Transforming growth factor-beta (TGF-beta) binding to the extracellular domain of the type II TGF-beta receptor: receptor capture on a biosensor surface using a new coiled-coil capture system demonstrates that avidity contributes significantly to high affinity binding

Mature TGF-beta isoforms, which are covalent dimers, signal by binding to three types of cell surface receptors, the type I, II and III TGF-beta receptors. A complex composed of the TGF-beta ligand and the type I and II receptors is required for signaling. The type II receptor is responsible for recruiting TGF-beta into the heteromeric ligand/type I receptor/type II receptor complex. The purpose of this study was to test for the extent that avidity contributes to receptor affinity. Using a surface plasmon resonance (SPR)-based biosensor (the BIACORE), we captured the extracellular domain of the type II receptor (TbetaRIIED) at the biosensor surface in an oriented and stable manner by using a de novo designed coiled-coil (E/K coil) heterodimerizing system. We characterized the kinetics of binding of three TGF-beta isoforms to this immobilized TbetaRIIED. The results demonstrate that the stoichiometry of TGF-beta binding to TbetaRIIED was one dimeric ligand to two receptors. All three TGF-beta isoforms had rapid and similar association rates, but different dissociation rates, which resulted in the equilibrium dissociation constants being approximately 5pM for the TGF-beta1 and -beta3 isoforms, and 5nM for the TGF-beta2 isoform. Since these apparent affinities are at least four orders of magnitude higher than those determined when TGF-beta was immobilized, and are close to those determined for TbetaRII at the cell surface, we suggest that avidity contributes significantly to high affinity receptor binding both at the biosensor and cell surfaces. Finally, we demonstrated that the coiled-coil immobilization approach does not require the purification of the captured protein, making it an attractive tool for the rapid study of any protein-protein interaction.     

Studies on the binding of copper to dopamine beta-monooxygenase and other proteins using the Cu2+ ion-selective electrode

The binding of Cu2+ to native and copper-free dopamine beta-monooxygenase has been investigated by potentiometric titrations using a Cu2+-selective electrode. Stoichiometric formation constants have been determined from regression analysis of the resulting titration curves. The results establish a stoichiometry of four high-affinity binding sites for Cu/+ (log Kf approximately 11) per enzyme tetramer, and more binding sites of lower affinity (log Kf approximately 5-7). The data for binding of the first four Cu2+ to the enzyme tetramer indicate interactions in the binding to the sites. Bovine serum albumin, metal-free carbonic anhydrase, and ovotransferrin have also been titrated with Cu2+, and the formation constants of both high-affinity binding sites and other sites have been determined. The stoichiometry of one high-affinity binding site of Cu2+ for carbonic anhydrase (log Kf approximately 10-12) and two sites for ovotransferrin (log Kf approximately 11) agree with the reported metal binding properties of these proteins. The number of high-affinity binding sites for bovine serum albumin was pH dependent.     

Calculations of DNA Condensation Caused by Ligand Adsorption

A method for calculating the curves of DNA transition from linear to condensed state upon binding of condensing ligands has been developed. The character of the transition and ligand concentration necessary for condensation have been shown to be governed by the length of DNA molecule, energy and stoichiometry parameters of the DNA–ligand complex (equilibrium constant between linear and condensed form in the absence of ligands, constants for ligand binding to linear and condensed forms, the number of base pairs covered by one ligand, etc.). The results of the calculations indicate that a slight difference in the free energies of these DNA states (less than 6 cal/mol(bp) for a DNA of 500 bp) is sufficient for the existence of a stable linear state in the absence of ligands (in free DNA) and the formation of stable condensed state upon complexation.     

Determination of binding parameters of cyclic AMP and its analogs to cyclic AMP-dependent protein kinase by the fluorescent probe method.

The method for determination of dissociation constants for cyclic AMP and its analogs bound to cyclic AMP-dependent protein kinase from pig brain is described. The technique for measuring the binding parameters of the ligands is based on the changes in the fluorescent spectrum of etheno cyclic AMP once it is bound to protein kinase. The dissociation constants for a number of nonfluorescent cyclic AMP analogs were determined in the competitive displacement of etheno cyclic AMP by these analogs. The number of cyclic AMP-binding sites in the pig brain protein kinase was found to be 2.2; no cooperativity was observed upon binding. The holoenzyme complex (Mr = 180,000) of the protein kinase under study was established to have the stoichiometry of R2C2 type under native conditions.     

Calculation of DNA condensation, caused by adsorption of ligands

A method for calculating the curves of DNA transition from linear to condensed state upon binding of condensing ligands has been developed. The character of the transition and ligand concentration necessary for condensation have been shown to be governed by the length of DNA molecule, energy and stoichiometry parameters of DNA-ligand complex (equilibrium constant between linear and condensed form in the absence of ligands, constants for ligand binding to linear and condensed forms, the number of base pairs covered by one ligand, etc.). The results of the calculations indicate that only slight difference in the free energies of these states in free DNA (less than 6 cal/mole(bp) for DNA of 500 bp long) is sufficient for the existence of stable linear state in the absence of ligands (in free DNA) and the formation of stable condensed state upon complexation.     

Binding of dimeric aminoglycosides to the HIV-1 rev responsive element (RRE) RNA construct

Through a series of elegant fluorescence measurements, particularly through stopped-flow kinetic measurements, it was recently demonstrated that aminoglycoside antibiotics are able to bind to the HIV-1 Rev responsive element (RRE) RNA construct in more than a 1:1 stoichiometry (Lacourciere, K. A.; Stivers, J. T.; Marino, J. P. Biocheminstry 2000, 39, 5630). Here, we present the binding study results of dimeric neomycin ligands through fluorescence anisotropy studies, to the HIV-1 RRE RNA construct. The dimeric neomycin molecules are observed to be able to bind the HIV-1 RRE RNA construct approximately 17-fold higher when compared to the monomeric neomycin, lending evidence that there are indeed two or more neomycin binding sites within the HIV-1 RRE construct.     

ATP binding to bovine serum albumin.

Specific binding of ATP to bovine serum albumin (BSA) is demonstrated employing ATP derivatives spin-labeled at either N6 or C8 of adenine ring or at the ribose moiety. Based on a 1:1 stoichiometry binding constants are in the 50-100 microM range. Binding is largely competitive with ATP or stearic acid. A small fraction of the labeled nucleotides could not be liberated by these ligands. Binding of AMP is in the millimolar range, only.     

Rapid determination of the binding affinity and specificity of the mushroom Polyporus squamosus lectin using frontal affinity chromatography coupled to electrospray mass spectrometry

The binding affinity and specificity of the mushroom Polyporus squamosus lectin has been determined by the recently developed method of frontal affinity chromatography coupled to electrospray mass spectrometry (FAC/MS). A micro-scale affinity column was prepared by immobilizing the lectin ( approximately 25 microg) onto porous glass beads in a tubing column (9.8 microl column volume). The column was then used to screen several oligosaccharide mixtures. The dissociation constants of 22 sialylated or sulfated oligosaccharides were evaluated against the immobilized lectin. The lectin was found to be highly specific for Neu5Acalpha2-6Galbeta1-4Glc/GlcNAc containing oligosaccharides with K(d) values near 10 microM. The FAC/MS assay permits the rapid determination of the dissociation constants of ligands as well as a higher throughput screening of compound mixtures, making it a valuable tool for affinity studies, especially for testing large numbers of compounds.     

The cationic locus on the recombinant kringle 2 domain of tissue-type plasminogen activator that stabilizes its interaction with omega-amino acids.

The properties of the cationic locus within the recombinant (r) kringle 2 domain (residues 180-261) of tissue-type plasminogen activator ([K2tPA]) that are responsible for stabilization of its interaction with the carboxylate moiety of omega-amino acid ligands have been assessed by determination of the binding constants of several such ligands to a variety of r-[K2tPA] mutants obtained by oligonucleotide-directed mutagenesis. We have generated, expressed in Escherichia coli, and purified alanyl mutants of individual histidyl,lysyl, and arginyl residues of r-[K2tPA] and determined the dissociation constants of several omega-amino acids, viz., 6-aminohexanoic acid (6-AHxA), 7-aminoheptanoic acid (7-AHpA), L-lysine (L-Lys), and trans-(aminomethyl)cyclohexane-1-carboxylic acid (AMCHA), to each of the r-[K2tPA] variants. We find that K33 plays the most significant role as a cationic partner of the complementary carboxylate group of these ligands. When K33 is altered to a variety of other amino acids, the K33R mutant best stabilizes binding of all of these ligands. However, the r-K33L and r-K33F variants selectively interact with 7-AHpA almost as strongly (ca. 2-fold reduction in binding strength) as wild-type r-[K2tPA]. Increased polarity (K33Q) or a negative charge (K33E) at this sequence position significantly destabilizes binding of omega-amino acids to the muteins. We also found that the r-K33E mutant and, to a lesser extent, the r-K33Q variant selectively interact with a new ligand, 1,6-diaminohexane. These observations show that the omega-amino acid binding site of wtr-[K2tPA] could be redesigned to provide a new binding specificity.(ABSTRACT TRUNCATED AT 250 WORDS)     

Measuring dissociation constants of RNA and aminoglycoside antibiotics by electrospray ionization mass spectrometry

Electrospray ionization mass spectrometry (ESI-MS) has been used to determine the dissociation constants (K(D)s) and binding stoichiometry for tobramycin and paromomycin with a 27-nucleotide RNA construct representing the A-site of the 16S ribosomal RNA. K(D) values determined by holding the ligand concentration fixed are compared with K(D) values derived by holding the RNA target concentration fixed. Additionally, the effect of solution conditions such as the amount of organic solvent present and the amount of salt present in the solution on the K(D) measurement is investigated. It is shown that the preferred method for determining dissociation constants using ESI-MS is holding the RNA target concentration fixed below the expected K(D) and titrating the ligand. K(D) measurements should also be carried out at as high as possible salt concentration to minimize nonspecific binding due primarily to electrostatic interactions. For tobramycin, two nonequivalent binding sites were found with K(D1) = 352 nM and K(D2) = 9 microM. For paromomycin, there is only one binding site with K(D) = 52 nM.     

An improved method for the purification of rat liver-type fatty acid binding protein from Escherichia coli

Rat liver fatty acid binding protein (L-FABP) was efficiently expressed in Escherichia coli and purified to homogeneity. The cDNA encoding L-FABP was ligated into the pTrc99A expression vector and expressed by induction with isopropyl-beta-d-thiogalactopyranoside under the control of the P(trc) promoter. Following an 18 h induction period, L-FABP constituted approximately 3% of the cytosolic protein. The protein could be purified to electrophoretic homogeneity (silver-stained polyacrylamide gel detection) by ammonium sulfate fractionation (65% saturation) of the soluble bacterial lysate followed by the chromatographic sequence of anion-exchange-->hydrophobic interaction-->anion-exchange chromatography. The recombinant protein displayed an isoelectric point of 7.0 and cross-reactivity with rabbit anti-(human L-FABP) polyclonal antibody. The ligand binding properties of the delipidated L-FABP were examined by titration with the fluorescent probe 1-anilino-8-naphthalene sulfonic acid and isothermal titration calorimetric analysis of oleic acid binding. The purified rat L-FABP displayed a binding stoichiometry of 2:1 (ANS:L-FABP) with dissociation constants (K(d)) of 1.7 and 15.5 microM for the high and low affinity binding sites, respectively. The K(d) values determined by ITC for oleic acid binding were 0.155 and 4.04 microM with a binding stoichiometry of approximately 2 mol of fatty acid/mol of protein. These physicochemical and binding properties are in agreement with those of L-FABP isolated from rat liver tissue.     

Heparin binding to the urokinase kringle domain.

The binding of urokinase to immobilized heparin and dextran sulfate was studied using activity assays of the bound urokinase. The markedly higher binding observed with high M(r) urokinase compared to low M(r) urokinase indicated a role for the amino-terminal fragment (ATF). This was confirmed by the use of inactive truncated urokinase and monoclonal antibodies specific for the ATF in competition assays of urokinase binding. Antibody competition assays suggested a site in the kringle domain, and a synthetic decapeptide Arg-52-Trp-62 from the kringle sequence (kringle numbering convention) was competitive in assays of urokinase binding to dextran sulfate and heparin. Heparin binding to the urokinase kringle was unambiguously demonstrated via 1H NMR spectroscopy at 500 MHz. Effective equilibrium association constants (K(a)*) were determined for the interaction of isolated kringle fragment and low M(r) heparin at pH 7.2. The binding was strong in salt-free 2H2O (K(a)* approximately 57 mM-1) and remained significant in 0.15 M NaCl (K(a)* approximately 12 mM-1), supporting a potential physiological role for the interaction. This is the first demonstration of a function for the kringle domain of urokinase, and it suggests that while the classical kringle structure has specificity for lysine binding, there may also exist a class of kringles with affinity for polyanion binding.     

Comparison of the binding of anthracycline derivatives to purified DNA and to cell nuclei

Fluorescence method was used to study the interactions of anthracyclines with purified DNA and with cell nuclei at 37 degrees C, at pH ranging from 6.8 to 8. Four anthracyclines were used; adriamycin (ADR), 4'-o-tetrahydropyranyladriamycin (THP-ADR), daunorubicin (DNR) and aclacinomycin (ACM). The values of pKa of deprotonation of these four drugs in the pH range 6.5-8.5 are 8.4, 7.7, 8.4 and 7.0 for ADR, THP-ADR, DNR and ACM, respectively. The overall binding constants K* of these four drugs to purified DNA was determined at various pH values. The binding constants K0 and K+ of the respectively neutral form and once protonated form of the drugs to DNA were calculated. Using cell nuclei from K562 cells, the amount of drug intercalated (CN) within the nuclei of K562 cells and the amount of free drug (CE) in the solution were determined at various pH values: measuring at the same pH values, a linear correlation occurred between K* and CN/CE.     

Binding of nonsubstrate ligands to the glutathione S-transferases.

Fluorescence spectroscopy and inhibition kinetics were used to quantitate the affinity of nonsubstrate ligands for the rat liver glutathione S-transferases AA, A, B, and C in the presence of glutahione. The dissociation constants KD, for ligands such as bilirubin, indocyanine green, and hematin were determined by measuring the decrease in the intrinsic fluorescence of the proteins attendant on the addition of ligand. A second technique, used for compounds which absorb strongly at the excitation maxima of tryptophan, was to utilize 8-anilinonaphthalen sulfonate in the formation of protein complex fluorescing at a higher wavelength. The quenching of this complex allowed the determination of the dissociation constants for ligands such as 3,6-dibromosulfophthalein and cephalothin. These data indicate that all four proteins bind these ligands but do so with different affinities. The bilirubin-induced decrease in fluorescence was used to estimate the stoichiometry of binding as 1.2 mol of bilirubin bound/mol of transferase B and 0.7 mol/mol of transferase C. All of the ligands examine are inhibitors of catalytic activity, as tested in a standard assay with GSH and 1-chloro-2,4-dinitrobenzene as substrates. From these studies we conclude that these proteins have a broad specificity not only for their substrates, but for the binding of nonsubstrate ligands as well.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Two-site binding of beta-cyclodextrin to the Alzheimer Abeta(1-40) peptide measured with combined PFG-NMR diffusion and induced chemical shifts

The interactions of Alzheimer's amyloid beta-peptide with cyclodextrins were studied by (1)H NMR: the translational diffusion coefficient of the peptide and chemical shift changes were studied by the presence of variable concentrations of cyclodextrins. For the full-length peptide, Abeta(1-40), the combined results of translational diffusion and chemical shift changes are consistent with a model where aromatic side chains interact with beta-cyclodextrin with dissociation constants in the millimolar range. The diffusion data were consistent with two beta-cyclodextrin molecules bound per peptide. The binding occurs at two sites, at F(19) and/or F(20) and at Y(10), with dissociation constants K(d)(F) = 4.7 mM and K(d)(Y) = 6.6 mM, respectively, in 10 mM sodium phosphate, pH 7.4 and 298 K. Shorter Alzheimer peptide fragments were studied to measure specific affinities for different binding sites. The N-terminal fragment Abeta(1-9) with a putative binding site at F(4) does not show measurable affinity for beta-cyclodextrin. The fragment Abeta(12-28) has similar apparent affinity (K(d) = 3.8 mM) to beta-cyclodextrin as the full-length peptide Abeta(1-40). Here, the diffusion data suggests a one-to-one stoichiometry, and the binding site is F(19) and/or F(20). Both diffusion results and chemical shift changes give the same affinity. A variant Abeta(12-28)G(19)G(20) without phenylalanines does not bind to beta-cyclodextrin. Other potential ligands, alpha-cyclodextrin, gamma-cyclodextrin, nicotine, and nornicotine do not bind to the Abeta(12-28) fragment. This study shows that combined (1)H NMR diffusion and chemical shift changes may be used to quantitatively determine affinities and stoichiometries of weak interactions, using unlabeled ligands and hosts of comparable sizes.     

A Thermodynamic Characterization of the Binding of Thrombin Inhibitors to Human Thrombin, Combining Biosensor Technology, Stopped-Flow Spectrophotometry, and Microcalorimetry

The binding of a series of low-molecular-mass, active-site-directed thrombin inhibitors (399-575 Da) to human alpha-thrombin was investigated by surface plasmon resonance technology (BIACORE), stopped-flow spectrophotometry, and isothermal titration microcalorimetry (ITC). The equilibrium constants K(D) (nM to microM range) at 25 degrees C obtained from the BIACORE analysis correlated well with the inhibition constants K(i) in a chromogenic inhibition assay. The interactions between thrombin and three potent inhibitors, melagatran, inogatran, and CH-248, were further investigated at temperatures between 278 and 310K. A one-to-one binding stoichiometry found with ITC was supported by BIACORE data. K(i) and K(D) values increased with the temperature, mainly due to higher values for dissociation rate constants. The changes in enthalpy, DeltaH, and entropy, DeltaS, determined from the linear van't Hoff plots (R coefficient > 0.99), were linearly correlated by chemical compensation. Both techniques indicated clear differences in DeltaS for the three inhibitors, with a strong correlation to the number of rotational bonds. Immobilization of thrombin increased the binding stability at higher temperature and reduced the DeltaH by 20 kJ mol(-1). DeltaH values obtained from the inhibition kinetics and BIACORE were thus not identical, but correlated well with ITC data obtained at 37 degrees C. The two thermodynamic techniques allowed further differentiation between compounds of similar affinity; furthermore, kinetic analysis, hence analysis of the transition state, is complementary to ITC. A direct BIACORE binding assay might be a useful alternative to more elaborate inhibition studies.     

Pi binding by the F1-ATPase of beef heart mitochondria and of the Escherichia coli plasma membrane

Pi binding by the F(1)-ATPase of beef heart mitochondria and of the Escherichia coli plasma membrane (E. coli F(1)) was examined by two methods: the centrifuge column procedure [Penefsky, H.S. (1977) J. Biol. Chem. 252, 2891-2899] and the Paulus pressure dialysis cell [Paulus, H. (1969) Anal. Biochem. 32, 91-100]. The latter is an equilibrium dialysis-type procedure. Pi binding by beef heart F(1) could be determined by either procedure. However, direct binding of Pi to E. coli F(1) could be determined adequately only in the Paulus cell which indicated more than two binding sites per mol of enzyme with a K(d) in the range of 0.1 mM. It is concluded that previous failure to observe Pi binding to E. coli F(1) with the centrifuge column procedure is due to a rapid rate of dissociation of Pi from the E. coli enzyme which results in loss of Pi during transit of the enzyme-Pi complex through the column.     

The binding of substrates and a product of the enzymatic reaction to glutathione S-transferase A.

The binding of substrates and a product to glutathione S-transferase A from rat liver was studied by use of equilibrium dialysis and equilibrium partition in a two-phase system. The radioactive substrates glutathione and bromosulfophthalein as well as a product of glutathione and 3,4-dichloro-1-nitrobenzene, S-(2-chloro-4-nitrophenyl)glutathione, gave hyperbolic binding isotherms with a stoichiometry of 2 mol per mol of enzyme (i.e. 1 molecule per subunit). Glutathione (and glutathione disulfide) had an equilibrium (dissociation) constant for the binding of about 10 microM, whereas bromosulfophthalein and the product had equilibrium constants of about 0.5 microM. All ligands showed the same binding stoichiometry, and competition experiments involving unlabeled ligands indicated that glutathione and the glutathione derivatives were binding to the same site. Low affinity sites appeared to exist in addition to the specific high affinity sites (one per subunit) for all ligands tested. The binding studies are fully consistent with a steady state random kinetic mechanism for the enzyme.     

Equilibrium binding of [3H]tubocurarine and [3H]acetylcholine by Torpedo postsynaptic membranes: stoichiometry and ligand interactions

Studies are presented of the equilibrium binding of [3H]-d-tubocurarine (dTC) and [3H]acetylcholine (AcCh) to Torpedo postsynaptic membranes. The saturable binding of [3H]dTC is characterized by two affinities: Kd1 = 33 +/- 6 nM and Kd2 = 7.7 +/- 4.6 microM, with equal numbers of binding sites. Both components are completely inhibited by pretreatment with excess alpha-bungarotoxin or 100 microM nonradioactive dTC and competitively inhibited by carbamylcholine with a KI = 100 nM, but not affected by the local anesthetics dimethisoquin, proadifen, and meproadifen. The biphasic nature of [3H]dTC binding was unaltered in solutions of low ionic strength and by preparation of Torpedo membranes in the presence of N-ethylmaleimide, a treatment which yields dimeric AcCJ receptors. dTC competitively inhibits the binding of [3H]AcCH and decreases the fluorescence of 1-(5-dimethylaminonaphthalene-1-sulfonamido)ethane-2-trimethylammonium (Dns-Chol) in a manner quantitatively consistent with its directly measured binding properties. It decreases the initial rate of 3H-labeled Naja nigricollis alpha-toxin binding by 50% at 60 nM with an apparent Hill coefficient of 0.58. The stoichiometry of total dTC, AcCh, and alpha-neurotoxin binding sites in Torpedo membranes was determined by radiochemical techniques and by a novel fluorescence assay utilizing Dns-Chol as an indicator, yielding ratios of 0.9 +/- 0.1:0.9 +/- 0.2:1, respectively. The biphasic equilibrium binding function is not unique to dTC since other ligands inhibited [3h]acCh binding in a biphasic manner with apparent inhibition constants as follows: gallamine triethiodide (K11 = 2 microM, K12 = 1 mM); Me2dTC (K11 = 500 nM, K12 = 10 microM); decamethonium (K11 = 100 nM, K12 = 1.6 microM). Carbamylcholine, however, inhibited [3H]AcCh binding with a single KI = 100 nM. The observed competition between those ligands and [3H] AcCh cannot be completely accounted for by competitive interaction with two different affinities, and the deviations are discussed in terms of the positive cooperativity of the [3H] AcCh binding function itself. It is concluded that dTC binds only to the AcCh sites in Torpedo membranes and that those sites display two affinities for dTC but only one for AcCh.