Electron spin resonance studies of membrane proteins in erythrocytes in myotonic muscular dystrophy.

A goat antibody produced against bovine adrenal ferredoxin has been employed to establish immunochemically the involvement of adrenal ferredoxin in the cholesterol side-chain cleavage reaction catalyzed by mammalian adrenal mitochondria. When added to preparations of bovine adrenocortical mitochondria, this antibody was found to inhibit the conversion of cholesterol to pregnenolone and progesterone, the 11β-hydroxylation of deoxycorticosterone and the NADPH-dependent reduction of cytochrome c. These observations demonstrate that, similar to the NADPH-cytochrome c reductase and steroid 11β-hydroxylase reactions, adrenal ferredoxin is also required for the oxidative cleavage of the cholesterol side-chain catalyzed by bovine adrenocortical mitochondria.The goat antibody to bovine adrenal ferredoxin was also found to interact with the comparable iron-sulfur proteins present in mitochondria prepared from sheep, rat, mouse, cat, dog, guinea pig, rabbit, and human adrenals. The interaction of the antibody with these iron-sulfur proteins resulted in the inhibition of both the cholesterol side-chain cleavage and NADPH-cytochrome c reductase activities catalyzed by these adrenal mitochondria. The NADH-dependent reduction of cytochrome c catalyzed by mammalian adrenal mitochondria was not inhibited by the goat antibody to adrenal ferredoxin. These results demonstrate the immunochemical similarity existing among mammalian adrenal ferredoxins and their involvement in the adrenal cholesterol side-chain cleavage reaction.     

Immunochemical studies on adrenal ferredoxin: Involvement of adrenal ferredoxin-like iron-sulfur proteins in the cholesterol side-chain cleavage reaction of mammalian steroidogenic tissues

The possible immunochemical and functional similarities existing among adrenal ferrdoxin-like iron-sulfur proteins present in the mitochondria of mammalian steroidogenic tissues have been examined by employing a goat antibody produced against homogeneous bovine adrenal ferredoxin. This antibody was found to inhibit the NADPH-cytochrome c reductase and cholesterol side-chain cleavage activities catalyzed by mitochondria prepared from rat adrenals, rat ovaries and the testes of rats which had been treated with human chorionic gonadotropin. No inhibition of the NADH-dependent reduction of cytochrome c catalyzed by these mitochondria was observed in the presence of the anti-adrenal ferredoxin. These results demonstrate that adrenal ferredoxin and the comparable iron-sulfur proteins of ovarian and testicular mitochondria are immunochemically similar and are required for the cholesterol side-chain cleavage reaction occurring in these tissues. Although a precipitin reaction was observed upon double diffusion of the anti-adrenal ferredoxin against human term placental mitochondria, no inhibition of either the NADPH-cytochrome c reductase or the cholesterol side-chain cleavage⁴ activity catalyzed by preparations of these mitochondria was observed in the presence of the antibody. These results indicate that the iron-sulfur protein present in human placental mitochondria at term differs immunochemically from other mammalian adrenal ferredoxin-like iron-sulfur proteins.     

Two plant-type ferredoxins from a blue-green alga, Nostoc verrucosum

Two plant-type ferredoxins were isolated and purified from a blue-green alga, Nostoc verrucosum. They were separable by chromatography on a DEAE-cellulose column. The slow-moving band was designated ferredoxin I (Fd I) and the fast-moving band was ferredoxin II (Fd II). The ratio of the yield of ferredoxins I and II was about 1:0.84. Both ferredoxins had absorption spectra similar to those of plant-type ferredoxins. Two atoms of non-heme iron and two of labile sulfur were found per mol of both ferredoxin I and ferredoxin II. Their molecular weights were identical and estimated to be about 18 000 by a gel filtration method. The biochemical activities of these Nostoc ferredoxins were studied: the NADP photoreduction activity on one hand and the NADP-cytochrome c reductase activity on the other.     

Photosynthetic Electron Transport Chain of Chlamydomonas reinhardi. V. Purification and Properties of Cytochrome 553 and Ferredoxin

Cytochrome 553 and ferredoxin were isolated and purified from acetone powders prepared from intact cells of the wild-type strain of Chlamydomonas reinhardi. Purification was achieved by ion exchange chromatography on DEAE cellulose and gel filtration on Sephadex G-75.     

Interactions between spinach ferredoxin and other electron carriers. The involvement of a ferredoxin:cytochrome c complex in the ferredoxin-linked cytochrome c reductase activity of ferredoxin:NADP+ oxidoreductase.

The trinitrophenylation of a single amino group of spinach ferredoxin abolishes its ability to inhibit the diaphorase activity of the flavoprotein, ferredoxin:NADP oxidoreductase (EC 1.6.7.1); in contrast, the ability of ferredoxin to participate in the ferredoxin-linked cytochrome c reductase activity catalyzed by the flavoprotein is unaffected. Comparison with previously published results [Davis, D. J., and San Pietro, A. (1977) Biochem. Biophys. Res. Commun.74, 33–40]indicates that the site of interaction between ferredoxin and the flavoprotein resulting in inhibition if diaphorase activity is responsible for the spectrally observable 1:1 complex between the two proteins and is identical to the site of ferredoxin involvement in NADP photoreduction. The role of ferredoxin in the ferredoxin-linked cytochrome c reductase activity of the flavoprotein has been reexamined under conditions were the entire electron-accepting system (rather than just the ferredoxin component) is rate limiting. The data support a mechanism by which ferredoxin can bind either to the flavoprotein or to cytochrome c, and the ferredoxin:cytochrome c complex serves as the true substrate for reduction by the flavoprotein. Furthermore, Chromatographic evidence is presented for the formation of complexes between ferredoxin and cytochrome c.     

Low-temperature magnetic circular dichroism evidence for the conversion of four-iron-sulphur clusters in a ferredoxin from Clostridium pasteurianum into three-iron-sulphur clusters

Oxidation of the 8Fe ferredoxin from Clostridium pasteurianum with potassium ferricyanide, followed by purification on Sephadex G-25 and DE-23 cellulose columns, gives a protein with an intense EPR signal at g 2.01. The low-temperature magnetic circular dichroism (MCD) spectra of this species are different from those of the oxidized high-potential iron protein from Chromatium but identical with the spectra of ferredoxin II from Desulphovibrio gigas. On reduction of the ferricyanide-treated ferredoxin with sodium dithionite only a weak EPR signal with g factors of 2.05, 1.94 and 1.89 is obtained. The low-temperature MCD spectra are strongly temperature dependent with a form similar to those of dithionite-reduced D. gigas ferredoxin II. The MCD magnetization curves are dominated by a species with ground-state effective g factors of $\text{g}{}_{\mathrm{?}}$ 8.0 and g_⊥ 0.0, which are also similar to those determined recently by low-temperature MCD spectroscopy for D. gigas ferredoxin II. The MCD characteristics are quite different from those of dithionite-reduced ferredoxin from Cl. pasteurianum, untreated with ferricyanide. This establishes the close similarity of the iron-sulphur clusters in ferricyanide-treated Cl. pasteurianum ferredoxin and in D. gigas ferredoxin II. The latter is known to contain a single 3Fe centre, similar to that observed in ferredoxin I from Azotobacter vinelandii by X-ray crystallography. Therefore, it is concluded that the [4Fe-4S] clusters of Cl. pasteurianum ferredoxin are converted to 3Fe clusters on oxidation with ferricyanide.     

Semisynthetic synthesis and biological activity of a clostridial-type ferredoxin free of aromatic amino acid residues

Clostridium M-E ferredoxin has been chemically modified by replacing the only aromatic amino acid residue it contains, Tyr², with leucine. The resulting Clostridium M-E [Leu²]ferredoxin, which is devoid of aromatic amino acid residues, is as active as the native Clostridium M-E ferredoxin or as Clostridium acidi-urici ferredoxin as an electron carrier in the phosphoroclastic enzyme system.     

Isolation and Role of Nonheme Iron Protein in Clostridium botulinum

A type of iron-bound protein was isolated from Clostridium botulinum by a modification of the method used for isolating ferredoxin from C. pasteurianum. This method involved acetone and diethylaminoethyl cellulose treatments followed by ammonium sulfate fractionation. The protein exhibited maximal absorption in the ultraviolet region near 260 mμ. Portions of the isolated iron protein were separated by disc electrophoresis and, following specific iron-bound protein staining, showed a positive reaction in the same position on the gel column as was first demonstrated by use of cell-free extract. Evidence accumulated by use of a cell-free extract of C. botulinum suggests that pyruvate is metabolized through a phosphoroclastic system as demonstrated in other clostridia. It is probable that ferredoxin is an electron mediator between pyruvic oxidase and hydrogenase for hydrogen evolution and acetyl phosphate formation.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Photosynthetic characterization of flavodoxin-expressing tobacco plants reveals a high light acclimation-like phenotype

Flavodoxins are electron carrier flavoproteins present in bacteria and photosynthetic microorganisms which duplicate the functional properties of iron-sulphur containing ferredoxins and replace them under adverse environmental situations that lead to ferredoxin decline. When expressed in plant chloroplasts, flavodoxin complemented ferredoxin deficiency and improved tolerance to multiple sources of biotic, abiotic and xenobiotic stress. Analysis of flavodoxin-expressing plants grown under normal conditions, in which the two carriers are present, revealed phenotypic effects unrelated to ferredoxin replacement. Flavodoxin thus provided a tool to alter the chloroplast redox poise in a customized way and to investigate its consequences on plant physiology and development. We describe herein the effects exerted by the flavoprotein on the function of the photosynthetic machinery. Pigment analysis revealed significant increases in chlorophyll a, carotenoids and chlorophyll a/b ratio in flavodoxin-expressing tobacco lines. Results suggest smaller antenna size in these plants, supported by lower relative contents of light-harvesting complex proteins. Chlorophyll a fluorescence and P700 spectroscopy measurements indicated that transgenic plants displayed higher quantum yields for both photosystems, a more oxidized plastoquinone pool under steady-state conditions and faster plastoquinone dark oxidation after a pulse of saturating light. Many of these effects resemble the phenotypes exhibited by leaves adapted to high irradiation, a most common environmental hardship faced by plants growing in the field. The results suggest that flavodoxin-expressing plants would be better prepared to cope with this adverse situation, and concur with earlier observations reporting that hundreds of stress-responsive genes were induced in the absence of stress in these lines.     

Antigenic similarities between ferredoxin-dependent nitrite reductase and glutamate synthase fromChlamydomonas reinhardtii

Polyclonal antisera were prepared against ferredoxin-nitrite reductase (EC 1.7.7.1) and ferredoxin-glutamate synthase (glutamate synthase (ferredoxin); EC 1.4.7.1) from the green algaChlamydomonas reinhardtii. The anti-glutamate synthase antibodies recognized both glutamate synthase and nitrite reductase, but inhibited only the ferredoxin-linked activity of the latter enzyme and not the activity dependent on methyl viologen. Analogously, the anti-nitrite reductase antibodies recognized glutamate synthase and nitrite reductase but the first enzyme was only poorly inhibited. Free ferredoxin protected the nitrite reductase against its inactivation by anti-glutamate synthase antibodies. These results indicate that the ferredoxin-dependent glutamate synthase and nitrite reductase from this alga share common antigenic determinants, and that these are located at the ferrodoxin-binding domains.     

Primary structure of a 7Fe ferredoxin from Streptomyces griseus

The complete primary structure of a Streptomyces griseus (ATCC 13273) 7Fe ferredoxin, which can couple electron transfer between spinach ferredoxin reductase and S. griseus cytochrome P-450_soy for NADPH-dependent substrate oxidation, has been determined by Edman degradation of the whole protein and peptides derived by Staphylococcus aureus V8 proteinase and trypsin digestion. The protein consists of 105 amino acids and has a calculated molecular weight, including seven irons and eight sulfurs, of 12291. The ferredoxin sequence is highly homologous (73%) to that of the 7Fe ferredoxin from Mycobacterium smegmatis. The N-terminal half of the sequence, which is the FeS clusters binding domain, has more than 50% homology with other 7Fe ferredoxins. In particular, the seven cysteines known from the crystal structure of Azotobacter vinelandii ferredoxin I to be involved in binding the two FeS clusters are conserved.     

Properties and regulation of synthesis of two ferredoxins from Rhodopseudomonas capsulata

Two ferredoxins from nitrogen-fixing cells of the phototrophic bacterium Rhodopseudomonas capsulata, strain B10, are purified to a homogeneous state and characterized. The molecular mass of ferredoxin I is about 12 kDa and that of ferredoxin II, 18 kDa. Ferredoxin I contains 8 Fe²⁺ and 8 S^2?; ferredoxin II has 4 Fe²⁺ and 4 S^2? per molecule. The redox potential of ferredoxin I is about ?270 mV and that of ferredoxin II ?419 mV. Ferredoxin I is more labile to the action of O₂, O^?₂, H₂O₂ and heating. The ferredoxins are also different in their absorption and EPR spectra, amino acid composition and electron-transfer activity to Rps. capsulata nitrogenase: both C₂H₂ reduction and H₂ evolution by Rps. capsulata nitrogenase proceed faster in the presence of ferredoxin I than in case of ferredoxin II. Synthesis of ferredoxin I takes place only in Rps. capsulata nitrogen-fixing cells grown in light under anaerobic conditions whereas ferredoxin II formation does not depend on the source of nitrogen or the growth medium, though the amount of ferredoxin II varies with the growth conditions. Its highest level has been found in the cells grown in lactate-limited medium in the presence of CO₂ and light or in the presence of glutamate in darkness under anaerobic conditions.     

Immunohistochemical localization of adrenal ferredoxin and distribution of adrenal ferredoxin and cytochrome P-450 in the rat adrenal

Adrenal ferredoxin, the iron-sulfur protein associated with cytochromes P-450 in adrenocortical mitochondria, has been localized immunohistochemically at the light microscopic level in rat adrenals by employing rabbit antiserum to bovine adrenal ferredoxin in both an unlabeled antibody peroxidase-antiperoxidase method and an indirect fluorescent antibody method. When sections of rat adrenals were exposed to the adrenal ferredoxin antiserum in both procedures, positive staining for adrenal ferredoxin was observed in parenchymal cells of the three cortical zones but not in medullary chromaffin cells. Marked differences in the intensity of staining, however, where observed among the three cortical zones: the most intense staining being found in the zona fasciculata, less in the zona reticularis, and least in the zona glomerulosa. Furthermore, differences in staining intensity were also observed among cells within both the zona fasciculata and the zona reticularis. In agreement with these immunohistochemical observations, determinations of adrenal ferredoxin contents by electron paramagnetic resonance (EPR) spectrometry in homogenates prepared from capsular and decapsulated rat adrenals revealed that the concentration of adrenal ferredoxin in the zona glomerulosa was lower than that in the zona fasciculata-reticularis. Similar results were obtained when the contents of cytochrome P-450 were determined in capsular adn decapsulated rat adrenal homogenates. These observations indicate that adrenal ferrodoxin and cytochrome P-450 are not distributed uniformly throughout the rat adrenal cortex.     

Studies on photosystem I. II. Involvement of ferredoxin in cyclic electron flow

The effects of ferredoxin (Fd) and ferredoxin-NADP reductase on the light-induced spectral changes of cytochrome f (cyt f) were investigated with specific reference to their possible involvement in the cyclic electron transfort pathway of photosystem I (PS I). The steady-state level of photooxidation of reduced cytochrome f is decreased by ferredoxin but unaffected by either ferredoxin-NADP reductase alone or ferredoxin plus ferredoxin-NADP reductase when present in equimolar concentrations. These data are taken as evidence for a cyclic electron transport pathway of: PS I → “X” → Fd → (cyt f) → PC → PS I. The reduced ferredoxin could either reduce directly plastocyanin (PC) or via cytochrome f; the data do not allow differentiation between these two possibilities. However, neither ferredoxin-NADP reductase nor cytochrome b564 appear to serve as electron carriers in this pathway.     

Immunological quantitation of chloroplast ferredoxin

An immunoassay for the quantitative determination of ferredoxins in cell-free extracts from plant tissues is described. The method is accurate for the assay of 0.3–1.5 nmol ferredoxin directly from the extracts. The following average values (nmol ferredoxin/mg extractable protein) were obtained: 3.9, 1.8, 5.90, 14.8 and 10.9 for Euglena gracilis, spinach, parsley, lettuce and broccoli, respectively. Specific factors affecting the method are discussed in detail.     

Two sites of interaction of ferredoxin with thylakoids

The interaction of ferredoxin with thylakoids is shown to occur at two distinct sites: at the reducing end of photosystem I, and at the site where ferredoxin-NADP reductase (FNR) is located on the membrane. The evidence is based on the lack of inhibition of ferredoxin photoreduction by the extraction of FNR or its inactivation by an antibody, and on the difference between K_m values for ferredoxin in reactions requiring FNR as compared to those only requiring ferredoxin.     

Protein modulase appears to be a complex of ferredoxin, ferredoxin/thioredoxin reductase, and thioredoxin

Protein modulase and ferredoxin/thioredoxin reductase are soluble proteins that have been suggested to catalyze the light-dependent modulation of enzyme activity in the stromal compartment of the chloroplast. Protein modulase is active in vitro without additional ferredoxin and thioredoxin, whereas ferredoxin/thioredoxin reductase requires additional ferredoxin and thioredoxin. We hypothesize that protein modulase is a complex protein composed of ferredoxin/thioredoxin reductase, ferredoxin, and thioredoxin. In reconstituted chloroplast systems, antiserum directed against ferredoxin, at concentrations sufficient to inhibit the photoreduction of NADP, had no effect on light modulation. Antiserum directed against thioredoxin gave variable results: one batch of polyclonal antibodies inhibited light modulation, another was stimulatory, and another was without effect. These results suggest that the ferredoxin and thioredoxin active in light modulation are not free in solution. Furthermore, molecular sieve chromatography of stromal proteins results in the elution of four species that catalyze light modulation. Based on whether or not ferredoxin and/or thioredoxin must be added for activity, these four species have been tentatively identified as protein modulase, a complex of ferredoxin/thioredoxin reductase and ferredoxin, a complex of ferredoxin/thioredoxin reductase and thioredoxin, and ferredoxin/thioredoxin reductase. That is, the four correspond to all the possible combinations of ferredoxin, ferredoxin/thioredoxin reductase, and thioredoxin. We suggest that buffer ionic strength affects the interactions among these proteins and in part determines the fate of the protein modulase complex in vitro.     

Purification and characterization of a 7Fe ferredoxin from Streptomyces griseus

A ferredoxin has been purified from Streptomyces griseus grown in soybean flour-containing medium. The homogeneous protein has a molecular weight near 14000 as determined by both PAGE and size exclusion chromatography. The iron and labile sulfide content is 6–7 atoms/mole protein. EPR spectroscopy of native S. griseus ferredoxin shows an isotropic signal at g=2.01 which is typical of [3Fe-4S]¹⁺ clusters and which quantitates to 0.9 spin/mole. Reduction of the ferredoxin by excess dithionite at pH 8.0 produces an EPR silent state with a small amount of a g=1.95 type signal. Photoreduction in the presence of deazaflavin generates a signal typical of [4Fe-4S]¹⁺ clusters at much higher yields (0.4–0.5 spin/mole) with major features at g-values of 2.06, 1.94, 1.90 and 1.88. This latter EPR signal is most similar to that seen for reduced 7Fe ferredoxins, which contain both a [3Fe-4S] and [4Fe-4S] cluster. In vitro reconstitution experiments demonstrate the ability of the S. grisues ferredoxin to couple electron transfer between spinach ferredoxin reductase and S. griseus cytochrome P-450_soy for NADPH-dependent substrate oxidation. This represents a possible physiological function for the S. griseus ferredoxin, which if true, would be the first functional role demonstrated for a 7Fe ferredoxin.