Nucleosome phasing on a DNA fragment from the replication origin of simian virus 40 and rephasing upon cruciform formation of the DNA.

Nucleosomes were reconstituted in vitro from a fragment of DNA spanning the simian virus 40 minimal replication origin. The fragment contains a 27-base-pair palindrome (perfect inverted repeat). DNA molecules with stable cruciform structures were generated by heteroduplexing this DNA fragment with mutants altered within the palindromic sequence (C. Nobile and R. G. Martin, Int. Virol., in press). Analyses of the structural features of the reconstituted nucleosomes by the DNase I footprint technique revealed two alternative DNA-histone arrangements, each one accurately phased with respect to the uniquely labeled DNA ends. As linear double-stranded DNA, a unique core particle was formed in which the histones strongly protected the regions to both sides of the palindrome. The cruciform structure seemed to be unable to associate with core histones and, therefore, an alternative phasing of the histone octamer along the DNA resulted. Thus, nucleosome positioning along a specific DNA sequence appears to be influenced in vitro by the secondary structure (linear or cruciform) of the 27-base-pair palindrome. The formation of cruciform structures in vivo, if they occur, might therefore represent a molecular mechanism by which nucleosomes are phased.     

Polyomavirus origin for DNA replication comprises multiple genetic elements.

To define the minimal cis-acting sequences required for polyomavirus DNA replication (ori), we constructed a number of polyomavirus-plasmid recombinants and measured their replicative capacity after transfection of a permissive mouse cell line capable of providing polyomavirus large T antigen in trans (MOP cells). Recombinant plasmids containing a 251-base-pair fragment of noncoding viral DNA replicate efficiently in MOP cells. Mutational analyses of these viral sequences revealed that they can be physically separated into two genetic elements. One of these elements, termed the core, contains an adenine-thymine-rich area, a 32-base-pair guanine-cytosine-rich palindrome, and a large T antigen binding site, and likely includes the site from which bidirectional DNA replication initiates. The other, termed beta, is located adjacent to the core near the late region and is devoid of outstanding sequence features. Surprisingly, another sequence element named alpha, located adjacent to beta but outside the borders of the 251-base-pair fragment, can functionally substitute for beta. This sequence too contains no readily recognized sequence features and possesses no obvious homology to the beta element. The three elements together occupy a contiguous noncoding stretch of DNA no more than 345 base pairs in length in the order alpha, beta, and core. These results indicate that the polyomavirus origin for DNA replication comprises multiple genetic elements.     

Occurrence of reiterated sequences in an untranslated region of Simian virus 40 DNA determined by nucleotide sequence analysis.

An earlier report (Subramanian, Dhar, and Weissman, 1977c) presented the nucleotide sequence of Eco RII-G fragment of SV40 DNA, which contains the origin of DNA replication. The nucleotide sequence of Eco RII-N fragment located next to Eco RII-G on the physical map of SV40 DNA is presented in this report. Eco RII-N is found to be a tandem duplication of the last 55 nucleotides of Eco RII-G. This tandem repeat is immediately preceded by two other reiterated sequences occurring within Eco RII-G, one of them being a tandem repeat of 21 nucleotides and the other a nontandem repeat of 10 nucleotides. These repetitive sequences occur in close proximity to the origin of DNA replication which is known to contain other specialized sequences such as a few palindromes (one of which is 27 long and possesses a perfect 2-fold axis of symmetry), one "true" palindrome, and a long A/T-rich cluster. The repeats (and the replication origin) occur within an untranslated region of SV40 DNA flanked by (the few) structural genes coding for the "late" proteins on the one side and that (those) coding for the "early" protein(s) on the other side. The reiterated sequences are comparable in some respects to repetitive sequences occurring in eucaryotic DNAs. Possible biological functions of the repeats are discussed.     

The mismatched nucleotides in the 5'-terminal hairpin of minute virus of mice are required for efficient viral DNA replication.

The 5'-terminal sequence in the DNA of the parvovirus minute virus of mice (MVM) is a palindrome. It can form a hairpin, the stem of which is entirely base-paired except for three consecutive unpaired nucleotides which form a bubble. Since this structure is well conserved among different parvoviruses, we examined its importance for viral replication by generating MVM mutants with alterations in this region. A clone of MVMp DNA which contained the entire 3' end and more than half of the 5' palindrome was made. Although it lacked the sequence information to form a wild-type bubble, this DNA was infectious. On transfection into A9 fibroblasts, it gave rise to a virus (MVMs) which had a bubble in its 5' palindrome. The bubble consisted of four mismatched nucleotides in the same location as the unpaired nucleotides of the wild-type palindrome. Apparently, neighboring plasmid sequences were incorporated into the viral DNA, enabling formation of the mismatch. This observation suggested that a bubble is critical for growth of MVM but that its sequence is not. To find out whether MVM lacking a bubble in the 5' palindrome is viable, we made a second clone in which the plasmid sequences incorporated in MVMs were removed. Transfection of this DNA gave rise to a virus (MVMx) in which the nucleotides unpaired in the wild-type hairpin are now fully base-paired. Although MVMx can be propagated, it is defective in comparison with wild-type MVMp; it exhibited about a 50-fold-lower ratio of plaque-forming units to DNA content. In mixed infections, MVMp consistently outgrew the bubbleless MVMx. The rate of accumulation of DNA replication intermediates was lower for MVMx than for the wild-type virus. Quantitative analysis of the 5' termini of replicative form DNA suggested that the ability of MVMx to convert hairpin 5' termini to extended termini is impaired. In contrast, the virus with the altered bubble, MVMs, behaved like the wild-type MVMp in all the assays. We conclude that MVM lacking a bubble in its 5'-terminal DNA hairpin is less infectious than and has a selective disadvantage compared with wild-type MVM. The nucleotide sequence of the bubble is not critical. We provide evidence that the presence of a bubble is necessary for efficient viral DNA replication.     

Identification and nucleotide sequences of two similar tandem direct repeats in Epstein-Barr virus DNA

Epstein-Barr virus DNA is known to have partially homologous segments, designated DL and DR, near the left and right ends of the long unique region (Raab-Traub et al., Cell 22:257-267, 1980). DL and DR are each partially composed of tandem direct repeat sequences. DL contains 11 to 14 repeats of a 124-base-pair sequence designated IR2. DR contains approximately 30 direct repeats of a 103-base-pair sequence designated IR4. The DL and DR sequences have colinear partial homology for approximately 2.4 and 1.5 kilobase pairs to the right of IR2 and IR4, respectively. IR2 and IR4 are similar sequences and evolved in part from a common ancestor. Both sequences are 84% guanine and cytosine and have limited homology to Epstein-Barr virus IR1 and to the herpes simplex virus type 1 inverted terminal repeat "a" sequence. IR2 encodes part of an abundant 2.5-kilobase persistent early EBV RNA expressed in productively infected cells, but does not encode part of the 3-kilobase Epstein-Barr virus RNA which is transcribed from the adjacent IR1-U2 region of the Epstein-Barr virus genome in latently infected cells.     

Adeno-associated virus general transduction vectors: analysis of proviral structures.

We used two kinds of adeno-associated virus (AAV) vectors to transduce the neomycin resistance gene into human cells. The first of these (dl52-91) retains the AAV rep genes; the second (dl3-94) retains only the AAV terminal repeats and the AAV polyadenylation signal (428 base pairs). Both vectors could be packaged into AAV virions and produced proviral structures that were essentially the same. Thus, the AAV sequences that are required in cis for packaging (pac), integration (int), rescue (res), and replication (ori) of viral DNA are located within a 284-base-pair sequence that includes the terminal repeat. Most of the G418r cell lines (73%) contained proviruses which could be rescued (Res+) when the cells were superinfected with the appropriate helper viruses. Some produced high yields of viral DNA; other rescued at a 50-fold lower level. Most of the lines that were Res+ (79%) contained a tandem repeat of the AAV genome (2 to 20 copies) which was integrated randomly with respect to cellular DNA. Junctions between two consecutive AAV copies in a tandem array contained either one or two copies of the AAV terminal palindrome. Junctions between AAV and cellular sequences occurred predominantly at or within the AAV terminal repeat, but in some cases at internal AAV sequences. Two lines were seen that contained free episomal copies of AAV DNA. Res+ clones contained deleted proviruses or tandem repeats of a deleted genome. Occasionally, flanking cellular DNA was also amplified. There was no superinfection inhibition of AAV DNA integration. Our results suggest that AAV sequences are amplified by DNA replication either before or after integration and that the mechanism of replication is different from the one used during AAV lytic infections. In addition, we have described a new AAV general transduction vector, dl3-94, which provides the maximum amount of room for insertion of foreign DNA and integrates at a high frequency (80%).     

Replication process of the parvovirus H-1. VII. Electron microscopy of replicative-form DNA synthesis.

The geometry of replicative form (RF) DNA synthesis of the H-1 parvovirus was studied with the electron microscope using formamide or aqueous variations of the Kleinschmidt spreading procedure. H-1 DNA was isolated from human or hamster cells infected with a temperature-sensitive mutant, ts1, which is deficient in progeny single-stranded DNA synthesis at the restrictive temperature (S.L. Rhode, 1976), thus minimizing possible confusion between RF and progeny DNA replicative intermediates (RIs). The purity of the isolated H-1 DNA, as determined by gel electrophoresis, ethidium bromide staining, autoadiography, and digestion with endo R-EcoRI, was high. H-1 RF DNA'S WERE LINEAR DOUBLE-STRANDED MOLECULES, 1.53 MUM IN LENGTH. H-1 RIs of RF DNA replication were double-stranded, Y-shaped molecules, with the same length as RF DNAs. The replication origin was localized no more than 0.15 genome lengths from one end of the RF DNA, with replication proceeding toward the other end at a uniform rate. Similar RF and RI molecules of dimer size were also observed. The length of H-1 single-stranded DNA extracted from purified virions was measured relative to that of phiX174 and it had a very similar contour length, so that the molecular weight of H-1 single-stranded DNA would be at least 1.48 X 10(6) to 1.59 X 10(6) (Berkowitz and Day, 1974).     

Two spatially distinct genetic elements constitute a bipartite DNA replication origin in the minute virus of mice genome.

Mutations were introduced into plasmid pMM984, a full-length infectious clone of the fibrotropic strain of minute virus of mice, to identify cis-acting genetic elements required for the excision and replication of the viral genome. The replicative capacity of these mutants was measured directly, using an in vivo transient DNA replication assay following transfection of plasmids into murine A9 cells and primate COS-7 cells. Experiments with subgenomic constructs indicated that both viral termini must be present on the same DNA molecule for replication to occur and that the viral nonstructural protein NS-1 must be provided in trans. The necessary sequences were located within 1,084 and 807 nucleotides of the 3' and 5' ends of the minute virus of mice genome, respectively. The inhibitory effect of deletions within the 206-bp 5'-terminal palindrome demonstrated that these sequences comprise a cis-acting genetic element that is absolutely essential for the excision and replication of viral DNA. The results further indicated a requirement for a stem-plus-arms T structure as well as for the formation of a simple hairpin. In addition, the removal of one copy of a tandemly arranged 65-bp repeat found 94 nucleotides inboard of the 5'-terminal palindrome inhibited viral DNA replication in cis by 10- and just greater than 100-fold in A9 and COS-7 cells, respectively. The latter results define a novel genetic element within the 65-bp repeated sequence, distinct from the terminal palindrome, that is capable of regulating minute virus of mice DNA replication in a species-specific manner.     

Origin of adeno-associated virus DNA replication is a target of carcinogen-inducible DNA amplification.

DNA amplification of the helper-dependent parvovirus AAV (adeno-associated virus) can be induced by a variety of genotoxic agents in the absence of coinfecting helper virus. Here we investigated whether the origin of AAV type 2 DNA replication cloned into a plasmid is sufficient to promote replication activity in cells treated by the carcinogen N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). A pUC19-based plasmid, designated pA2Y1, which contains the left terminal repeat sequences (TRs) representing the AAV origin of replication and the p5 and p19 promoter but lacks any functional parvoviral genes is shown to confer replication activity and to allow selective DNA amplification in carcinogen-treated cells. Following transfection of plasmid pA2Y1 or plasmid pUC19 as a control, density labeling by a bromodeoxyuridine and DpnI resistance assay suggested a semi-conservative mode of replication of the AAV origin-containing plasmid. Furthermore, the amount of DpnI-resistant full-length pA2Y1 DNA molecules was increased by MNNG treatment of cells in a dose-dependent manner. In addition, DNA synthesis of plasmid pA2Y1 was studied in vitro. Extracts derived from MNNG-treated CHO-9 and L1210 cells displayed greater synthesis of DpnI-resistant full-length pA2Y1 molecules than did nontreated controls. Experiments with specific enzyme inhibitors suggested that the reaction is largely dependent on DNA polymerase alpha, DNA primase, and DNA topoisomerase I. Furthermore, restriction endonuclease mapping analysis of the in vitro reaction products revealed the occurrence of specific initiation at the AAV origin of DNA replication. Though elongation was not very extensive, extracts from carcinogen-treated cells markedly amplified the AAV origin region. Our results, including electron microscopic examination, suggest that the AAV origin/terminal repeat structure is recognized by the cellular DNA replicative machinery induced or modulated by carcinogen treatment in the absence of parvoviral gene products.     

Detection of template strand switching during initiation and termination of DNA replication of porcine circovirus

Nucleotide substitution mutagenesis was conducted to investigate the importance of the inverted repeats (palindrome) at the origin of DNA replication (Ori) of porcine circovirus type 1 (PCV1). Viral genomes with engineered mutations on either arm or both arms of the palindrome were not impaired in protein synthesis and yielded infectious progeny viruses with restored or new palindromes. Thus, a flanking palindrome at the Ori was not essential for initiation of DNA replication, but one was generated inevitably at termination. Among the 26 viruses recovered, 16 showed evidence of template strand switching, from minus-strand genome DNA to palindromic strand DNA, during biosynthesis of the Ori. Here I propose a novel rolling-circle "melting-pot" model for PCV1 DNA replication. In this model, the replicator Rep protein complex binds, destabilizes, and nicks the Ori sequence to initiate leading-strand DNA synthesis. All four strands of the destabilized inverted repeats exist in a "melted" configuration, and the minus-strand viral genome and a palindromic strand are available as templates, simultaneously, during initiation or termination of DNA replication. Inherent in this model is a "gene correction" or "terminal repeat correction" mechanism that can restore mutilated inverted-repeat sequences to a palindrome at the Ori of circular DNAs or at the termini of circularized linear DNAs. Potentially, the melted state of the inverted repeats increases the rate of noncomplementary or illegitimate nucleotide incorporation into the palindrome. Thus, this melting-pot model provides insight into the mechanisms of DNA replication, gene correction, and illegitimate recombination at the Ori of PCV1, and it may be applicable to the replication of other circular DNA molecules.     

Comparison of the DNA sequence of the Crawford small-plaque variant of polyomavirus with those of polyomaviruses A2 and strain 3.

The DNA sequence of two wild-type strains of polyomavirus (A2 and strain 3) are known. We have determined the majority of the DNA sequence of a third strain, the Crawford small-plaque virus. This virus has been noted for its capacity to induce readily detected tumor-specific transplantation antigen in hamster cells, a property that is most likely attributable to an altered middle T-antigen. A comparison of its DNA sequence with those of the A2 and strain 3 viruses reveals numerous nucleotide substitutions, insertions, and deletions throughout the genome. Most sequence changes in coding regions are silent mutations; however, variability in proteins can be predicted from these sequence data at 5 locations in middle T-antigen, 10 in large T-antigen, and 10 in VP1. The Crawford small-plaque virus noncoding regulatory region contains, in addition to nucleotide substitutions, a 44-base-pair tandem repeat of sequences on the late side of the origin of DNA replication.     

The rabbit C family of short, interspersed repeats. Nucleotide sequence determination and transcriptional analysis

When the entire adeno-associated virus (AAV) genome is inserted into a bacterial plasmid, infectious AAV genomes can be rescued and replicated when the recombinant AAV-plasmid DNA is transfected into human 293 cells together with helper adenovirus particles. We have taken advantage of this experimental system to analyze the effects of several classes of mutations on replication of AAV DNA. We obtained AAV mutants by molecular cloning in bacterial plasmids of naturally occurring AAV variant or defective-interfering genomes. Each of these mutants contains a single internal deletion of AAV coding sequences. Also, some of these mutant-AAV plasmids have additional deletions of one or both AAV terminal palindromes introduced during constructions in vitro. We show here that AAV mutants containing internal deletions were defective for replicative form DNA replication (rep-) but could be complemented by intact wild-type AAV. This indicates that an AAV replication function, Rep, is required for normal AAV replication. Mutants in which both terminal palindromes were deleted (ori-) were also replication defective but were not complementable by wild-type AAV. The cis-dominance of the ori- mutation shows that the replication origin is comprised in part of the terminal palindrome. Deletion of only one terminal palindrome was phenotypically wild-type and allowed rescue and replication of AAV genomes in which the deleted region was regenerated apparently by an intramolecular correction mechanism. One model for this correction mechanism is proposed. An AAV ori- mutant also complemented replication of AAV rep- mutants as efficiently as did wild-type AAV. These studies also revealed an unexpected additional property of the deletion mutants in that monomeric single-stranded single-stranded DNA accumulated very inefficiently even though monomeric single-stranded DNA from the complementing wild-type AAV did accumulate.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Interaction between gene II protein and the DNA replication origin of bacteriophage f1

The origin of DNA replication of the filamentous bacteriophage f1 binds its initiator protein (gene II protein) in vitro to form a complex that can be trapped on nitrocellulose filters. The binding occurs with both superhelical form DNA and linear DNA fragments. A number of defective mutants of the origin were tested for the ability to bind gene II protein. The region of DNA required for the binding is around a second palindrome downstream from the palindrome that contains the DNA replication initiation site. It overlaps, but is not identical to, the region required for the nicking reaction by the protein. The nicking site itself was dispensable for the binding. In vivo, a number of defective deletion mutants of the origin, when in a plasmid, inhibited growth of superinfecting phage if the intracellular level of gene II protein was low. In addition, these defective origins inhibited the activity of the functional phage origin located on the same replicon. The domain of the DNA sequence required for inhibition in vivo was consistent with that for the binding in vitro.     

Three domains in the simian virus 40 core origin orchestrate the binding, melting, and DNA helicase activities of T antigen.

The simian virus 40 (SV40) core origin of replication consists of three functional domains. The sequence 5'-CACTACTTCTGGAATAG-3' with an imperfect inverted repeat (underlined), a palindrome with four 5'-GAGGC-3' pentanucleotide repeats, and a 17-base-pair A + T-rich segment. We have been able to assign primary functions to each domain. Remarkably, SV40 large T antigen melted the inverted repeat domain in the complete absence of other origin sequences. Presumably, this protein-DNA interaction initiates a replication bubble that leads to daughter strand DNA synthesis. The pentanucleotide domain alone docked and arranged T antigen at the origin. The A + T-rich domain had no independent function, but, in the presence of the other two domains, allowed bound T antigen to extend the replication bubble. Thus, three domains of the origin coordinate the binding, melting, and DNA helicase activities of T antigen in an ordered sequence of events to initiate DNA replication.     

Nucleotide sequence analysis of the long terminal repeat of avian myeloblastosis virus and adjacent host sequences.

The nucleotide sequence of the integrated avian myeloblastosis virus long terminal repeat has been determined. The sequence is 385 base pairs long and is present at both ends of the viral DNA. The cell-virus junctions at each end consist of a 6-base-pair direct repeat of cell DNA next to the inverted repeat of viral DNA. The long terminal repeat also contains promoter-like sequences, an mRNA capping site, and polyadenylation signals. Several features of this long terminal repeat suggest a structural and functional similarity with sequences of transposable and other genetic elements. Comparison of these sequences with long terminal repeats of other avian retroviruses indicates that there is a great variation in the 3' unique sequence (U3), whereas the 5' specific sequences (U5) and the R region are highly conserved.     

Evolutionarily selected replication origins: functional aspects and structural organization.

A selective replicative pressure occurs during the evolution of simian virus 40 variants. When the replication origin is duplicated as an inverted repeat, there is a dramatic enhancement of replication. Having regulatory sequences located between the inverted repeat of ori magnifies their enhancing effect on replication. A passage 20 variant and a passage 45 variant containing three pairs of an inverted repeat of ori replicated more efficiently than a passage 13 variant containing nine copies of ori arranged in tandem. A 69-base-pair cellular sequence inserted between inverted repeats of ori of both passage 40 and 45 variants enhanced simian virus 40 DNA replication. Differences in replication efficiencies became greater as the total number of replicating species was increased in the transfection mixture, under conditions where T antigen is limiting. In a competitive environment, sequences flanking the replication origin may be inhibitory to replication.     

The nucleotide sequence surrounding the origin of DNA replication of Col E1.

The DNA of Col E1 replicates from a unique origin located at a distance of 17-19% of the genome length from the single Eco RI clevage site. The nucleotide sequence about this site has been determined by a combination of RNA and DNA sequencing techniques. The principal features of the sequence are two palindromes, one of which resembles a palindrome located in the intercistronic region of 0X174. The sequence also contains stretches of purine and pyrimidine clusters of the following compositions: pAT5G, pC2T5G, pGT5G. The origin sequence demonstrates that initiation of DNA replication takes place in an intercistronic region of Col E1DNA, although the possibility that this region makes small polypeptides 30-40 residues long cannot be strictly eliminated at this time.