ATP-dependent exonuclease V from Micrococcus luteus. The enzyme-DNA complex, the processive mechanism, and the role of ATP

Some kinetic predictions of the proposed processive mechanism for the hydrolysis of DNA by the ATP-dependent enzyme exonuclease V have been checked. The method is to trap enzyme molecules not attached to radioactive DNA substrate with an excess of nonradioactive DNA, so that enzyme molecules attached to the radioactive substrate contribute to the liberation of radioactive products only until they dissociate from it. The experiments show that enzyme molecules remain attached to a T7 double-stranded DNA molecule, while hydrolysing it, for about 2 min under our conditions, in agreement with the predictions of the processive mechanism. However, the mechanism of degradation of single-stranded DNA is not processive. Formation of an enzyme-DNA complex is largely dependent on the presence of ATP. This formation does not appear to be synchronous. ATP analogs do not stimulate formation of, nor stabilize, the enzyme-DNA complex. EDTA causes dissociation of enzyme molecules from the DNA complex.     

ATP-dependent exonuclease V from Micrococcus luteus The enzyme-DNA complex,the processive mechanism,and the role of ATP

Some kinetic predictions of the proposed processive mechanism for the hydrolysis of DNA by the ATP-dependent enzyme exonuclease V have been checked. The method is to trap enzyme molecules not attached to radioactive DNA substrate with an excess of nonradioactive DNA, so that enzyme molecules attached to the radioactive substrate contribute to the liberation of radioactive products only until they dissociate from it.The experiments show that enzyme molecules remain attached to a T7 double-stranded DNA molecule, while hydrolysing it, for about 2 min under our conditions, in agreement with the predictions of the processive mechanism. However, the mechanism of degradation of single-stranded DNA is not processive. Formation of an enzyme-DNA complex is largely dependent on the presence of ATP. This formation does not appear to be synchronous. ATP analogs do not stimulate formation of, nor stabilize, the enzyme-DNA complex. EDTA causes dissociation of enzyme molecules from the DNA complex.     

The mechanism of phosphoglucomutase from Micrococcus lysodeikticus

The mechanism of the phosphoglucomutase from Micrococcus lysodeikticus was investigated. Induced-transport tests at low substrate concentrations (0.15mm) showed co-transport of the (32)P label but no induced transport of the (14)C label, which is in quantitative agreement with a phosphoenzyme mechanism with a rapid isomerization of the phosphoenzyme. The results excluded an intramolecular transfer of phosphate and could only have been compatible with a sequential mechanism if the K(m) for glucose 1-phosphate had been over 20 times smaller than the measured value. The results of induced-transport tests at intermediate concentrations (1mm) with both labels agreed quantitatively with a phosphoenzyme mechanism, and induced-transport tests with (14)C-labelled substrates at high concentrations (26mm) indicated that the rate constants for isomerization of the phosphoenzyme must be greater than about 3x10(6)s(-1). Consistent with these findings is the fact that (14)C label exchanged between the substrates twice as rapidly as the (32)P label at chemical equilibrium. Further, since the (14)C label exchanged between the substrates about ten times more rapidly than between the substrates and glucose 1,6-diphosphate, glucose 1,6-diphosphate is not an obligatory intermediate in the interconversion of the substrates. It is concluded that, contrary to previous evidence, the mechanism of the enzyme from M. lysodeikticus is essentially that of the rabbit muscle enzyme. To account for the rapid isomerization of the phosphoenzyme in both cases a mechanism is proposed in which there is no formal isomerization of the phosphoenzyme.     

Membrane-reversible H+-ATPase from Micrococcus lysodeikticus.

Treatment of phosphorylating fragments of bacterial membrane from Micrococcus lysodeikticus with trypsin leads to increase ATPase activity. As a result of this treatment, the membrane fragments acquire the ability to transform the ATP energy into transmembrane difference in potential. Dithiothreitol has a similar effect to that of trypsin on the membrane fragments from M. lysodeikticus. Dicyclohexylcarbodimide inhibits ATPase of the membrane fragments of M. lysodeikticus, and also the ATPase-reaction-coupled generation of membrane potential. It has been suggested that the increased ATPase activity of membranes from M. lysodeikticus during treatment with trypsin and dithiothreitol is connected with the effect of these agents on the protein inhibitor of ATPase.     

Three-dimensional structure of catalase from Micrococcus lysodeikticus at 1.5 A resolution.

The three-dimensional crystal structure of catalase from Micrococcus lysodeikticus has been solved by multiple isomorphous replacement and refined at 1.5 A resolution. The subunit of the tetrameric molecule of 222 symmetry consists of a single polypeptide chain of about 500 amino acid residues and one haem group. The crystals belong to space group P4(2)2(1)2 with unit cell parameters a = b = 106.7 A, c = 106.3 A, and there is one subunit of the tetramer per asymmetric unit. The amino acid sequence has been tentatively determined by computer graphics model building and comparison with the known three-dimensional structure of beef liver catalase and sequences of several other catalases. The atomic model has been refined by Hendrickson and Konnert's least-squares minimisation against 94,315 reflections between 8 A and 1.5 A. The final model consists of 3,977 non-hydrogen atoms of the protein and haem group, 426 water molecules and one sulphate ion. The secondary and tertiary structures of the bacterial catalase have been analyzed and a comparison with the structure of beef liver catalase has been made.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

Partial characterization of membrane-associated proteinases from Micrococcus lysodeikticus

Summary We have identified cytoplasmic and membrane-associated proteinases from Micrococcus lysodeikticus (M. luteus) by the use of ¹²⁵I-labeled casein and insulin as substrates. The membrane-associated activities were released by shock washing. Proteolytic activities showed pH optima at slightly alkaline values and we have concentrated on the activities at pH 8.0. The total units of both proteolytic activities were higher in the cytoplasmic than in any other fractions but the situation was different when the results were expressed in terms of specific activity. The activities against casein and insulin were differentiated by the action of inhibitors, divalent metal ions, Arrhenius plots and dependence on ionic strength. On these grounds, it is proposed that the membrane-associated enzyme acting on insulin is a single thiol proteinase while the proteolysis of casein reflects the action of, at least, two enzymes (thiol proteinase and serine proteinase). The distinction between the casein and insulin degrading activities was confirmed by crossed-inhibition experiments and by their behaviour on gel chromatography and concentration-dependent experiments.The aggregating properties have hampered the purification of the enzymes. The present results raise doubts about the significance of preventing membrane damage and degradation of membrane proteins by the addition of indiscriminated proteinase inhibitors during membrane isolation and manipulation.