Intercalation of aflatoxin B1 in two oligodeoxynucleotide adducts: comparative 1H NMR analysis of d(ATCAFBGAT).d(ATCGAT) and d(ATAFBGCAT)2

8,9-Dihydro-8-(N7-guanyl-[d(ATCGAT)])-9-hydroxyaflatoxin B1.d(ATCGAT) and 8,9-dihydro-8-(N7-guanyl-[d(ATGCAT)])-9-hydroxyaflatoxin B1.8,9-dihydro-8-(N7-guanyl-[d(ATGCAT)])-9-hydroxyaflatoxin B1 were prepared by direct addition of afltoxin B1 8,9-epoxide to d(ATCGAT)2 and d(ATGCAT)2, respectively. In contrast to reaction of aflatoxin B1 8,9-epoxide with d(ATCGAT)2 which exhibits a limiting stoichiometry of 1:1 aflatoxin B1:d(ATCGAT)2 [Gopalakrishnan, S., Stone, M. P., & Harris, T. M. (1989) J. Am. Chem. Soc. 111, 7232-7239], reaction of aflatoxin B1 8,9-epoxide with d(ATGCAT)2 exhibits a limiting stoichiometry of 2:1 aflatoxin B1:d(ATGCAT)2. 1H NOE experiments, nonselective 1H T1 relaxation measurements, and 1H chemical shift perturbations demonstrate that in both modified oligodeoxynucleotides the aflatoxin moiety is intercalated above the 5'-face of the modified guanine. The oligodeoxynucleotides remain right-handed, and perturbation of the B-DNA structure is localized adjacent to the adducted guanine. Aflatoxin-oligodeoxynucleotide 1H NOEs are observed between aflatoxin and the 5'-neighbor base pair and include both the major groove and the minor groove. The aflatoxin methoxy and cyclopentenone ring protons face into the minor groove; the furofuran ring protons face into the major groove. No NOE is observed between the imino proton of the modified base pair and the imino proton of the 5'-neighbor base pair; sequential NOEs between nucleotide base and deoxyribose protons are interrupted in both oligodeoxynucleotide strands on the 5'-side of the modified guanine. The protons at C8 and C9 of the aflatoxin terminal furan ring exhibit slower spin-lattice relaxation as compared to other oligodeoxynucleotide protons, which supports the conclusion that they face into the major groove. Increased shielding is observed for aflatoxin protons; chemical shift perturbations of the oligodeoxynucleotide protons are confined to the immediate vicinity of the adducted base pair. The imidazole proton of the modified guanine exchanges with water and is observed at 9.75 ppm. The difference in reaction stoichiometry is consistent with an intercalated transition-state complex between aflatoxin B1 8,9-epoxide and B-DNA. Insertion of aflatoxin B1-8,9 epoxide above the 5'-face of guanine in d(ATCGAT)2 would prevent the binding of a second molecule of aflatoxin B1 8,9-epoxide. In contrast, two intercalation sites would be available with d(ATGCAT)2.(ABSTRACT TRUNCATED AT 400 WORDS)     

Epimerization of benzo[a]pyrene-tetrols after acid hydrolysis, implications for determination of benzo[a]pyrene adducts in protein and DNA

Determination of benzo[a]pyrene-DNA or protein adducts with high performance liquid chromatography (HPLC) after acid hydrolysis at high temperature (90 degrees C) enables four isomers of benzo[a]pyrene tetrahydrotetrol to be identified and quantitated. We have investigated the effect of acid treatment of benzo[a]pyrene-tetrahydrotetrol isomers using HPLC and nuclear magnetic resonance spectroscopy (NMR) analysis. By HPLC, we found reversible epimerization of (+/-)-benzo[a]pyrene-r-7,t-8,9, 10-tetrahydrotetrol to (+/-)-benzo[a]pyrene-r-7,t-8,9, c-10-tetrahydrotetrol and of (+/-)-benzo[a]pyrene-r-7,t-8,c-9, t-10-tetrahydrotetrol to (+/-)-benzo[a]pyrene-r-7,t-8,c-9, 10-tetrahydrotetrol, but no interconversion between the two isomer groups. After acid hydrolysis, we found an equilibrium of 87% (+/-)-benzo[a]pyrene-r-7,t-8,9,c-10-tetrahydrotetrol and 9% (+/-)-benzo[a]pyrene-r-7,t-8,9,10-tetrahydrotetrol and 68% (+/-)-benzo[a]pyrene-r-7,t-8,c-9,10-tetrahydrotetrol and 20% (+/-)-benzo[a]pyrene-r-7,t-8,c-9,t-10-tetrahydrotetrol. Minor amounts of two unknown compounds with similar chromatographic characteristics were also found. We have established a NMR method for determination of underivatized (+/-)-benzo[a]pyrene-r-7,t-8,9, c-10-tetrahydrotetrol and (+/-)-benzo[a]pyrene-r-7,t-8,9, 10-tetrahydrotetrol confirming the epimerization of (+/-)-benzo[a]pyrene-r-7,t-8,9,10-tetrahydrotetrol to (+/-)-benzo[a]pyrene-r-7,t-8,9,c-10- tetrahydrotetrol. (+/-)-Benzo[a]pyrene-r-7,t-8,9,10-tetrahydrotetrol was treated with aqueous hydrochloric acid in tetrahydro- furan-d8 to give (+/-)-benzo[a]pyrene-r-7,t-8,9,c-10-tetrahydrotetrol at 57 degrees C while observing the 1H NMR resonances at 500 MHz. Gradient-selected correlation spectroscopy (COSY), heteronuclear multiple quantum correlation (HMQC) and heteronuclear multiple bond correlation (HMBC) experiments were performed to confirm the assignments of the aliphatic hydrogens in the product (+/-)-benzo[a]pyrene-r-7,t-8,9, c-10-terahydrotetrol. Thus, when analyzing benzo[a]pyrene-DNA or protein adducts by cleaving the adducts with acid hydrolysis, the only ratio of biological significance is between (+/-)-benzo[a]pyrene-r-7,t-8,9,c-10-tetrahydrotetrol plus (+/-)-benzo[a]pyrene-r-7,t-8,9,10-tetrahydrotetrol and (+/-)-benzo[a]pyrene-r-7,t-8,c-9,10-tetrahydrotetrol plus (+/-)-benzo[a]pyrene-r-7,t-8,c-9,t-10-tetrahydrotetrol, due to interconversion (epimerization) at C-10.     

8,9-Epoxyeicosatrienoic acid analog protects pulmonary artery smooth muscle cells from apoptosis via ROCK pathway

Epoxyeicosatrienoic acids (EETs), metabolites of arachidonic acid (AA) catalyzed by cytochrome P450 (CYP), have many essential biologic roles in the cardiovascular system including inhibition of apoptosis in cardiomyocytes. In the present study, we tested the potential of 8,9-EET and derivatives to protect pulmonary artery smooth muscle cells (PASMCs) from starvation induced apoptosis. We found 8,9-epoxy-eicos-11(Z)-enoic acid (8,9-EET analog (214)), but not 8,9-EET, increased cell viability, decreased activation of caspase-3 and caspase-9, and decreased TUNEL-positive cells or nuclear condensation induced by serum deprivation (SD) in PASMCs. These effects were reversed after blocking the Rho-kinase (ROCK) pathway with Y-27632 or HA-1077. Therefore, 8,9-EET analog (214) protects PASMC from serum deprivation-induced apoptosis, mediated at least in part via the ROCK pathway. Serum deprivation of PASMCs resulted in mitochondrial membrane depolarization, decreased expression of Bcl-2 and enhanced expression of Bax, all effects were reversed by 8,9-EET analog (214) in a ROCK dependent manner. Because 8,9-EET and not the 8,9-EET analog (214) protects pulmonary artery endothelial cells (PAECs), these observations suggest the potential to differentially promote apoptosis or survival with 8,9-EET or analogs in pulmonary arteries.     

Metabolic and stereoselective formations of non-K-region benz(a)anthracene 8,9- and 10,11-epoxides

The non-K-region benz[a]anthracene (BA) 8,9- and 10,11-epoxides were isolated by normal-phase high-performance liquid chromatography as rat liver microsomal metabolites of BA. The identities of these epoxides were established by ultraviolet and mass spectral analyses and were further validated by the microsomal epoxide hydrolase catalyzed conversion to BA trans-8,9-dihydrodiol and trans-10,11-dihydrodiol, respectively. Circular dichroism spectral analyses of the metabolically formed non-K-region epoxides and dihydrodiols and mass spectral analyses of metabolically formed 18O-labeled non-K-region dihydrodiols and their acid-catalyzed dehydration products indicated that BA (8R,9S)-epoxide and (10S,11R)-epoxide were the predominant enantiomers formed in the metabolism at the 8,9- and 10,11- aromatic double bonds of BA, respectively, by rat liver microsomes. This is the first example demonstrating the direct detection and stereoselective metabolic formation of non-K-region epoxides of a polycyclic aromatic hydrocarbon.     

Theoretical investigation of hydrogen bonding effects on oxygen, nitrogen, and hydrogen chemical shielding and electric field gradient tensors of chitosan/HI salt

A density functional theory study has been carried out to calculate the (17)O, (15)N, (13)C, and (1)H chemical shielding as well as (17)O, (14)N, and (2)H electric field gradient tensors of chitosan/HI type I salt. These calculations were performed using the B3LYP functional and 6-311++G (d,p) and 6-31++G (d,p) basis sets. Calculated EFG and chemical shielding tensors were used to evaluate the (17)O, (14)N, and (2)H nuclear quadruple resonance, NQR, and (17)O, (15)N, (13)C, and (1)H nuclear magnetic resonance, NMR, parameters in the cluster model, which are in good agreement with the available experimental data. The difference in the isotropic shielding (sigma(iso)) and quadrupole coupling constant (C(Q)) between monomer and target molecule in the cluster was analyzed in detail. It was shown that both EFG and CS tensors are sensitive to hydrogen-bonding interactions, and calculating both tensors is an advantage. A different influence of various hydrogen bond types, N-Hcdots, three dots, centeredI, O-Hcdots, three dots, centeredI, and N-Hcdots, three dots, centeredO was observed on the calculated CS and EFG tensors. On the basis of this study, nitrogen and O-6 are the most important nuclei to confirm crystalline structure of chitosan/HI. These nuclei have large change in their CS and EFG tensors because of forming intermolecular hydrogen bonds. Moreover, the quantum chemical calculations indicated that the intermolecular hydrogen-bonding interactions play an essential role in determining the relative orientation of CS and EFG tensors of O-6 and nitrogen atoms in the molecular frame axes.     

8,9-Epoxyeicosatrienoic acid inhibits antibody production of B lymphocytes in mice

Epoxyeicosatrienoic acids (EETs), synthesized from arachidonic acid by cytochrome P450 epoxygenases, are converted to dihydroxyeicosatrienoic acids by soluble epoxide hydrolase. EETs exert anti-inflammatory effects. However, the effect of EETs on humoral immunity is poorly understood. The present study is to investigate the potential role of EETs on B cell function and mechanisms. We examined the role of EETs on antibody production of splenic B cells from C57BL/6 and apolipoprotein E-deficient (ApoE-/-) mice by means of ELISA. Of the 4 EET regioisomers, 8,9-EET decreased basal and activation-induced B cell antibody secretion. As well, 8,9-EET significantly inhibited B-cell proliferation and survival, plasma cell differentiation and class-switch recombination. Western blot analysis revealed that lipopolysaccharide-induced nuclear translocation of NF-κB could be attenuated by 8,9-EET. Furthermore, germinal center formation was impaired by 8,9-EET in mice in vivo. 8,9-EET may inhibit B-cell function in vitro and in vivo, which suggests a new therapeutic strategy for diseases with excess B cell activation.     

Crystallization of a DNA tridecamer d(C-G-C-A-G-A-A-T-T-C-G-C-G)

Crystals of the DNA tridecamer d(C-G-C-A-G-A-A-T-T-C-G-C-G) have been grown by the vapor-diffusion technique with 2-methyl-2,4-pentanediol as precipitant. They are monoclinic space group C2, with a = 79.6 A, b = 43.1 A, c = 24.9 A and beta = 98.7 degrees. Previous nuclear magnetic resonance studies predicted that this tridecamer forms a duplex similar to the B DNA dodecamer, d(C-G-C-G-A-A-T-T-C-G-C-G), except for an extra adenosine residue that is stacked within the helix but remains unpaired: (formula; see text) Preliminary X-ray diffraction studies confirmed that the tridecamer is in the B DNA conformation, consistent with the nuclear magnetic resonance results.     

Stereoselective fungal metabolism of 7,12-dimethylbenz[a]anthracene: identification and enantiomeric resolution of a K-region dihydrodiol

Syncephalastrum racemosum UT-70 and Cunninghamella elegans ATCC 36112 metabolized 7,12-dimethylbenz[a]anthracene (7,12-DMBA) to hydroxymethyl metabolites as well as 7-hydroxymethyl-12-methylbenz[a]anthracene trans-3,4-, -5,6-, -8,9-, and -10,11-dihydrodiols. The 7,12-DMBA metabolites were isolated by reversed-phase high-performance liquid chromatography and identified by their UV-visible absorption, mass, and nuclear magnetic resonance spectral characteristics. A comparison of the circular dichroism spectra of the K-region (5,6-position) dihydrodiol of both fungal strains with those of the 7,12-DMBA 5S,6S-dihydrodiol formed from 7,12-DMBA by rat liver microsomes indicated that the major enantiomer of the 7-hydroxymethyl-12-methylbenz[a]anthracene trans-5,6-dihydrodiol formed by both fungal strains had a 5R,6R absolute stereochemistry. Direct resolution of the fungal trans-5,6-dihydrodiols by chiral stationary-phase high-performance liquid chromatography indicated that the ratios of the R,R and S,S enantiomers were 88:12 and 77:23 for S. racemosum and C. elegans, respectively. These results indicate that the fungal metabolism of 7,12-DMBA at the K region (5,6-position) is highly stereoselective and different from that reported for mammalian enzyme systems.     

Ab initio quantum mechanical calculations of the variation of the 1H and 13C nuclear magnetic shielding constants in proline as a function of the angle psi

The variation of the nuclear magnetic shielding constant of the different protons and carbons of trans HCO-L-Pro-NH2 with the value of the angle psi is calculated by a non-empirical method for three conformations of the proline ring. The results concerning the CH protons show that the chemical shift of the alpha, beta and gamma endo hydrogens can vary by more than 1 ppm when psi goes from -30 degrees to 180 degrees. The theoretical variation of the chemical shift difference between alpha and gamma or beta and gamma carbons is found to be sensitive to the puckering of the proline ring. For the second of these differences the theoretical results are in agreement with Siemion's relation only for a limited range of molecular conformations. Additional calculations show that the variations of the proton shifts with the value of psi are due to the magnetic anisotropy of the proline carbonyl group and to the polarization of the CH bonds by the multipolar charge distribution carried by this carbonyl. The results are discussed in relation to experiment and the possibility of using 1H and 13C chemical shifts for the determination of the value of the torsion angle about the C alpha C' bond.     

Stereoselective fungal metabolism of 7,12-dimethylbenz[a]anthracene: identification and enantiomeric resolution of a K-region dihydrodiol.

Syncephalastrum racemosum UT-70 and Cunninghamella elegans ATCC 36112 metabolized 7,12-dimethylbenz[a]anthracene (7,12-DMBA) to hydroxymethyl metabolites as well as 7-hydroxymethyl-12-methylbenz[a]anthracene trans-3,4-, -5,6-, -8,9-, and -10,11-dihydrodiols. The 7,12-DMBA metabolites were isolated by reversed-phase high-performance liquid chromatography and identified by their UV-visible absorption, mass, and nuclear magnetic resonance spectral characteristics. A comparison of the circular dichroism spectra of the K-region (5,6-position) dihydrodiol of both fungal strains with those of the 7,12-DMBA 5S,6S-dihydrodiol formed from 7,12-DMBA by rat liver microsomes indicated that the major enantiomer of the 7-hydroxymethyl-12-methylbenz[a]anthracene trans-5,6-dihydrodiol formed by both fungal strains had a 5R,6R absolute stereochemistry. Direct resolution of the fungal trans-5,6-dihydrodiols by chiral stationary-phase high-performance liquid chromatography indicated that the ratios of the R,R and S,S enantiomers were 88:12 and 77:23 for S. racemosum and C. elegans, respectively. These results indicate that the fungal metabolism of 7,12-DMBA at the K region (5,6-position) is highly stereoselective and different from that reported for mammalian enzyme systems.     

31P nuclear magnetic resonance chemical shielding tensors of phosphorylethanolamine, lecithin, and related compounds: Applications to head-group motion in model membranes.

31P nuclear magnetic resonance (NMR) powder spectra have been used to obtain the principal values of the chemical shielding tensors of dipalmitoyellecithin (DPL), dipalmitoylphosphatidylethanolamine, and several related organophosphate mono- and diesters. In addition, the principal values and orientation of the phosphorylethanolamine shielding tensor were determined from 31P NMR spectra of a single crystal. In all compounds studied the shielding tensors were clearly monaxial. The monoester spectra are typified by the spectrum of phosphorylethanolamine with principal values of -67, -13, and 69 ppm relative to H3PO4. The diesters have a larger total anisotrophy, as indicated by the DPL values of -81, -25, and 108 ppm. These data as well as the orientation of the phosphorylethanolamine shielding tensor are correlated with the electron density distribution as determined by the bonding pattern of the phosphate. The spectrum of a DPL-water (1:1) mixture at 52 degrees C has a shift anisotrophy of 30 ppm and displays a shape characteristic of an axial tensor. This change from the rigid lattice DPL pattern is explained in terms of motional narrowing, and the shielding tensor data are used to interpret the motion of the phospholipid head group. Simple rotation about the P-O(glycerol) bond is excluded, and a more complex motion involving rotation about both the P-O (glycerol) and glycerol C(2)-C(3) bonds is postulated.     

Proton NMR study of the B----Z transition of d(CGm5CG)2 and d(CGm5CGCG)2: theory and experiment.

The magnetic shielding produced by the double helix in a B-DNA and a Z-DNA conformation is calculated for each non exchangeable proton of the oligodeoxynucleotides d(CGm5CG)2 and d(CGm5CGCG)2. The differences between the values obtained for the two helical forms are in good agreement with the variations of chemical shift measured when the salt concentration of the solution is changed from 0.1 M to 2 or 4 M. The analysis of the theoretical chemical shift variations shows that the large upfield shift observed for some of the protons of the cytidine residues is due to the sum of the ring current and local magnetic anisotropy effects of the guanines of the two nearest neighbours residues.     

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.     

Regio- and stereo-selective metabolism of 4-methylbenz[a]anthracene by the fungus Cunninghamella elegans.

Metabolism of 4-methylbenz[a]anthracene by the fungus Cunninghamella elegans was studied. C. elegans metabolized 4-methylbenz[a]anthracene primarily at the methyl group, this being followed by further metabolism at the 8,9- and 10,11-positions to form trans-8,9-dihydro-8,9-dihydroxy-4-hydroxymethylbenz[a]anthracene and trans-10,11-dihydro-10,11-dihydroxy-4-hydroxymethylbenz[a]anthracene. There was no detectable trans-dihydrodiol formed at the methyl-substituted double bond (3,4-positions) or at the 'K' region (5,6-positions). The metabolites were isolated by reversed-phase high-pressure liquid chromatography and characterized by the application of u.v.-visible-absorption-, 1H-n.m.r.- and mass-spectral techniques. The 4-hydroxymethylbenz[a]anthracene trans-8,9- and -10,11-dihydrodiols were optically active. Comparison of the c.d. spectra of the trans-dihydrodiols formed from 4-methylbenz[a]anthracene by C. elegans with those of the corresponding benz[a]anthracene trans-dihydrodiols formed by rat liver microsomal fraction indicated that the major enantiomers of the 4-hydroxymethylbenz[a]anthracene trans-8,9-dihydrodiol and trans- 10,11-dihydrodiol formed by C. elegans have S,S absolute stereochemistries, which are opposite to those of the predominantly 8R,9R- and 10R,11R-dihydrodiols formed by the microsomal fraction. Incubation of C. elegans with 4-methylbenz[a]anthracene under 18O2 and subsequent mass-spectral analysis of the metabolites indicated that hydroxylation of the methyl group and the formation of trans-dihydrodiols are catalysed by cytochrome P-450 mono-oxygenase and epoxide hydrolase enzyme systems. The results indicate that the fungal mono-oxygenase-epoxide hydrolase enzyme systems are highly stereo- and regio-selective in the metabolism of 4-methylbenz[a]anthracene.     

Orientational behavior of phosphatidylcholine bilayers in the presence of aromatic amphiphiles and a magnetic field.

A number of aromatic-containing additives which can influence the orientation of fragments of lipid bilayer membranes by a magnetic field have been investigated. Two properties of these additives prove important: (1) sufficient detergency to facilitate reorganization of bilayer components and (2), sufficient anisotropy in magnetic susceptibility the preferred direction of fragment orientation. Triton X-100 is identified as effective in terms of facilitating magnetic field ordering of bilayer fragments but does not alter the preferred direction of orientation. A combination of the detergent CHAPSO (3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate) and the aromatic alcohol 1-naphthol facilitates both ordering and alters the preferred direction of bilayer orientation. As mixtures of dimyristoylphosphatidylcholine (DMPC) and CHAPSO, which orient with bilayer normals perpendicular to the magnetic field, were titrated with 1-naphthol, the assemblies underwent transitions, first to random orientation, and then to an orientation with bilayer normals parallel to the field. Based on temperature-induced phase transitions and the extent of motional averaging of the 31P shielding tensor of the DMPC headgroup, the DMPC in these oriented samples appears to maintain a bilayer morphology during transitions. The insight provided in this study regarding factors which influence fragment stability and orientation lays the groundwork for the design of improved field-oriented media for spectroscopic investigation of membrane components.     

Shielding, but not zeroing of the ambient magnetic field reduces stress-induced analgesia in mice.

Magnetic field exposure was consistently found to affect pain inhibition (i.e. analgesia). Recently, we showed that an extreme reduction of the ambient magnetic and electric environment, by mu-metal shielding, also affected stress-induced analgesia (SIA) in C57 mice. Using CD1 mice, we report here the same findings from replication studies performed independently in Pisa, Italy and London, ON, Canada. Also, neither selective vector nulling of the static component of the ambient magnetic field with Helmholtz coils, nor copper shielding of only the ambient electric field, affected SIA in mice. We further show that a pre-stress exposure to the mu-metal box is necessary for the anti-analgesic effects to occur. The differential effects of the two near-zero magnetic conditions may depend on the elimination (obtained only by mu-metal shielding) of the extremely weak time-varying component of the magnetic environment. This would provide the first direct and repeatable evidence for a behavioural and physiological effect of very weak time-varying magnetic fields, suggesting the existence of a very sensitive magnetic discrimination in the endogenous mechanisms that underlie SIA. This has important implications for other reported effects of exposures to very weak magnetic fields and for the theoretical work that considers the mechanisms underlying the biological detection of weak magnetic fields.     

Influence of N-H...O and O-H...O hydrogen bonds on the (17)O, (15)N and (13)C chemical shielding tensors in crystalline acetaminophen: a density functional theory study

A computational investigation was carried out to characterize the (17)O, (15)N and (13)C chemical shielding tensors in crystalline acetaminophen. We found that N-H...O and O-H...O hydrogen bonds around the acetaminophen molecule in the crystal lattice have different influences on the calculated (17)O, (15)N and (13)C chemical shielding eigenvalues and their orientations in the molecular frame of axes. The calculations were performed with the B3LYP method and 6-311++G(d, p) and 6-311+G(d) standard basis sets using the Gaussian 98 suite of programs. Calculated chemical shielding tensors were used to evaluate the (17)O, (15)N, and (13)C NMR chemical shift tensors in crystalline acetaminophen, which are in reasonable agreement with available experimental data. The difference between the calculated NMR parameters of the monomer and molecular clusters shows how much hydrogen-bonding interactions affect the chemical shielding tensors of each nucleus. The computed (17)O chemical shielding tensor on O(1), which is involved in two intermolecular hydrogen bonds, shows remarkable sensitivity toward the choice of the cluster model, whereas the (17)O chemical shielding tensor on O(2) involved in one N-H...O hydrogen bond, shows smaller improvement toward the hydrogen-bonding interactions. Also, a reasonably good agreement between the experimentally obtained solid-state (15)N and (13)C NMR chemical shifts and B3LYP/6-311++G(d, p) calculations is achievable only in molecular cluster model where a complete hydrogen-bonding network is considered. Moreover, at the B3LYP/6-311++G(d, p) level of theory, the calculated (17)O, (15)N and (13)C chemical shielding tensor orientations are able to reproduce the experimental values to a reasonably good degree of accuracy.     

Orientation and dynamics of phospholipid head groups in bilayers and membranes determined from 31P nuclear magnetic resonance chemical shielding tensors

31P nuclear magnetic resonance (NMR) powder spectra have been used to determine the principal values of the chemical shielding tensors of phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and phosphatidic acid. The shielding tensors in all cases were clearly nonaxial. The principal values for the monoester phosphatidic acid shielding tensor are -40, -4, and 48 ppm relative to 85% H3PO4. By contrast the diesters have values of -87, -25, and 119 ppm for phosphatidylcholine, -81, -20, and 105 ppm for phosphatidylethanolamine, and -80, -20, and 112 ppm for phosphatidylserine. This difference reflects the sensitivity of the 31P shielding tensor to chemical environment. Anisotropic motion of the molecules in lamellar dispersions of phospholipids caused an incomplete averaging of the shielding tensors resulting in partially narrowed spectra. Spectra of various phospholipid dispersions were recorded as a function of temperature and transitions observed at the gel-liquid crystalline phase transition temperatures. Using a reasonable set of initial conditions, it was shown that a simple model of molecular motion could successfully predict the observed spectra and their temperature dependences. The model includes rotations about the P-O(glycerol) bond and the molecular z axis and a wobble of the molecule about the bilayer normal. As the temperature increases, the wobble amplitude increases and the spectra narrow. A preliminary 31 P NMR spectrum of chick embryo fibroblasts is included. The similarities between this spectrum and those of the lamellar dispersions indicate that some of the predominant features are due to the phospholipid resonances.