The organization of the evolutionarily conserved GATA/GACA repeats in the mouse genome

Simple repeated GATA and GACA sequences which were originally isolated from sex-specific snake satellite DNA have been found subsequently in all eukaryotes studied. The organization of these sequences within the mouse genome was investigated here by using synthetic oligonucleotide probes as a novel tool in comparison with conventional hybridization probes. Southern blot hybridization showed sex-specific patterns with both the (GATA)₄ and (GACA)₄ oligonucleotide probes, as previously described with conventional probes. The quantitative analysis of two mouse DNA phage libraries and of 25 isolated GATA-positive phage clones revealed intensive interspersion of GATA sequences with GACA, and with other repetitive and single-copy sequences. Ubiquitous interspersion and homogeneous genomic distribution of GATA and GACA sequences were confirmed by hybridization in situ of the oligonucleotide probes to metaphase chromosomes. The lengths of the GATA and GACA stretches were found to vary considerably in the individual phage clones. DNA inserts from 20 phages were assigned to autosomes and sex chromosomes and three genomic fragments were found to be confined to the Y chromosome. The organization of GATA and GACA sequences is discussed in the context of their evolutionary potential and possible conservation mechanisms.     

Early stages of sex chromosome differentiation in fish as analysed by simple repetitive DNA sequences

Animal sex chromosome evolution has started on different occasions with a homologous pair of autosomes leading to morphologically differentiated gonosomes. In contrast to other vertebrate classes, among fishes cytologically demonstrable sex chromosomes are rare. In reptiles, certain motifs of simple tandemly repeated DNA sequences like (gata)_n/(gaca)_m are associated with the constitutive heterochromatin of sex chromosomes. In this study a panel of simple repetitive sequence probes was hybridized to restriction enzyme digested genomic DNA of poeciliid fishes. Apparent male heterogamety previously established by genetic experiments in Poecilia reticulata (guppy) was correlated with male-specific hybridization using the (GACA)₄ probe. The (GATA)₄ oligonucleotide identifies certain male guppies by a Y chromosomal polymorphism in the outbred population. In contrast none of the genetically defined heterogametic situations in Xiphophorus could be verified consistently using the collection of simple repetitive sequence probes. Only individuals from particular populations produced sex-specific patterns of hybridization with (GATA)₄. Additional poeciliid species (P. sphenops, P. velifera) harbour different sex-specifically organized simple repeat motifs. The observed sex-specific hybridization patterns were substantiated by banding analyses of the karyotypes and by in situ hybridization using the (GACA)₄ probe.by E.R. SchmidtDedicated to Professor Karl Sperling on the occasion of his 50th birthday     

Multiple forms of male-specific simple repetitive sequences in the genusMus

Summary Previous reports indicate that in laboratory strains of mice, males are distinct from females in possession of repetitive DNA, notably devoid of Eco RI and Hae III sites and rich in the simple tetranucleotides GATA/GACA. We report here that such sequences originated in an ancestor common to laboratory mice,Mus hortulanus, M. spretus, and possibly alsoM. cookii. Interestingly, other male-specific satellite sequences were detected inM. caroli, M. cookii, M. saxicola, andM. minutoides. This novel satellite is also likely to be composed of simple repetitious sequences, but does not contain GATA and GACA. Thus, the Y chromosome appears to contain a disproportionately large amount of simple repetitious DNA. An attractive explanation for these results is that long tandem arrays of simple repeated sequences are generated at high frequency throughout the genome and that they are retained for a longer time on the Y chromosome due to the absence of homologous pairing at meiosis.     

On sex determination in the Turkish desert woodlouse Hemilepistus elongatus (Crustacea, Isopoda, Oniscidea): searching for sex chromosomes and for sex-specific differences in simple DNA repeats.

The karyotype of male and female Hemilepistus elongatus was investigated by means of C-banding. The diploid chromosome number in both sexes is 2n = 50. By scrutinizing general morphology and localization of the constitutive heterochromatin, no heteromorphic sex chromosomes were found. All chromosome pairs in males are well paired during diakinesis. Hybridization of genomic DNA with (GACA)4 and (GATA)4 oligonucleotides revealed no sex-specific patterns. Key words : karyotype, C-banding, sex determination, simple DNA-repeats, Isopoda.     

Heterochromatin and microsatellites detection in karyotypes of four sea turtle species: Interspecific chromosomal differences

The wide variation in size and content of eukaryotic genomes is mainly attributed to the accumulation of repetitive DNA sequences, like microsatellites, which are tandemly repeated DNA sequences. Sea turtles share a diploid number (2n) of 56, however recent molecular cytogenetic data have shown that karyotype conservatism is not a rule in the group. In this study, the heterochromatin distribution and the chromosomal location of microsatellites (CA)_n, (GA)_n, (CAG)_n, (GATA)_n, (GAA)_n, (CGC)_n and (GACA)_n in Chelonia mydas, Caretta caretta, Eretmochelys imbricata and Lepidochelys olivacea were comparatively investigated. The obtained data showed that just the (CA)_n, (GA)_n, (CAG)_n and (GATA)_n microsatellites were located on sea turtle chromosomes, preferentially in heterochromatic regions of the microchromosomes (mc). Variations in the location of heterochromatin and microsatellites sites, especially in some pericentromeric regions of macrochromosomes, corroborate to proposal of centromere repositioning occurrence in Cheloniidae species. Furthermore, the results obtained with the location of microsatellites corroborate with the temperature sex determination mechanism proposal and the absence of heteromorphic sex chromosomes in sea turtles. The findings are useful for understanding part of the karyotypic diversification observed in sea turtles, especially those that explain the diversification of Carettini from Chelonini species.     

Simple repetitive sequences are associated with differentiation of the sex chromosomes in the guppy fish

Summary Hybridization of restriction enzymedigested genomic guppy (Poecilia reticulata, Poeciliidae) DNA with the oligonucleotide probe (GACA)₄ revealed a male-specific simple tandem repeat locus, which defines the Y chromosome in outbred populations. The related (GATA)₄ probe identifies certain males with the red color phenotype. In contrast only in two out of eight laboratory guppy strains was the typical (GACA)₄ band observed. By specific staining of the constitutive heterochromatin one pair of chromosomes could also be identified as the sex chromosomes, confirming the XX/XY mechanism of sex determination. All males exhibit Y chromosomes with a large region of telomeric heterochromatin. Hybridization in situ with nonradioactively labeled oligonucleotide probes localized the (GACA)_n repeats to this heterochromatic portion. Together these results may be regarded as a recent paradigm for the differentiation of heteromorphic sex chromosomes from a pair of autosomes during the course of evolution. According to the fish model system, this may have happened in several independent consecutive steps.     

Molecular genetics of sex determination in channel catfish: studies on SRY, ZFY, Bkm, and human telomeric repeats.

In amniotes, the banded krait minor (Bkm) minisatellite (GATA), the human telometric sequence (TTAGGG)7, and the Y-specific genes, ZFY and SRY, are associated with a particular sex. These sequences were studied in the channel catfish, Ictalurus punctatus. However, none was sex-specific in catfish; homologs of each were present in males and females. Our data suggest that components of mammalian sex-determining systems may be widespread and shared among the vertebrates in general. Whether those components are involved in sex determination in lower vertebrates or merely represent evolutionary precursors of sex-determining factors in amniotes remains to be determined.     

Microsatellite fingerprinting in the genus Phaseolus.

The genetic variability of the genus Phaseolus was investigated by nonradioactive DNA fingerprinting. The simple repetitive sequences (GATA)4, (GACA)4, (CAC)5, and (CA)8 were used as probes to differentiate 18 species comprised of 90 genotypes. (GATA)4, (CAC)5, and (CA)8 could be detected in the genome of nearly all species, while the (GACA)4 motif occurred only in 13 species. Almost all fragments that hybridized with (GACA)4 also hybridized with (GATA)4. All but two cultivars of Phaseolus vulgaris, P. lunatus, P. acutifolius, and P. polyanthus showed specific banding patterns with (GATA)4. The other repetitive motifs revealed only limited or no intraspecific variation. In P. vulgaris, two group-specific patterns were found with (GATA)4, giving further evidence for a Middle American and an Andean origin of the P. vulgaris genotypes. The high intraspecific pattern variation that was revealed with (GATA)4 in the predominantly self-pollinating species P. vulgaris and P. lunatus can probably be explained by there being at least two primary centres of domestication and, hence, genetic diversification. In cross-pollinating species (e.g., P. coccineus), the observed intraspecific variation was, surprisingly, rather low. The present study shows that DNA fingerprinting with microsatellites successfully distinguishes among gene pools, cultivars, and, in some cases, among individuals.     

Heterogeneities in the distribution of (GACA)n simple repeats in the karyotypes of primates and mouse

Summary Tandemly organized simple repetitive sequences are widespread in all eukaryotes. The organization of the simple tetrameric (GACA)_n sequences at chromosomal loci has been investigated using in situ hybridization with chemically pure oligonucleotide probes. Both biotin- and digoxigenin-attached (GACA)₄ probes reveal specific hybridization signals over the short arms of all acrocentric autosomes in man. In the other examined primates the NOR-bearing autosomes could be detected by in situ hybridization with (GACA)₄, and a major concentration of the GACA simple repeats could be observed on the Y chromosome in the gibbon and mouse; the hybridization site in the gibbon Y chromosome coincides particularly with the silver-stainable NOR. In the past, accumulations of (GACA)_n sequences were demonstrated mainly on vertebrate sex chromosomes. Therefore, the organization of GACA simple sequences is discussed in the context of their evolutionary potential accumulation and the possible linkage with the primate rDNA loci.     

Copy number variation in patients with disorders of sex development due to 46,XY gonadal dysgenesis

Disorders of sex development (DSD), ranging in severity from mild genital abnormalities to complete sex reversal, represent a major concern for patients and their families. DSD are often due to disruption of the genetic programs that regulate gonad development. Although some genes have been identified in these developmental pathways, the causative mutations have not been identified in more than 50% 46,XY DSD cases. We used the Affymetrix Genome-Wide Human SNP Array 6.0 to analyse copy number variation in 23 individuals with unexplained 46,XY DSD due to gonadal dysgenesis (GD). Here we describe three discrete changes in copy number that are the likely cause of the GD. Firstly, we identified a large duplication on the X chromosome that included DAX1 (NR0B1). Secondly, we identified a rearrangement that appears to affect a novel gonad-specific regulatory region in a known testis gene, SOX9. Surprisingly this patient lacked any signs of campomelic dysplasia, suggesting that the deletion affected expression of SOX9 only in the gonad. Functional analysis of potential SRY binding sites within this deleted region identified five putative enhancers, suggesting that sequences additional to the known SRY-binding TES enhancer influence human testis-specific SOX9 expression. Thirdly, we identified a small deletion immediately downstream of GATA4, supporting a role for GATA4 in gonad development in humans. These CNV analyses give new insights into the pathways involved in human gonad development and dysfunction, and suggest that rearrangements of non-coding sequences disturbing gene regulation may account for significant proportion of DSD cases.     

DNA fingerprinting in reptiles: Bkm hybridization patterns in Crocodilia and Chelonia

The simple tetranucleotide repeat GATA (GACA) occurs in all eukaryotes so far studied. In many species, the arrangement of these sequences varies considerably among individuals. Thus GATA (GACA) type probes produce DNA fingerprints when hybridized with restricted DNA from different individuals within a species. Banded krait minor (Bkm) satellite DNA (related to sequences originally recovered from the W chromosome of the banded krait and consisting essentially of a series of GATA repeats) is found in a wide spectrum of vertebrates and invertebrates. We used the Bkm 2(8) clone to evaluate the occurrence of this satellite in DNA from five species of Crocodilia and six species of Chelonia, including the sea turtles Chelonia mydas and Lepidochelys kempi. Well-resolved DNA fingerprints were obtained. Among the crocodilians, fewer restriction fragments were generated and fewer of the fragments were polymorphic, than among the chelonians, consistent with the view that the crocodilians are less divergent within species. The Bkm 2(8) clone can accordingly be used to advantage in individual, familial, and population studies, and perhaps in the evaluation of taxonomic relationships in these animals. This is of potential value in endangered species such as C. mydas and L. kempi.     

A novel testis-specific RAG2-like protein,Peas: its expression in pachytene spermatocyte cytoplasm and meiotic chromatin

We report a novel gene Peas that constitutes an overlapping gene complex in mammalian genome. We have cloned human and mouse Peas cDNAs (hPEAS/mPeas) and analyzed their tissue and stage-specific expressions. Peas protein contains six repeated kelch motifs, structurally similar to RAG2, a V(D)J recombination activator, and is evolutionarily conserved among mammals, birds, insects, and nematodes. Northern, RNA in situ hybridization and immunohistochemical analyses showed that mPeas is specifically transcribed in testis, particularly in pachytene spermatocytes in which it is localized to the cytoplasm and meiotic chromatin. It is suggested that Peas may be involved in meiotic recombination process.     

Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)_3.75, OAT18. 2 (GACA)_4.5, OAT24.2 (GACA)₆, OAT36 (GACA)₉, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)_3.75 and OAT15.2 (GACA)_3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.     

Activation of endogenous retroviral sequences in human leukemia

Endogenous retroviral sequences have been identified in the genomes of several species including humans. Proteins similar to those of primate endogenous viruses have been found on the surface of various malignant cells in man. To further define this role, we have used a primate retrovirus DNA from the Baboon Endogenous Virus to probe a human genomic library for related sequences. A total of 45 clones homologous to BaEV gag-pol were isolated under low stringency hybridization. Of these, several were found to contain DNA which was expressed as RNA at higher levels in human lymphoid leukemic cells than in normal lymphocytes.     

Genome-wide analysis of Bkm sequences (GATA repeats): predominant association with sex chromosomes and potential role in higher order chromatin organization and function

MOTIVATION: Bkm (Banded krait minor) satellite DNA sequences (GATA repeats) have been shown to be associated with the sex determining chromosomes of various eukaryotes and have been implicated in the evolution and differentiation of sex chromosomes in snakes. The objective of the study is to analyze the GATA repeats of human genome specifically, the Y-chromosome, and other model organisms to understand the possible function and potential role in higher order chromatin organization. RESULTS: Our extensive analysis of GATA repeats in the prokaryotic and eukaryotic genomes, which have been completely sequenced so far, has revealed that GATA repeats are absent in prokaryotes and have been gradually accumulated in higher organisms during the course of evolution. In human, the Y-chromosome has the highest GATA repeat density, which predominantly exists in the Yq centromeric region. Generally, occurrence of repeats in the genomes decreases steadily as the length of the repeat increases. In contrast, we report, that the occurrence of GATA repeats increases as the length of the repeat increases from six tandem repeats onwards and peaks at (GATA)(10-12). This has not been observed with any other simple repeat. Distribution of (GATA)(10-12) along the chromosome and their close proximity to Matrix Associated Regions (GATA-MAR) suggests that it may be demarking chromatin domains for a coordinated expression of genes residing in these domains.