Ullrich-Turner syndrome is not caused by haploinsufficiency of RPS4X

Ullrich-Turner syndrome (UTS) is frequently associated with monosomy X but may also occur with structural aberrations of the X and the Y chromosomes. It has been hypothesized that the ribosomal protein genes RPS4X and RPS4Y play a critical role in the prevention of UTS. Individual patients with a 46,X,i(Xq) karyotype cannot be differentiated phenotypically from 45,X UTS patients and carry three gene copies of RPS4X. Since haploinsufficiency of one or several gene(s) is thought to cause the UTS phenotype, direct assessment of RPS4X expression levels in these patients should establish whether RPS4X is involved in UTS. We have investigated fibroblasts of four 46,X,i(Xq) UTS patients with typical symptoms and a non-mosaic chromosome complement, and have found significantly increased RPS4X mRNA levels in all patients. Based on our results, we conclude that haploinsufficiency of RPS4X is not the cause of UTS.     

Assessment of X bends in patients with atypical X chromosome phenotypes.

Several patients with X chromosome structural abnormalities have been more severely affected clinically than expected. Since bends at Xq13-21 have been associated with inactivation, the authors scored bends retrospectively in 62 patients with X chromosome aneuploidy and 21 cases with structural abnormalities of the X chromosome. They found that patients with 2 X inactivation sites where one X was structurally abnormal had significantly fewer cells with X bends than normal 46,XX. In addition, these patients also showed X bends on the normal X more often than would be expected if non-random X inactivation of the abnormal X chromosome was occurring. Five of the 6 patients with a short or long arm deletion or paracentric inversion of Xq were mentally retarded or had other congenital anomalies not usually associated with Turner syndrome. This suggests to them that these clinical findings may be related to interference with X inactivation patterns in cells with a structurally abnormal X chromosome.     

Small marker X chromosomes lack the X inactivation center: implications for karyotype/phenotype correlations.

The abnormal phenotype and/or mental retardation seen in persons with small marker X (mar(X)) chromosomes has been hypothesized to be due to the loss of the X inactivation center (XIC) at Xq13.2, resulting in two active copies of genes in the pericentromeric region. In order to define precisely the DNA content of mar(X) chromosomes and to correlate phenotype with karyotype, we studied small mar(X) chromosomes, using FISH with probes in the juxtacentromeric region. One of the probes was a 40-kb genomic cosmid for the XIST gene, which maps to the smallest interval known to contain the XIC and is thought to be involved in X inactivation. Our findings reveal that small mar(X) chromosomes do not include the XIC and therefore cannot be subject to X inactivation, supporting the premise that abnormal dosage of expressed genes in the pericentromeric region of the X generates the aberrant phenotype seen in patients with small mar(X) chromosomes.     

The proportion of cells with functional X disomy is associated with the severity of mental retardation in mosaic ring X Turner syndrome females

Turner syndrome females (45,X) do not have mental retardation (MR), whereas some mosaic ring X Turner syndrome females, with 45,X/46,X,r(X), have severe MR. The MR is believed to be caused by a failure of X chromosome inactivation (XCI) of the small ring X chromosome, which leads to functional X disomy (FXD), To explore this hypothesis, we examined the proportion of FXD cells in the peripheral blood of four ring X Turner syndrome females with various levels of MR, using two newly developed XCI assays based on DNA methylation of X-linked genes. As a result, the two patients with extremely severe MR showed complete FXD patterns, whereas the remaining two patients with relatively milder MR showed partial FXD patterns. These results indicate that the proportion of FXD cells may be associated with the severity of MR in mosaic ring X Turner syndrome females, although this association should be confirmed by examining brain cells during development. One of the cases with severe MR and a complete FXD pattern neither lacked the XIST gene nor had uniparental X isodisomy, and we discuss the mechanism of the failure of XCI in this case.     

The cell surface antigen locus, MIC2X, escapes X-inactivation

Recently, it was shown that the cell surface antigen defined by the monoclonal antibody 12E7 is expressed by both the human X and Y chromosomes; the gene loci on the X and Y chromosomes are referred to as MIC2X and MIC2Y, respectively. It was also shown that MIC2X is located in the region Xp22.3----Xpter and MIC2Y is in the region Ypter-Yq1.1. Here, we show that MIC2X escapes X-inactivation on structurally normal and abnormal inactive human X chromosomes.     

Analysis of methylation of a human X located gene which escapes X inactivation.

The gene MIC2 is located in the pseudoautosomal region at the ends of the short arms of the X and Y chromosomes. In females MIC2 escapes X inactivation. We have analyzed the methylation pattern of MIC2 on the active X, the inactive X chromosomes, and the Y chromosome. The 5' end of the gene contains a GC rich region which is unmethylated on the active X, the inactive X and on the Y. The body of the gene is characterized by variable methylation.     

Localization of a gene that escapes inactivation to the X chromosome proximal short arm: implications for X inactivation.

The process of mammalian X chromosome inactivation results in the inactivation of most, but not all, genes along one or the other of the two X chromosomes in females. On the human X chromosome, several genes have been described that "escape" inactivation and continue to be expressed from both homologues. All such previously mapped genes are located in the distal third of the short arm of the X chromosome, giving rise to the hypothesis of a region of the chromosome that remains noninactivated during development. The A1S9T gene, an X-linked locus that complements a mouse temperature-sensitive defect in DNA synthesis, escapes inactivation and has now been localized, in human-mouse somatic cell hybrids, to the proximal short arm, in Xp11.1 to Xp11.3. Thus, A1S9T lies in a region of the chromosome that is separate from the other genes known to escape inactivation and is located between other genes known to be subject to X inactivation. This finding both rules out models based on a single chromosomal region that escapes inactivation and suggests that X inactivation proceeds by a mechanism that allows considerable autonomy between different genes or regions on the chromosome.     

X chromosome-inactivation patterns in patients with Rett syndrome

Rett syndrome (RS) is a complex and severely disabling neurologic disorder, restricted to females. As non-random X inactivation could indicate that the X chromosome has a role in the etiology of the syndrome, we performed molecular analysis based on the differential methylation of the active and inactive X chromosomes with probe M27β, taking into account the parental origin of the two Xs, in 24 RS girls (including a pair of concordant monozygote twins), 22 mothers, and a control group of 30 normal women. The results showed a significantly (Fisher’s exact test) increased frequency of skewed X inactivation in lymphocytes from 15/23 RS compared with 4/22 mothers (P = 0.0031) and 6/30 controls (P = 0.0021). Our results, together with those from the literature, showed that as a group, RS patients are apparently more prone to skewed X inactivation than their mothers and normal controls, and this suggests that the X chromosome is somehow involved in RS etiology. Received: 13 February 1997 / Accepted: 5 November 1997     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

The steroid sulfatase locus on structurally abnormal inactive X chromosomes is expressed

In mammalian somatic cells, sex-chromosome dosage compensation is achieved by random inactivation of one of the two X chromosomes. The Xg blood group antigen (Xg) and steroid sulfatase (STS) loci on the distal end of the short arm of the X chromosome have been shown to escape this inactivation. However, it has been reported that on structurally abnormal inactive X chromosomes Xg and STS are inactivated. This discrepancy requires further consideration since whatever process accounts for the lack of inactivation of these loci on structurally normal, inactive X chromosomes might be anticipated to be operative on structurally abnormal, inactive X chromosomes. To investigate this issue, we examined the expression of STS activity in mouse-human somatic-cell hybrids retaining two different, deleted, inactive human X chromosomes. These studies provide evidence for lack of inactivation of STS on structurally abnormal, inactive X chromosomes.     

Pericentric inversion of the X chromosome: presentation of a case and review of the literature.

A large pericentric inversion of the X chromosome [inv(X)(p22.31q26.3)] was found to be transmitted in four generations through phenotypically normal males and females. In one female carrier, the inv(X) was late replicating in 70% of lymphocytes and 46% of skin fibroblasts. Steroid sulfatase (STS), an enzyme which normally escapes inactivation has been located to Xp22.32 and, in our case, has been moved to an aberrant position. We have assayed its activity in clones with the inv(X) inactive or the normal X inactive and found no significant differences. Thus, the STS locus escaped X inactivation in both the normal and the inverted X chromosomes. A review of the literature shows that almost half of the breakpoints on the short arm are found at region p22 and we propose that low-copy repetitive DNA segments along the X chromosome are responsible for non-homologous pairing and production of inversions.