Characterization of a novel protein that specifically binds to DNA modified by N-acetoxy-acetylaminofluorene and cis-diamminedichloroplatinum

Proteins recognizing DNA damaged by the chemical carcinogen N-acetoxy-acetylaminofluorene (AAAF) were analyzed in nuclear extracts from rat tissues, using a 36 bp oligonucleotide as a substrate and electrophoretic mobility shift and Southwestern blot assays. One major damage-recognizing protein was detected, whose amount was estimated as at least 10(5) copies per cell. Levels of this protein were similar in extracts from brain, kidney and liver, but much lower in extracts from testis. The affinity of the detected protein for DNA damaged by AAAF was about 70-fold higher than for undamaged DNA. DNA damaged by cis-diamminedichloroplatinum (cis-DDP), benzo(a)pyrene diolepoxide (BPDE) or UV-radiation also bound this protein with an increased affinity, the former more strongly and the latter two more weakly as compared to AAAF-damaged DNA. The detected AAAF/DDP-damaged-DNA-binding (AAAF/DDP-DDB) protein had a molecular mass of about 25 kDa and was distinct from histone H1 or HMGB proteins, which are known to have a high affinity for cis-DDP-damaged DNA. The level of this damage-recognizing protein was not affected in rats treated with the carcinogen 2-acetylaminofluorene. The activity of an AAAF/DDP-DDB protein could also be detected in extracts from mouse liver cells but not from the Hep2G human hepatocellular carcinoma.     

DNA sequence context modulates the impact of a cisplatin 1,2-d(GpG) intrastrand cross-link on the conformational and thermodynamic properties of duplex DNA

The anticancer activity of cisplatin derives from its ability to bind and cross-link DNA, with the major adduct being the 1,2-d(GpG) intrastrand cross-link. Here, the consequences of this adduct on the conformation, thermal stability, and energetics of duplex DNA are assessed, and the modulation of these parameters by the sequence context of the adduct is evaluated. The properties of a family of 15-mer DNA duplexes containing a single 1,2-d(GpG) cis-?Pt(NH(3))(2)?(2+) intrastrand cross-link are probed in different sequence contexts where the flanking base-pairs are systematically varied from T.A to C.G to A.T. By using a combination of spectroscopic and calorimetric techniques, the structural, thermal, and thermodynamic properties of each duplex, both with and without the cross-link, are characterized. Circular dichroism spectroscopic data reveal that the cross-link alters the structure of the host duplex in a manner consistent with a shift from a B-like to an A-like conformation. Thermal denaturation data reveal that the cross-link induces substantial thermal and thermodynamic destabilization of the host duplex. Significantly, the magnitudes of these cross-link-induced effects on duplex structure, thermal stability, and energetics are influenced by the bases that flank the adduct. The presence of flanking A.T base-pairs, relative to T.A or C.G base-pairs, enhances the extent of cross-link-induced alteration to an A-like conformation and dampens the extent of cross-link-induced duplex destabilization. These results are discussed in terms of available structural data, and in terms of the selective recognition of cisplatin-DNA adducts by HMG-domain proteins.     

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Thermodynamic properties of duplex DNA containing a site-specific d(GpG) intrastrand crosslink formed by an antitumor dinuclear platinum complex

Bifunctional polynuclear platinum compounds represent a novel class of metal-based antitumor drugs which are currently undergoing preclinical development. A typical agent is [(trans-PtCl(NH(3))(2))(2)H(2)N(CH(2))(4)NH(2)]Cl(2) (1,1/t,t), which coordinates to bases in DNA and forms various types of covalent crosslinks. It also forms a 1,2-d(GpG) intrastrand adduct, the equivalent of the major DNA lesion of 'classical' cisplatin. In the present study differential scanning calorimetry and spectroscopic techniques were employed to characterize the influence of this crosslink on the thermal stability and energetics of 20 bp DNA duplexes site-specifically modified by 1,1/t,t. Thermal denaturation data revealed that the crosslink of 1,1/t,t reduced thermal and thermodynamical stability of the duplex noticeably more than that of 'classical' cisplatin. The energetic consequences of the intrastrand crosslink at the d(GG) site are discussed in relation to the structural distortions induced by this adduct in DNA and to its recognition and binding by HMG domain proteins. It has been suggested that the results of the present work are consistent with different DNA binding modes of cisplatin and polynuclear bifunctional DNA-binding drugs, which might be relevant to their distinct biological effectiveness.     

HMG-domain protein recognition of cisplatin 1,2-intrastrand d(GpG) cross-links in purine-rich sequence contexts

HMG-domain proteins bind strongly to bent DNA structures, including cruciform and cisplatin-modified duplexes. Such protein-platinated DNA complexes, formed where the DNA is modified by the active cis but not the inactive trans isomer of diamminedichloroplatinum(II), are implicated in the cytotoxic mechanism of the drug. A series of oligonucleotide duplexes with deoxyguanosine nucleosides flanking a cis-[Pt(NH(3))(2)?d(GpG)-N7(1),-N7(2)?] cross-link have been synthesized. These probes were used to determine the flanking sequence dependence of the affinity of the individual HMG domains of HMG1 toward cisplatin-modified DNA. Nine related sequences, where N(1) and N(2) are not dG and GG is the 1,2-intrastrand cisplatin adduct in N(1)GGN(2), were previously investigated [Dunham, S. U., and Lippard, S. J. (1997) Biochemistry 36, 11428-11436]. Three of the seven remaining possible sequences for which N(1) and/or N(2) was dG were prepared here by using normal deoxyguanosine, but the rest, where N(1) is dG and N(2) is dA, dC, T, or dG, could not be isolated in pure form. These sequences were accessed by using the synthetic bases 7-deazaadenine and 7-deazaguanine, which lack the nucleophilic N7 atom in the purine ring. Deaza nucleotides accurately mimic the properties of the natural bases, allowing the interaction of the HMG-domain proteins with cisplatin-modified DNA to be examined. These experiments reveal that the flexibility of A.T versus G.C flanking base pairs, rather than base-specific contacts, determines HMG1domA protein selectivity. This conclusion was supported by use of mutant HMG1domA and HMG1domB proteins, which exhibit identical flanking sequence selectivity. The methods and results obtained here not only improve our understanding of how proteins might mediate cisplatin genotoxicity but also should apply more generally in the investigation of how other proteins interact with damaged DNA.     

Characterization of a novel transformation-sensitive heat-shock protein (HSP47) that binds to collagen

The synthesis of a major collagen-binding glycoprotein of molecular weight 47,000 was previously shown to be regulated by malignant transformation as well as by heat shock in chick embryo fibroblasts. The 47-kDa protein purified from chick embryos was characterized biochemically, and was found to exist as a monomer in native form. Its composition was enriched in basic amino acids and glycine, with fewer acidic residues and virtually no cysteine. N-terminal amino acid sequencing covering 36 residues revealed a single, novel sequence with an internal tandem repeat of Asp-Lys-Ala-Thr-Thr-Leu-Ala and Asp-Arg-Ser-Thr-Thr-Leu-Ala.     

Identification of a cell surface protein from Crandell feline kidney cells that specifically binds Aleutian mink disease parvovirus

Aleutian mink disease parvovirus (ADV) is the etiological agent of Aleutian disease of mink. The acute disease caused by ADV consists of permissive infection of alveolar type II cells that results in interstitial pneumonitis. The permissive infection is experimentally modeled in vitro by infecting Crandell feline kidney (CrFK) cells with a tissue culture-adapted isolate of ADV, ADV-G. ADV-G VP2 empty virions expressed in a recombinant baculovirus system were analyzed for the ability to bind to the surface of CrFK cells. Radiolabeled VP2 virions bound CrFK cells specifically, while they did not bind either Mus dunni or Spodoptera frugiperda cells, cells which are resistant to ADV infection. The binding to CrFK cells was competitively inhibited by VP2 virions but not by virions of cowpea chlorotic mottle virus (CCMV), another unenveloped virus similar in size to ADV. Furthermore, preincubation of CrFK cells with the VP2 virions blocked infection by ADV-G. The VP2 virions were used in a virus overlay protein binding assay to identify a single protein of approximately 67 kDa, named ABP (for ADV binding protein), that demonstrates specific binding of VP2 virions. Exogenously added VP2 virions were able to competitively inhibit the binding of labeled VP2 virions to ABP, while CCMV virions had no effect. Polyclonal antibodies raised against ABP reacted with ABP on the outer surface of CrFK cells and blocked infection of CrFK cells by ADV-G. In addition, VP2 virion attachment to CrFK cells was blocked when the VP2 virions were preincubated with partially purified ABP. Taken together, these results indicate that ABP is a cellular receptor for ADV.     

Characterization of a protein that binds multiple sequences in mammalian type C retrovirus enhancers.

Mammalian type C retrovirus enhancer factor 1 (MCREF-1) is a nuclear protein that binds several directly repeated sequences (CNGGN6CNGG) in the Moloney and Friend murine leukemia virus (MLV) enhancers (N. R. Manley, M. O'Connell, W. Sun, N. A. Speck, and N. Hopkins, J. Virol. 67:1967-1975, 1993). In this paper, we describe the partial purification of MCREF-1 from calf thymus nuclei and further characterize the binding properties of MCREF-1. MCREF-1 binds four sites in the Moloney MLV enhancer and three sites in the Friend MLV enhancer. Ethylation interference analysis suggests that the MCREF-1 binding site spans two adjacent minor grooves of DNA.     

Characterization of a multisubunit human protein which selectively binds single stranded d(GA)n and d(GT)n sequence repeats in DNA.

A protein which selectively binds d(GA)n and d(GT)n sequence repeats in single stranded DNA has been identified in human fibroblasts. This protein, designated PGB, has been purified at least 500-fold by ammonium sulfate precipitation followed by DEAE-Sepharose column chromatography and affinity chromatography in a column of d(GA)-Sepharose. Electrophoretic mobility shift assays revealed that the PGB protein bound most avidly d(GA)n and d(GT)n tracts of n > 5. It also bound other G-rich DNA sequence repeats, including dGn tracts, with lower affinities. It did not manifest significant binding affinities to single stranded M13 DNA, or to the homopolynucleotides poly dA, poly dC and poly dT, or to various DNA sequence repeats which do not contain G residues, such as d(A-C)n and d(TC)n. It did not bind double stranded d(T-C)n.d(GA)n tracts or other double stranded DNA sequences. In glycerol gradient centrifugation assays the d(GA)n- and the d(GT)n-binding activities cosedimented as a homogeneous protein species having an S20,w = 9.4 +/- 0.7 and an estimated native molecular weight of 190,000 +/- 7,000. UV crosslinking assays revealed that the protein contains 33.6 +/- 2.1 kd subunits which bind d(GA)n and d(GT)n sequences. However, SDS-polyacrylamide gel electrophoresis of the purified protein followed by silver staining indicated that it may also contain other subunits that do not contact the DNA. It is proposed that binding of the PGB protein to single stranded d(GA)n or d(GT)n tracts in double stranded topologically restricted DNA may stimulate strand separation and formation of triple helices or other unusual DNA structures.     

Solution structure of a DNA duplex containing a cis-diammineplatinum(II) 1,3-d(GTG) intrastrand cross-link, a major adduct in cells treated with the anticancer drug carboplatin.

The platinum 1,3-d(GXG) intrastrand cross-link is one of the adducts formed in the reaction of the antitumor drug cisplatin with DNA, and in fact the major adduct found in cells treated with the cisplatin analogue carboplatin. To determine the 3D structure of this adduct, the duplex d(CTCTGTGTCTC).d(GAGACACAGAG)], where GTG denotes a platinum 1,3-intrastrand cross-link, was prepared and studied with high-resolution (1)H NMR. The solution structure was determined using the SPEDREF protocol, which includes an iterative NOE-restrained refinement procedure. Calculated and recorded NOE spectra were found to be in good agreement (NMR R factor 22%). The studied duplex is more distorted from B-DNA than previously determined structures of the 1,2-d(GG) intrastrand adducts. The base pairing is lost for the 5'G-C and the central T-A base pair in the GTG lesion, and the central thymine is extruded from the minor groove. To accommodate this lesion, the minor groove is widened, and the 5'-guanine ribose adopts an N-type conformation. The helix is unwound locally and is significantly bent toward the major groove. Significant difference between the structural distortion of the 1, 3-d(GTG) cross-link and other Pt-DNA cross-links sheds new light on the observed differences in protein recognition of these lesions, and thus on the possible differences in mechanisms of action of the various Pt-DNA adducts formed in treatment with platinum anticancer complexes.     

On the role of proofreading exonuclease in bypass of a 1,2 d(GpG) cisplatin adduct by the herpes simplex virus-1 DNA polymerase

UL30, the herpes simplex virus type-1 DNA polymerase, stalls at the base preceding a cisplatin crosslinked 1,2 d(GpG) dinucleotide and engages in a futile cycle of incorporation and excision by virtue of its 3'-5' exonuclease. Therefore, we examined the translesion synthesis (TLS) potential of an exonuclease-deficient UL30 (UL30D368A). We found that UL30D368A did not perform complete translesion synthesis but incorporated one nucleotide opposite the first base of the adduct. This addition was affected by the propensity of the enzyme to dissociate from the damaged template. Consequently, addition of the polymerase processivity factor, UL42, increased nucleotide incorporation opposite the lesion. The addition of Mn(2+), which was previously shown to support translesion synthesis by wild-type UL30, also enabled limited bypass of the adduct by UL30D368A. We show that the primer terminus opposite the crosslinked d(GpG) dinucleotide and at least three bases downstream of the lesion is unpaired and not extended by the enzyme. These data indicate that the primer terminus opposite the lesion may be sequestered into the exonuclease site of the enzyme. Consequently, elimination of exonuclease activity alone, without disrupting binding, is insufficient to permit bypass of a bulky lesion by this enzyme.     

Identification and characterization of a bovine sperm protein that binds specifically to single-stranded telomeric deoxyribonucleic acid

Telomere DNA at the physical termini of chromosomes forms a single-stranded 3' overhang. In lower eukaryotes, e.g., ciliated protozoa, this DNA extension is capped by specific proteins that have been structurally and functionally characterized. Much less is known about single-stranded telomere DNA-binding proteins in vertebrates. Here we describe a new protein from bovine sperm designated bsSSTBP that specifically interacts with single-stranded (TTAGGG)(N) DNA. The bsSSTBP was extracted from nuclei by 0.6 M KCl. The native size of this protein, estimated by gel filtration, was 20-40 kDa. SDS-PAGE of the UV cross-linked complex between bsSSTBP and telomere DNA indicated that several polypeptides are involved in complex formation. Bovine sSSTB had high specificity toward nucleotide sequence, since single nucleotide substitutions in the (TTAGGG)(4) substrate suppressed binding. The minimal number of (TTAGGG) repeats required for binding of bsSSTBP was 3, and the protein recognized linear but not folded DNA structures. We propose that the bsSSTBP participates in telomere-telomere interactions and the telomere membrane localization observed in mature sperm. In mammals, somatic telomere-binding proteins are apparently substituted by sperm-specific ones that may lead to a structural reorganization of telomere domains to fulfill functions important during meiosis and fertilization.     

Characterization of a monoclonal antibody that specifically binds to choline phospholipids and its use in immunocytochemistry.

A monoclonal IgM (MC22-33F), raised in response to mouse embryonic dental papilla cells, was selected for further analysis on the basis of the unusual resistance of its epitope to detergent extractions and protease treatments of cell cultures. Binding of MC22-33F to cultured cells was abolished after either pre-treatment of the cells with phospholypase C or pre-incubation of the hybridoma culture supernatant with multilamellar phosphatidylcholine-containing vesicles. MC22-33F reacted with phosphatidylcholine, with the phosphatidylcholine analogue dimethylphosphatidylethanolamine, and with sphingomyelin immobilized on polystyrene surfaces or in thin-layer chromatograms. Crossreaction with other phospholipids was not observed. The surface of cultured epithelial cells was labeled by MC22-33F at sites of bleb formation. Combining immunostaining by MC22-33F and histochemical staining of cultured cells revealed codistribution of phospholipid-containing inclusions with either lysosomes or neutral fat droplets, and inhibition of lipid degradation by kanamycin resulted in a parallel accumulation of these inclusions and of neutral fats in the cytoplasm. Immunolabeling by MC22-33F of frozen mouse tissues was maximal in fat-storing and steroid-producing cells. Extracellular phospholipids present in calcifying cartilage septa strongly reacted with MC22-33F. This monoclonal antibody offers an interesting alternative to histochemical lipid stains for investigating fatty metamorphosis and extracellular lipid deposition under physiological and pathological conditions.     

Characterization of autoantibody-secreting B cells in mice undergoing stimulatory (chronic) graft-versus-host reactions. Identification of a CD44hi population that binds specifically to hyaluronate

This study was undertaken to identify and isolate the pathophysiologically important B cell subpopulation which is activated to Ig secretion and autoantibody production in stimulatory (chronic) graft-vs-host (GVH) reactions. We recently demonstrated that IL-5 stimulation in vitro induces the appearance of a distinct CD44hi Ialow CD45Rlow B cell subpopulation that has aquired the ability to bind to hyaluronate (HA), one of the ligands for CD44, and that this B cell subpopulation is enriched in both proliferative and Ig-secretory responses. In the present report, CD44 expression was examined in B cells which were activated in the course of stimulatory GVH reactions. Compared with normal mice, B cells from mice undergoing stimulatory GVH reactions contained a novel CD44hi B cell subpopulation which exhibited enhanced binding to HA. The CD44hi HA-adherent B cell subpopulation from GVH mice spontaneously secreted large amounts of Ig, particularly IgG, including autoantibody specific for ssDNA. These findings demonstrate that CD44 expression distinguishes those B cells that are activated in vivo in the course of GVH to proliferate and differentiate into Ig-secreting cells. These CD44hi, HA-adherent, cells may play a prominent role in the hypergammaglobulinemia and immune complex glomerulonephritis that occur during chronic GVH reactions.     

KIN17, a mouse nuclear protein, binds to bent DNA fragments that are found at illegitimate recombination junctions in mammalian cells

Illegitimate recombination is the dominant mechanism of recombination in mammalian somatic cells. It is responsible for most genome rearrangements such as translocations, deletions and integrations. Little is known as yet about the mechanism of illegitimate recombination and the enzymes involved. Recently, it has been shown that intrinsically bent DNA, also known as curved DNA, is present at chromosomal sites of illegitimate recombination events. Here we report that KIN17, a new mouse nuclear protein, binds to the curved DNA fragments found at illegitimate recombination sites.     

Mutagenic and genotoxic effects of DNA adducts formed by the anticancer drug cis-diamminedichloroplatinum(II).

The toxicity and mutagenicity of three DNA adducts formed by the anticancer drug cis-diamminedichloroplatinum(II) (cis-DDP or cisplatin) were investigated in Escherichia coli. The adducts studied were cis-[Pt(NH3)2(d(GpG))] (G*G*), cis-[Pt(NH3)2(d(ApG))] (A*G*) and cis-[Pt(NH3)2(d(GpTpG))] (G*TG*), which collectively represent approximately 95% of the DNA adducts reported to form when the drug damages DNA. Oligonucleotide 24-mers containing each adduct were positioned at a known site within the viral strand of single stranded M13mp7L2 bacteriophage DNA. Following transfection into E. coli DL7 cells, the genomes containing the G*G*, A*G* and G*TG* adducts had survival levels of 5.2 +/- 1.2, 22 +/- 2.6 and 14 +/- 2.5% respectively, compared to unmodified genomes. Upon SOS induction, the survival of genomes containing the G*G* and A*G* adducts increased to 31 +/- 5.4 and 32 +/- 4.9% respectively. Survival of the genome containing the G*TG* adduct did not increase upon SOS induction. In SOS induced cells, the G*G* and A*G* adducts gave rise predominantly to G-->T and A-->T transversions respectively, targeted to the 5' modified base. In addition, A-->G transitions were detected for the A*G* adduct and low levels of tandem mutations at the 5' modified base as well as the adjacent 5' base were also observed for both adducts. The A*G* adduct was more mutagenic than the G*G* adduct, with a mutation frequency of 6% compared to 1.4% for the latter adduct. No cis-[Pt(NH3)2)2+ intrastrand crosslink-specific mutations were observed for the G*TG* adduct.