Heterologous expression of alkaloid biosynthetic genes — a review

Tetrahydrobenzylisoquinoline alkaloids comprise a diverse class of secondary metabolites with many pharmacologically active members. The biosynthesis at the enzyme level of at least two tetrahydrobenzylisoquinoline alkaloids, the benzophenanthridine alkaloid sanguinarine in the California poppy, Eschscholtzia californica, and the bisbenzylisoquinoline alkaloid berbamunine in barberry, Berberis stolonifera, has been elucidated in detail starting from the aromatic amino acid (aa) l-tyrosine. In an initial attempt to develop alternate systems for the production of medicinally important alkaloids, one enzyme from each pathway (BBE, a covalently flavinylated enzyme of benzophenanthridine alkaloid biosynthesis and CYP80, a phenol coupling cytochrome P-450-dependent oxidase of bisbenzylisoquinoline alkaloid biosynthesis) has been purified to homogeneity, a partial aa sequence determined, and the corresponding cDNAs isolated with aid of synthetic oligos based on the aa sequences. The recombinant enzymes were actively expressed in Spodoptera frugiperda Sf9 cells using a baculovirus vector, purified and then characterized. Insect cell culture has proven to be a powerful system for the overexpression of alkaloid biosynthetic genes.     

Reporter genes: too much of a good thing?

Advances in viral vector design and identification of new reporter genes have allowed the development of novel delivery systems. In the presence of reporter genes, cellular transduction frequency, expression of the gene of interest and phenotypic effects in cells expressing the gene under study can now be easily monitored both in vitro and in vivo. Moreover, the presence of unique cell markers allows for the enrichment of transduced cells for research studies or patient infusion. The ideal reporter gene product should be biologically inert and not influence the cell population under investigation. Recent reports suggest that reporter gene products may not be biologically benign.     

Isolation of β-globin-related genes from a human cosmid library

A human gene library was constructed using an improved cloning technique for cosmid vectors. Human placental DNA was partially digested with restriction endonuclease Mboi, size-fractionated and ligated to BamHI-cut and phosphatase-treated cosmid vector pJB8. After packaging in λ phage particles, the recombinant DNA was transduced into Escherichia coli 1400 or HB101 followed by selection on ampicillin for recombinant E. coli. 150000 recombinant-DNA-containing colonies were screened for the presence of the human β-globin related genes. Five recombinants were isolated containing the human β-globin locus and encompassing approx. 70 kb of human DNA.     

Enrichment or depletion of a GO category within a class of genes: which test?

MOTIVATION: A number of available program packages determine the significant enrichments and/or depletions of GO categories among a class of genes of interest. Whereas a correct formulation of the problem leads to a single exact null distribution, these GO tools use a large variety of statistical tests whose denominations often do not clarify the underlying P-value computations. SUMMARY: We review the different formulations of the problem and the tests they lead to: the binomial, chi2, equality of two probabilities, Fisher's exact and hypergeometric tests. We clarify the relationships existing between these tests, in particular the equivalence between the hypergeometric test and Fisher's exact test. We recall that the other tests are valid only for large samples, the test of equality of two probabilities and the chi2-test being equivalent. We discuss the appropriateness of one- and two-sided P-values, as well as some discreteness and conservatism issues. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.     

Sequence analysis of a variety of primate fertilin α genes: Evidence for non-functional genes in the gorilla and man

The sperm surface fertilin complex was first described in the guinea pig where it was found as a heterodimer of α and β subunits, both of which were proposed to play a role in sperm-oolemma recognition and plasma membrane fusion during fertilisation. Whilst the β subunit is apparently testis-specific, the finding of low levels of fertilin α in nonreproductive tissues has cast some doubt on a unique role in fertilisation. Moreover, the absence of a functional fertilin α gene in the human would imply that this gene product is not absolutely essential for fertilisation, although it could play a facilitatory role. We now describe the organisation and sequence of the fertilin α genes in a range of primates, including the great apes, and find that the gorilla gene, like that of the human, is non-functional. Mol. Reprod. Dev. 51:92–97, 1998. © 1998 Wiley-Liss, Inc.     

Expression of somite segmentation genes in amphioxus: a clock without a wavefront?

In the basal chordate amphioxus (Branchiostoma), somites extend the full length of the body. The anteriormost somites segment during the gastrula and neurula stages from dorsolateral grooves of the archenteron. The remaining ones pinch off, one at a time, from the tail bud. These posterior somites appear to be homologous to those of vertebrates, even though the latter pinch off from the anterior end of bands of presomitic mesoderm rather than directly from the tail bud. To gain insights into the evolution of mesodermal segmentation in chordates, we determined the expression of ten genes in nascent amphioxus somites. Five (Uncx4.1, NeuroD/atonal-related, IrxA, Pcdhdelta2-17/18, and Hey1) are expressed in stripes in the dorsolateral mesoderm at the gastrula stage and in the tail bud while three (Paraxis, Lcx, and Axin) are expressed in the posterior mesendoderm at the gastrula and neurula stages and in the tail bud at later stages. Expression of two genes (Pbx and OligA) suggests roles in the anterior somites that may be unrelated to initial segmentation. Together with previous data, our results indicate that, with the exception that Engrailed is only segmentally expressed in the anterior somites, the genetic mechanisms controlling formation of both the anterior and posterior somites are probably largely identical. Thus, the fundamental pathways for mesodermal segmentation involving Notch-Delta, Wnt/beta-catenin, and Fgf signaling were already in place in the common ancestor of amphioxus and vertebrates although budding of somites from bands of presomitic mesoderm exhibiting waves of expression of Notch, Wnt, and Fgf target genes was likely a vertebrate novelty. Given the conservation of segmentation gene expression between amphioxus and vertebrate somites, we propose that the clock mechanism may have been established in the basal chordate, while the wavefront evolved later in the vertebrate lineage.     

Pollen as a vehicle for the escape of engineered genes?

Recent studies of pollen exchange between neighboring populations of plants have shown that interpopulation gene flow can proceed over much greater distances and at higher rates than hitherto believed. This means that the escape of engineered genes from crop plants to their wild relatives is not only possible, but also likely. The development of containment strategies, such as extra modifications for increased self-fertilization and decreased pollen longevity in engineered crop plants, will be necessary to safeguard against such escape.     

Human evolution: a legacy of cannibalism in our genes?

A new study of genetic variation in the human prion protein gene suggests that balancing selection has operated on an amino acid sequence polymorphism in the gene during the last five hundred thousand years. Is this a legacy of widespread cannibalism by our ancestors?     

Are chlorella viruses a rich source of ion channel genes?

Plaque-forming dsDNA (>330 kb) viruses that infect certain unicellular, eukaryotic chlorella-like green algae contain approximately 375 protein-encoding genes. These proteins include a 94 amino acid K+ channel protein, called Kcv, as well as two putative ligand-gated ion channels. The viruses also encode other proteins that could be involved in the assembly and/or function of ion channels, including protein kinases and a phosphatase, polyamine biosynthetic enzymes and histamine decarboxylase.     

What genes make a tree a tree?

Woody growth is evolutionarily ancient, yet has been gained and lost multiple times in plant evolution and is readily enhanced or minimized in eudicot speciation. New molecular genetic and genomic studies in Populus and Arabidopsis that are defining the genes responsible for cambium function and woody growth suggest that the genes regulating woody growth are not unique to woody plants. Surprisingly, key genetic mechanisms originally characterized as regulating the meristematic cells of the shoot apical meristem are also expressed in the vascular cambium during woody growth. This has important implications for the development of Populus as a model species and illustrates why forest trees constitute a contrived group of plants that have more in common with herbaceous relatives than we foresters like to admit.     

The organization of repetitive sequences in a cluster of rabbit β-like globin genes

Several complementary procedures were used to identify and characterize DNA sequences which are repeated within a 44 kilobase (kb) segment of rabbit chromosomal DNA containing four different rabbit β-like globin genes (β1–β4). Cross-hybridization between cloned DNAs from different regions of the gene cluster indicates the presence of a complex array of repeat sequences interspersed with the globin genes. We classified 20 different repeat sequences into five families whose members cross-hybridize. Electron microscopy was used to determine the location, size and relative orientations of many of the repeat sequences. Both direct and inverted repeats were identified, with sizes ranging from 140 to 1400 base pairs (bp). Each of the four closely linked globin genes is flanked by at least one pair of inverted repeats of 140–400 bp, and the entire set of four genes is flanked by an inverted repeat of 1400 bp. Two of the five repeat families contain repeat sequences of different sizes. We found that the smaller sequence elements can occur individually or in association with the larger repeat sequences, suggesting that the larger repeats may be composed of more than one smaller repeat sequence. The restriction fragments containing the intracluster repeats also contain sequences which are repeated many times in total rabbit genomic DNA, but it is not known whether the genomic and intracluster repeats are the same sequences. The results provide the first demonstration of the relationship between single-copy and repetitive DNA sequences in a large segment of chromosomal DNA containing a well characterized set of developmentally regulated genes.     

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X_4–5-C-X_22–23-H-X₁-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.     

Localization of Müllerian mimicry genes on a dense linkage map of Heliconius erato

We report a dense genetic linkage map of Heliconius erato, a neotropical butterfly that has undergone a remarkable adaptive radiation in warningly colored mimetic wing patterns. Our study exploited natural variation segregating in a cross between H. erato etylus and H. himera to localize wing color pattern loci on a dense linkage map containing amplified fragment length polymorphisms (AFLP), microsatellites, and single-copy nuclear loci. We unambiguously identified all 20 autosomal linkage groups and the sex chromosome (Z). The map spanned a total of 1430 Haldane cM and linkage groups varied in size from 26.3 to 97.8 cM. The average distance between markers was 5.1 cM. Within this framework, we localized two major color pattern loci to narrow regions of the genome. The first gene, D, responsible for red/orange elements, had a most likely placement in a 6.7-cM region flanked by two AFLP markers on the end of a large 87.5-cM linkage group. The second locus, Sd, affects the melanic pattern on the forewing and was found within a 6.3-cM interval between flanking AFLP loci. This study complements recent linkage analysis of H. erato's comimic, H. melpomene, and forms the basis for marker-assisted physical mapping and for studies into the comparative genetic architecture of wing-pattern mimicry in Heliconius.     

Heritability of cellular radiosensitivity: a marker of low-penetrance predisposition genes in breast cancer?

Many inherited cancer-prone conditions show an elevated sensitivity to the induction of chromosome damage in cells exposed to ionizing radiation, indicative of defects in the processing of DNA damage. We earlier found that 40% of patients with breast cancer and 5%-10% of controls showed evidence of enhanced chromosomal radiosensitivity and that this sensitivity was not age related. We suggested that this could be a marker of cancer-predisposing genes of low penetrance. To further test this hypothesis, we have studied the heritability of radiosensitivity in families of patients with breast cancer. Of 37 first-degree relatives of 16 sensitive patients, 23 (62%) were themselves sensitive, compared with 1 (7%) of 15 first-degree relatives of four patients with normal responses. The distribution of radiosensitivities among the family members showed a trimodal distribution, suggesting the presence of a limited number of major genes determining radiosensitivity. Segregation analysis of 95 family members showed clear evidence of heritability of radiosensitivity, with a single major gene accounting for 82% of the variance between family members. The two alleles combine in an additive (codominant) manner, giving complete heterozygote expression. A better fit was obtained to a model that includes a second, rarer gene with a similar, additive effect on radiosensitivity, but the data are clearly consistent with a range of models. Novel genes involved in predisposition to breast cancer can now be sought through linkage studies using this quantitative trait.     

Evolutionary conservation of the 3′ ends of members of a family of giant secretory protein genes inChironomus pallidivittatus

Summary Two cDNA clones representing the 3-end regions of BR1 and BR2 75S mRNA were obtained fromChironomus pallidivittatus. The regular structure characterizing the core of these genes, consisting of tandemly arranged repeat units, changes into a more irregular structure toward the 3 end. Distal to a standard type of repeat unit with a characteristic excess of positive charges, a new type of repeat with a high, negative charge density is interspersed among parts of the standard unit. The last 111 amino acids before the stop codon represent a unique region distinctly different in amino acid composition from upstream regions, and include two partially homologous hydrophobic regions. Sequence comparison of 3-end regions from clones representing BR1 and BR2 genes indicates striking sequence conservation in the unique part of the region. Analysis of the level of silent site divergence shows that the homology increases in the 3 direction up to the polyadenylation site. That the unique region is retained as a part of the secreted protein is shown by Western blotting.