Genomewide search for type 2 diabetes-susceptibility genes in French whites: evidence for a novel susceptibility locus for early-onset diabetes on chromosome 3q27-qter and independent replication of a type 2-diabetes locus on chromosome 1q21-q24

Despite recent advances in the molecular genetics of type 2 diabetes, the majority of susceptibility genes in humans remain to be identified. We therefore conducted a 10-cM genomewide search (401 microsatellite markers) for type 2 diabetes-related traits in 637 members of 143 French pedigrees ascertained through multiple diabetic siblings, to map such genes in the white population. Nonparametric two-point and multipoint linkage analyzes-using the MAPMAKER-SIBS (MLS) and MAXIMUM-BINOMIAL-LIKELIHOOD (MLB) programs for autosomal markers and the ASPEX program for chromosome X markers-were performed with six diabetic phenotypes: diabetes and diabetes or glucose intolerance (GI), as well as with each of the two phenotypes associated with normal body weight (body-mass index<27 kg/m(2)) or early age at diagnosis (<45 years). In a second step, high-resolution genetic mapping ( approximately 2 cM) was performed in regions on chromosomes 1 and 3 loci showing the strongest linkage to diabetic traits. We found evidence for linkage with diabetes or GI diagnosed at age <45 years in 92 affected sib pairs from 55 families at the D3S1580 locus on chromosome 3q27-qter using MAPMAKER-SIBS (MLS = 4.67, P=.000004), supported by the MLB statistic (MLB-LOD=3.43, P=.00003). We also found suggestive linkage between the lean diabetic status and markers APOA2-D1S484 (MLS = 3. 04, P=.00018; MLB-LOD=2.99, P=.00010) on chromosome 1q21-q24. Several other chromosomal regions showed indication of linkage with diabetic traits, including markers on chromosome 2p21-p16, 10q26, 20p, and 20q. These results (a) showed evidence for a novel susceptibility locus for type 2 diabetes in French whites on chromosome 3q27-qter and (b) confirmed the previously reported diabetes-susceptibility locus on chromosome 1q21-q24. Saturation on both chromosomes narrowed the regions of interest down to an interval of <7 cM.     

Association study on chromosome 20q11.21-13.13 locus and its contribution to type 2 diabetes susceptibility in Japanese

Several linkage studies have predicted that human chromosome 20q is closely related to type 2 diabetes, but there is no clear evidence that certain variant(s) or gene(s) have strong effects on the disease within this region. To examine disease susceptibility variant in Japanese, verified SNPs from the databases, with a minor allele frequency larger than 0.15, were selected at 10-kb intervals across a 19.31-Mb region (20q11.21-13.13), which contained 291 genes, including hepatocyte nuclear factor 4α (HNF4α). As a result, a total of 1,147 SNPs were genotyped with TaqMan assay using 1,818 Japanese samples. By searching for HNF4α as a representative disease-susceptible gene, no variants of HNF4α were strongly associated with disease. To identify other genetic variant related with disease, we designed an extensive two-stage association study (725 first and 1,093 second test samples). Although SNP1146 (rs220076) was selected as a landmark within the 19.31 Mb region, the magnitude of the nominal P value (P = 0.0023) was rather weak. Subsequently, a haplotype-based association study showed that two common haplotypes were weakly associated with disease. All of these tests resulted in non-significance after adjusting for Bonferroni’s correction and the false discovery rate to control for the impact of multiple testing. Contrary to the initial expectations, we could not conclude that certain SNPs had a major effect on this promising locus within the framework presented here. As a way to extend our observations, we emphasize the importance of a subsequent association study including replication and/or meta-analysis in multiple populations.Electronic supplementary material Supplementary material is available in the online version of this article at and is accessible for authorized users.     

Genomewide scan and fine-mapping linkage studies in four European samples with bipolar affective disorder suggest a new susceptibility locus on chromosome 1p35-p36 and provides further evidence of loci on chromosome 4q31 and 6q24

We present the findings of a large linkage study of bipolar affective disorder (BPAD) that involved genomewide analysis of 52 families (448 genotyped individuals) of Spanish, Romany, and Bulgarian descent and further fine mapping of the 1p34-p36, 4q28-q31, and 6q15-q24 regions. An additional sample of 56 German families (280 individuals) was included for this fine-mapping step. The highest nonparametric linkage scores obtained in the fine mapping were 5.49 for 4q31 and 4.87 for 6q24 in the Romany families and 3.97 for 1p35-p36 in the Spanish sample. MOD-score (LOD scores maximized over genetic model parameters) analysis provided significant evidence of linkage to 4q31 and at least borderline significance for the 1p and 6q regions. On the basis of these results and previous positive research findings, 4q31 and 6q24 should now be considered confirmed BPAD susceptibility loci, and 1p35-p36 is proposed as a new putative locus that requires confirmation in replication studies.     

Localization of a susceptibility gene for type 2 diabetes to chromosome 5q34-q35.2

We report a genomewide linkage study of type 2 diabetes (T2D [MIM 125853]) in the Icelandic population. A list of type 2 diabetics was cross-matched with a computerized genealogical database clustering 763 type 2 diabetics into 227 families. The diabetic patients and their relatives were genotyped with 906 microsatellite markers. A nonparametric multipoint linkage analysis yielded linkage to 5q34-q35.2 (LOD = 2.90, P=1.29 x 10(-4)) in all diabetics. Since obesity, here defined as body mass index (BMI) > or =30 kg/m(2), is a key risk factor for the development of T2D, we studied the data either independently of BMI or by stratifying the patient group as obese (BMI > or =30) or nonobese (BMI <30). A nonparametric multipoint linkage analysis yielded linkage to 5q34-q35.2 (LOD = 3.64, P=2.12 x (10)-5) in the nonobese diabetics. No linkage was observed in this region for the obese diabetics. Linkage analysis conditioning on maternal transmission to the nonobese diabetics resulted in a LOD score of 3.48 (P=3.12 x 10(-5)) in the same region, whereas conditioning on paternal transmission led to a substantial drop in the LOD score. Finally, we observed potential interactions between the 5q locus and two T2D susceptibility loci, previously mapped in other populations.     

A susceptibility locus for myopia in the normal population is linked to the PAX6 gene region on chromosome 11: a genomewide scan of dizygotic twins

Myopia is a common, complex trait with considerable economic and social impact and, in highly affected individuals, ocular morbidity. We performed a classic twin study of 506 unselected twin pairs and inferred the heritability of refractive error to be 0.89 (95% confidence interval 0.86-0.91). A genomewide scan of 221 dizygotic twin pairs, analyzed by use of optimal Haseman-Elston regression methods implemented by use of generalized linear modeling, showed significant linkage (LOD >3.2) to refractive error at four loci, with a maximum LOD score of 6.1 at 40 cM on chromome 11p13. Evidence of linkage at this locus, as well as at the other linkage peaks at chromosomes 3q26 (LOD 3.7), 8p23 (LOD 4.1), and 4q12 (LOD 3.3), remained the same or became stronger after model fit was checked and outliers were downweighted. Examination of potential candidate genes showed the PAX6 gene directly below the highest peak at the 11p13 locus. PAX6 is fundamental to identity and growth of the eye, but reported mutations usually result in catastrophic congenital phenotypes such as aniridia. Haplotype tagging of 17 single-nucleotide polymorphisms (SNPs), which covered the PAX6 gene and had common minor allele frequencies, identified 5 SNPs that explained 0.999 of the haplotype diversity. Linkage and association analysis of the tagging SNPs showed strong evidence of linkage for all markers with a minimum chi 21 of 7.5 (P=.006) but no association. This suggests that PAX6 may play a role in myopia development, possibly because of genetic variation in an upstream promoter or regulator, although no definite association between PAX6 common variants and myopia was demonstrated in this study.     

Linkage analysis of juvenile myoclonic epilepsy and microsatellite loci spanning 61 cM of human chromosome 6p in 19 nuclear pedigrees provides no evidence for a susceptibility locus in this region.

Linkage analysis in separately ascertained families of probands with juvenile myoclonic epilepsy (JME) has previously provided evidence both for and against the existence of a locus (designated "EJM1"), on chromosome 6p, predisposing to a trait defined as either clinical JME, its associated electroencephalographic abnormality, or idiopathic generalized epilepsy. Linkage analysis was performed in 19 families in which a proband and at least one first- or two second-degree relatives have clinical JME. Family members were typed for seven highly polymorphic microsatellite markers on chromosome 6p: D6S260, D6S276, D6S291, D6S271, D6S465, D6S257, and D6S254. Pairwise and multipoint linkage analysis was carried out under the assumptions of autosomal dominant inheritance at 70% and 50% penetrance and autosomal recessive inheritance at 70% and 50% penetrance. No significant evidence in favor of linkage to the clinical trait of JME was obtained for any locus. The region formally excluded (LOD score < -2) by using multipoint analysis varies depending on the assumptions made concerning inheritance parameters and the proportion of linked families, alpha-that is, the degree of locus heterogeneity. Further analysis either classifying all unaffected individuals as unknown or excluding a subset of four families in which pyknoleptic absence seizures were present in one or more individuals did not alter these conclusions.     

Evidence of a non-MHC susceptibility locus in type I diabetes linked to HLA on chromosome 6.

Linkage studies have led to the identification of several chromosome regions that may contain susceptibility loci to type I diabetes (IDDM), in addition to the HLA and INS loci. These include two on chromosome 6q, denoted IDDM5 and IDDM8, that are not linked to HLA. In a previous study, we noticed that the evidence for linkage to IDDM susceptibility around the HLA locus extended over a total distance of 100 cM, which suggested to us that another susceptibility locus could reside near HLA. We developed a statistical method to test this hypothesis in a panel of 523 multiplex families from France, the United States, and Denmark (a total of 667 affected sib pairs, 536 with both parents genotyped), and here present evidence (P = .00003) of a susceptibility locus for IDDM located 32 cM from HLA in males but not linked to HLA in females and distinct from IDDM5 and IDDM8. A new statistical method to test for the presence of a second susceptibility locus linked to a known first susceptibility locus (here HLA) is presented. In addition, we analyzed our current family panel with markers for IDDM5 and IDDM8 on chromosome 6 and found suggestions of linkage for both of these loci (P = .002 and .004, respectively, on the complete family panel). When cumulated with previously published results, with overlapping families removed, the affected-sib-pair tests had a significance of P = .0001 for IDDM5 and P = .00004 for IDDM8.     

Two novel susceptibility loci for type 2 diabetes mellitus identified by longitudinal exome-wide association studies in a Japanese population

Recent genome-wide association studies identified genetic variants that confer susceptibility to type 2 diabetes mellitus (T2DM). However, few longitudinal genome-wide association studies of this metabolic disorder have been reported to date. Therefore, we performed a longitudinal exome-wide association study of T2DM, using 24,579 single nucleotide polymorphisms (SNPs) and repeated measurements from 6022 Japanese individuals. The generalized estimating equation model was applied to test relations of SNPs to three T2DM-related parameters: prevalence of T2DM, fasting plasma glucose level, and blood glycosylated hemoglobin content. Three SNPs that passed quality control were significantly (P < 2.26 × 10^? 7) associated with two of the three T2DM-related parameters in additive and recessive models. Of the three SNPs, rs6414624 in EVC and rs78338345 in GGA3 were novel susceptibility loci for T2DM. In the present study, the SNP of GGA3 was predicted to be a genetic variant whose minor allele frequency has recently increased in East Asia.     

Evidence for the localization of a malignant hyperthermia susceptibility locus (MHS2) to human chromosome 17q.

Malignant hyperthermia susceptibility is a lethal autosomal dominant disorder of skeletal muscle metabolism that is triggered by all potent inhalation anesthetic gases. Recent linkage studies suggest a genetic locus for this disorder on 19q13.1. We have previously reported three unrelated families diagnosed with MHS that are unlinked to markers surrounding this locus on 19q13.1. In this report we extend these observations and present linkage studies on 16 MHS families. Four families (25%) were found linked to the region 19q12-q13.2 (Zmax = 2.96 with the ryanodine receptor at theta = 0.0). Five families (31%) were found closely linked to the anonymous marker NME1 (previously designated NM23) on chromosome 17q11.2-q24 (Zmax = 3.26 at theta = 0.0). Two families (13%) were clearly unlinked to either of these chromosomal regions. In five additional families, data were insufficient to determine their linkage status (they were potentially linked to two or more sites). The results of our heterogeneity analyses are consistent with the hypothesis that MHS can be caused in humans by any one of at least three distinct genetic loci. Furthermore, we provide preliminary linkage data suggesting the localization of a gene in human MHS to 17q11.2-q24 (MHS2), with a gene frequency of this putative locus approximately equal to that of the MHS1 locus on 19q.     

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.     

African ancestry and its correlation to type 2 diabetes in African Americans: a genetic admixture analysis in three U.S. population cohorts

The risk of type 2 diabetes is approximately 2-fold higher in African Americans than in European Americans even after adjusting for known environmental risk factors, including socioeconomic status (SES), suggesting that genetic factors may explain some of this population difference in disease risk. However, relatively few genetic studies have examined this hypothesis in a large sample of African Americans with and without diabetes. Therefore, we performed an admixture analysis using 2,189 ancestry-informative markers in 7,021 African Americans (2,373 with type 2 diabetes and 4,648 without) from the Atherosclerosis Risk in Communities Study, the Jackson Heart Study, and the Multiethnic Cohort to 1) determine the association of type 2 diabetes and its related quantitative traits with African ancestry controlling for measures of SES and 2) identify genetic loci for type 2 diabetes through a genome-wide admixture mapping scan. The median percentage of African ancestry of diabetic participants was slightly greater than that of non-diabetic participants (study-adjusted difference = 1.6%, P<0.001). The odds ratio for diabetes comparing participants in the highest vs. lowest tertile of African ancestry was 1.33 (95% confidence interval 1.13-1.55), after adjustment for age, sex, study, body mass index (BMI), and SES. Admixture scans identified two potential loci for diabetes at 12p13.31 (LOD = 4.0) and 13q14.3 (Z score = 4.5, P = 6.6 × 10(-6)). In conclusion, genetic ancestry has a significant association with type 2 diabetes above and beyond its association with non-genetic risk factors for type 2 diabetes in African Americans, but no single gene with a major effect is sufficient to explain a large portion of the observed population difference in risk of diabetes. There undoubtedly is a complex interplay among specific genetic loci and non-genetic factors, which may both be associated with overall admixture, leading to the observed ethnic differences in diabetes risk.     

Comparison of the prevalence of the metabolic syndrome by WHO, AHA/NHLBI, and IDF definitions in a German population with type 2 diabetes: the Diabetes in Germany (DIG) Study.

This study investigated the prevalence of the metabolic syndrome (MetS) in a German population with type 2 diabetes (T2DM) using the three definitions for MetS according to WHO 1999, AHA/NHLBI 2005, and IDF 2005 criteria. Four-thousand and twenty participants as a cross section of daily practice of diabetes care in Germany (238 unselected sites) were included in the Diabetes in Germany (DIG) study. Inclusion criteria: T2DM and age between 35-80 years. Exclusion criteria: major cardiovascular event < 3 months before entry, NYHA-IV, macroproteinuria, and cancer < 5 years before entry. The components of MetS were measured following a standard protocol for anthropometric and laboratory control. The average diabetes duration was 8.4 years and HbA (1C) 7.0%. The prevalence of MetS by WHO criteria was 26.1%, by AHA/NHLBI 79.3%, and by IDF 82.6%. The degree of agreement (kappa statistic) was kappa = 0.69 between AHA/NHLBI and IDF definitions, but only 0.12 for WHO VS. IDF, and 0.17 for WHO vs. AHA/NHLBI. The frequency of central obesity by WHO was 50.9%, by AHA/NHLBI 72.9%, and by IDF 92.0% and for hypertension 29.3%, 92.6%, and 92.6%, respectively. However, the frequencies of lipid components by the three definitions were in the same range (57.8%, 59.5%, 59.5%). In this representative German sample of patients with type 2 diabetes, the prevalence of MetS was very highly independent of using the IDF or AHA/NHLBI definition. Females were significantly more affected than males. The distinctly lower prevalence delineated from WHO criteria is due to low frequency of central obesity and hypertension as consequence of higher cutoff limits for these components used in the WHO definition.