition processes underlying RNA/aminoglycoside binding. Important methodological considerations related to the use of medium resolution starting structures and associated sampling problems are thoroughly discussed.     

Deducing hydration sites of a protein from molecular dynamics simulations

Invariant water molecules that are of structural or functional importance to proteins are detected from their presence in the same location in different crystal structures of the same protein or closely related proteins. In this study we have investigated the location of invariant water molecules from MD simulations of ribonuclease A, HIV1-protease and Hen egg white lysozyme. Snapshots of MD trajectories represent the structure of a dynamic protein molecule in a solvated environment as opposed to the static picture provided by crystallography. The MD results are compared to an analysis on crystal structures. A good correlation is observed between the two methods with more than half the hydration sites identified as invariant from crystal structures featuring as invariant in the MD simulations which include most of the functionally or structurally important residues. It is also seen that the propensities of occupying the various hydration sites on a protein for structures obtained from MD and crystallographic studies are different. In general MD simulations can be used to predict invariant hydration sites when there is a paucity of crystallographic data or to complement crystallographic results.     

An NMR and MD study of complexes of bacteriophage lambda lysozyme with tetra- and hexa-N-acetylchitohexaose

The X-ray structure of lysozyme from bacteriophage lambda (λ lysozyme) in complex with the inhibitor hexa-N-acetylchitohexaose (NAG6) (PDB: 3D3D) has been reported previously showing sugar units from two molecules of NAG6 bound in the active site. One NAG6 is bound with four sugar units in the ABCD sites and the other with two sugar units in the E′F′ sites potentially representing the cleavage reaction products; each NAG6 cross links two neighboring λ lysozyme molecules. Here we use NMR and MD simulations to study the interaction of λ lysozyme with the inhibitors NAG4 and NAG6 in solution. This allows us to study the interactions within the complex prior to cleavage of the polysaccharide. ¹H^N and ¹⁵N chemical shifts of λ lysozyme resonances were followed during NAG4/NAG6 titrations. The chemical shift changes were similar in the two titrations, consistent with sugars binding to the cleft between the upper and lower domains; the NMR data show no evidence for simultaneous binding of a NAG6 to two λ lysozyme molecules. Six 150 ns MD simulations of λ lysozyme in complex with NAG4 or NAG6 were performed starting from different conformations. The simulations with both NAG4 and NAG6 show stable binding of sugars across the D/E active site providing low energy models for the enzyme-inhibitor complexes. The MD simulations identify different binding subsites for the 5th and 6th sugars consistent with the NMR data. The structural information gained from the NMR experiments and MD simulations have been used to model the enzyme-peptidoglycan complex.     

Hydration of DNA in aqueous solution: NMR evidence for a kinetic destabilization of the minor groove hydration of d-(TTAA)2 versus d-(AATT)2 segments.

The residence times of the hydration water molecules near the base protons of d-(GTGGAATTCCAC)2 and d-(GTGGTTAACCAC)2 were investigated by nuclear magnetic resonance (NMR) spectroscopy. Nuclear Overhauser effects (NOE) were observed between base protons of the DNA and hydration water in NOESY and ROESY experiments. Large positive NOESY cross peaks observed between the resonances of the water and the adenine 2H protons of the central d-(AATT)2 segment in the duplex d-(GTGGAATTCCAC)2 indicate the presence of a 'spine of hydration' with water molecules exhibiting residence times on the DNA longer than 1 nanosecond. In contrast, no positive intermolecular NOESY cross peaks were detected in the d-(TTAA)2 segment of the duplex d-(GTGGTTAACCAC)2, indicating that no water molecules bound with similarly long residence times occur in the minor groove of this fragment. These results can be correlated with the larger width of the minor groove in d-(TTAA)2 segments as compared to that in d-(AATT)2 segments, as observed previously in single crystal structures of related oligonucleotide duplexes in B type conformation. The present experiments confirm earlier experimental results from single crystal studies and theoretical predictions that a 5'-dTA-3' step in the nucleotide sequence interrupts the spine of hydration in the minor groove.     

Water and ion binding around RNA and DNA (C,G) oligomers

The dynamics, hydration, and ion-binding features of two duplexes, the A(r(CG)(12)) and the B(d(CG)(12)), in a neutralizing aqueous environment with 0.25 M added KCl have been investigated by molecular dynamics (MD) simulations. The regular repeats of the same C=G base-pair motif have been exploited as a statistical alternative to long MD simulations in order to extend the sampling of the conformational space. The trajectories demonstrate the larger flexibility of DNA compared to RNA helices. This flexibility results in less well defined hydration patterns around the DNA than around the RNA backbone atoms. Yet, 22 hydration sites are clearly characterized around both nucleic acid structures. With additional results from MD simulations, the following hydration scale for C=G pairs can be deduced: A-DNA相似文献   

Molecular dynamics simulation study of oriented polyamine- and Na-DNA: sequence specific interactions and effects on DNA structure

Molecular dynamics (MD) computer simulations have been carried out on four systems that correspond to an infinite array of parallel ordered B-DNA, mimicking the state in oriented DNA fibers and also being relevant for crystals of B-DNA oligonucleotides. The systems were all comprised of a periodical hexagonal cell with three identical DNA decamers, 15 water molecules per nucleotide, and counterions balancing the DNA charges. The sequence of the double helical DNA decamer was d(5'-ATGCAGTCAG)xd(5'-TGACTGCATC). The counterions were the two natural polyamines spermidine(3+) (Spd(3+)) and putrescine(2+) (Put(2+)), the synthetic polyamine diaminopropane(2+) (DAP(2+)), and the simple monovalent cation Na(+). This work compares the specific structures of the polyamine- and Na-DNA systems and how they are affected by counterion interactions. It also describes sequence-specific hydration and interaction of the cations with DNA. The local DNA structure is dependent on the nature of the counterion. Even the very similar polyamines, Put(2+) and DAP(2+), show clear differences in binding to DNA and in effect on hydration and local structure. Generally, the polyamines disorder the hydration of the DNA around their binding sites whereas Na(+) being bound to DNA attracts and organizes water in its vicinity. Cation binding at the selected sites in the minor and in the major groove is compared for the different polyamines and Na(+). We conclude that the synthetic polyamine (DAP(2+)) binds specifically to several structural and sequence-specific motifs on B-DNA, unlike the natural polyamines, Spd(3+) and Put(2+). This specificity of DAP(2+) compared to the more dynamic behavior of Spd(3+) and Put(2+) may explain why the latter polyamines are naturally occurring in cells.     

A 5-nanosecond molecular dynamics trajectory for B-DNA: analysis of structure, motions, and solvation.

We report the results of four new molecular dynamics (MD) simulations on the DNA duplex of sequence d(CGCGAATTCGCG)2, including explicit consideration of solvent water, and a sufficient number of Na+ counterions to provide electroneutrality to the system. Our simulations are configured particularly to characterize the latest MD models of DNA, and to provide a basis for examining the sensitivity of MD results to the treatment of boundary conditions, electrostatics, initial placement of solvent, and run lengths. The trajectories employ the AMBER 4.1 force field. The simulations use particle mesh Ewald summation for boundary conditions, and range in length from 500 ps to 5.0 ns. Analysis of the results is carried out by means of time series for conformationalm, helicoidal parameters, newly developed indices of DNA axis bending, and groove widths. The results support a dynamically stable model of B-DNA for d(CGCGAATTCGCG)2 over the entire length of the trajectory. The MD results are compared with corresponding crystallographic and NMR studies on the d(CGCGAATTCGCG)2 duplex, and placed in the context of observed behavior of B-DNA by comparisons with the complete crystallographic data base of B-form structures. The calculated distributions of mobile solvent molecules, both water and counterions, are displayed. The calculated solvent structure of the primary solvation shell is compared with the location of ordered solvent positions in the corresponding crystal structure. The results indicate that ordered solvent positions in crystals are roughly twice as structured as bulk water. Detailed analysis of the solvent dynamics reveals evidence of the incorporation of ions in the primary solvation of the minor groove B-form DNA. The idea of localized complexation of otherwise mobile counterions in electronegative pockets in the grooves of DNA helices introduces an additional source of sequence-dependent effects on local conformational, helicoidal, and morphological structure, and may have important implications for understanding the functional energetics and specificity of the interactions of DNA and RNA with regulatory proteins, pharmaceutical agents, and other ligands.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.