A set of 4 nuclear proteins binds to a DNA sequence within the FOS promoter region

We investigated DNA-protein-interactions occurring in the promoter region of c-fos using two-dimensional electrophoresis and south-western-blotting. When nuclear extracts from the human glioblastoma cell line HeRoSV were tested for their DNA-binding behaviour to a 650 bp-fragment within the promoter region of c-fos, we found 4 proteins designated as 120/6.6, 75/5.4, 65/6.4 55/5.0 interacting with this fragment. An additional protein 60/6.0 was detected by using a digoxygenine-labelled probe. These observations let us to assume that beside the well characterized SRF and FOS-JUN proteins additional factors recognize the promoter sequence and may play a role in c-fos regulation.Abbreviations DRE direct repeat element - DSE dyad symmetry element - DTE Dithiothreitol - EGF Epidermal growth factor - FCS fetal calf serum - PA polyacrylamide - PMSF Phenylmethylsulfonyl fluoride - SDS Sodiumdodecylsulfate - SRF serum response factor - TCF ternary complex factor - TPA 12-O-tetradecanoyl phorbol-13-acetate - 2D two-dimensional     

Identification of non-telomeric G4-DNA binding proteins in human,E. coli,yeast, and Arabidopsis

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.