Enhanced base-pair opening in the adenine tract of a RNA double helix

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the kinetics and energetics of base-pair opening in two nucleic acid double helices. One is the RNA duplex 5'-r(GCGAUAAAAAGGCC)-3'/5'-r(GGCCUUUUUAUCGC)-3', which contains a central tract of five AU base pairs. The other is the homologous DNA duplex with a central tract of five AT base pairs. The rates and the equilibrium constants of the opening reaction of each base pair are measured from the dependence of the exchange rates of imino protons on ammonia concentration, at 10 °C. The results reveal that the tract of AU base pairs in the RNA duplex differs from the homologous tract of AT base pairs in DNA in several ways. The rates of opening of AU base pairs in RNA are high and increase progressively along the tract, reaching their largest values at the 3'-end of the tract. In contrast, the opening rates of AT base pairs in DNA are much lower than those of AU base pairs. Within the tract, the largest opening rate is observed for the AT base pair at the 5'-end of the tract. These differences in opening kinetics are paralleled by differences in the stabilities of individual base pairs. All AU base pairs in the RNA are less stable than the AT base pairs in the DNA. The presence of the tract enhances these differences by increasing the stability of AT base pairs in DNA while decreasing the stability of AU base pairs in RNA. Due to these divergent trends, along the tracts, the AU base pairs become progressively less stable than AT base pairs. These findings demonstrate that tracts of AU base pairs in RNA have specific dynamic and energetic signatures that distinguish them from similar tracts of AT base pairs in DNA.     

Kinetics and energetics of base-pair opening in 5'-d(CGCGAATTCGCG)-3' and a substituted dodecamer containing G.T mismatches.

Proton nuclear magnetic resonance (NMR) spectroscopy is used to characterize the kinetics and energetics of base-pair opening in the dodecamers 5'-d(CGCGAATTCGCG)-3' and 5'-d(CGCGAATTTGCG)-3'. The latter dodecamer contains two symmetrical G.T mismatched base pairs. The exchange kinetics of imino protons is measured from resonance line widths and selective longitudinal relaxation times. For the G.T pair, the two imino protons (G-N1H and T-N3H) provide probes for the opening of each base in the mismatched pair. The lifetimes of individual base pairs in the closed state and the equilibrium constants for formation of the open state are obtained from the dependence of the exchange rates on the concentration of ammonia catalyst. The activation energies and standard enthalpy changes for base-pair opening are obtained from the temperature dependence of the lifetimes and equilibrium constants, respectively. The results indicate that the G.T mismatched pairs are kinetically and energetically destabilized relative to normal, Watson-Crick base pairs. The lifetimes of the G.T pairs are of the order of 1 ms or less, over the temperature range from 0 to 20 degrees C. The equilibrium constants for base-pair opening, at 20 degrees C, are increased up to 4000-fold, relative to those of normal base pairs. The energetic destabilization of the G.T base pairs is, at least in part, enthalpic in origin. The presence of the G.T mismatched base pairs destabilizes also neighboring base pairs.(ABSTRACT TRUNCATED AT 250 WORDS)     

High base pair opening rates in tracts of GC base pairs

Sequence-dependent structural features of the DNA double helix have a strong influence on the base pair opening dynamics. Here we report a detailed study of the kinetics of base pair breathing in tracts of GC base pairs in DNA duplexes derived from 1H NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia. In the limit of infinite exchange catalyst concentration, the exchange times of the guanine imino protons of the GC tracts extrapolate to much shorter base pair lifetimes than commonly observed for isolated GC base pairs. The base pair lifetimes in the GC tracts are below 5 ms for almost all of the base pairs. The unusually rapid base pair opening dynamics of GC tracts are in striking contrast to the behavior of AT tracts, where very long base pair lifetimes are observed. The implication of these findings for the structural principles governing spontaneous helix opening as well as the DNA-binding specificity of the cytosine-5-methyltransferases, where flipping of the cytosine base has been observed, are discussed.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Proton exchange and base pair opening in a DNA triple helix

Nuclear magnetic resonance spectroscopy has been used to characterize opening reactions and stabilities of individual base pairs in two related DNA structures. The first is the triplex structure formed by the DNA 31-mer 5'-AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT-3'. The structure belongs to the YRY (or parallel) family of triple helices. The second structure is the hairpin double helix formed by the DNA 20-mer 5'-AGAGAGAACCCCTTCTCTCT-3' and corresponds to the duplex part of the YRY triplex. The rates of exchange of imino protons with solvent in the two structures have been measured by magnetization transfer from water and by real-time exchange at 10 degrees C in 100 mM NaCl and 5 mM MgCl2 at pH 5.5 and in the presence of two exchange catalysts. The results indicate that the exchange of imino protons in protonated cytosines is most likely limited by the opening of Hoogsteen C+G base pairs. The base pair opening parameters estimated from imino proton exchange rates suggest that the stability of individual Hoogsteen base pairs in the DNA triplex is comparable to that of Watson-Crick base pairs in double-helical DNA. In the triplex structure, the exchange rates of imino protons in Watson-Crick base pairs are up to 5000-fold lower than those in double-helical DNA. This result suggests that formation of the triplex structure enhances the stability of Watson-Crick base pairs by up to 5 kcal/mol. This stabilization depends on the specific location of each triad in the triplex structure.     

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.     

Sequence-dependence of the energetics of opening of at basepairs in DNA

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the energetics of opening of AT/TA basepairs in the DNA dodecamer 5'-d(GCTATAAAAGGG)-3'/5'-d(CCCTTTTATAGC)-3'. The dodecamer contains the TATA box of the adenovirus major late promoter. The equilibrium constants for opening of each basepair are measured from the dependence of the exchange rates of imino protons on ammonia concentration. The enthalpy, entropy, and free energy changes in the opening reaction of each basepair are determined from the temperature dependence of the exchange rates. The results reveal that the opening enthalpy changes encompass a wide range of values, namely, from 17 to 29 kcal/mol. The largest values are observed for the AT basepairs in 7th and 8th positions. These values, and the exchange rates of the corresponding imino protons, suggest that these two basepairs open in a single concerted reaction. The enthalpy changes for opening of the central six basepairs are correlated to the opening entropy changes. This enthalpy-entropy compensation minimizes the variations in the opening free energies among these central basepairs. Deviations from the enthalpy-entropy compensation pattern are observed for basepairs located close to the ends of the duplex structure, suggesting a different mode of opening for these basepairs.     

1H NMR study of the base-pairing reactions of d(GGAATTCC): salt and polyamine effects on the imino proton exchange

Salts and polyamines have a variety of effects on the physical properties of DNA, including stabilization against thermal melting. We wished to gain greater insight into the mechanism of this stabilization by ascertaining its effect on the dynamics of base opening and closing reactions, as measured by NMR. Since the binding of spermidine(3+) is influenced by salt, and since spermidine may act as a base catalyst in proton exchange reactions, we have undertaken a study of salt and base catalyst effects on the imino proton exchange kinetics of a model oligomeric DNA. The selective longitudinal NMR relaxation rates of the hydrogen-bonded imino protons of the self-complementary octadeoxyribonucleotide d(GGAATTCC) monitor the rate of the base-catalyzed chemical exchange of these protons with solvent water. The exchange rates thus obtained provide a sensitive measure of the base-pair opening reactions of the DNA duplex. Under conditions of low pH and no added base catalyst, the NMR relaxation rates allow the determination of kd, the rate constant for the dissociation of the octameric duplex into single strands. Titration with the base catalyst tris(hydroxymethyl)aminomethane allows the determination of kop, the rate constant for the localized opening of individual base pairs, prior to dissociation. A significant Na+ concentration dependence is found for kd. From an analysis of this dependence, it is determined that 0.6 +/- 0.1 sodium ion is released during the dissociation event. The activation energy for helix dissociation (200 +/- 5 kJ/mol) is not dependent on the sodium ion concentration, indicating that the dissociation is entropically driven by the release of bound sodium ions.(ABSTRACT TRUNCATED AT 250 WORDS)     

Selective catalysis of A.T base pair proton exchange in DNA complexes: imino proton NMR analysis.

Polyaromatic molecules with amino chain substituents, upon binding with DNA, selectively catalyze exchange of the A.T base pair protons with bulk water protons. The amine-catalyzed exchange is mediated by compounds which are A.T and G.C base sequence specific, intercalators, and outside binders. A mechanism for the selective exchange, involving transient opening and closing of individual A.T base pairs in the duplex, is discussed.     

Structural energetics and base-pair opening dynamics in sarcin-ricin domain RNA

The sarcin-ricin domain is a universal element of the RNA from the large ribosomal subunit. The domain is part of the binding site for elongation factors and is specifically cleaved by the toxins alpha-sarcin and ricin. In this work, we have mapped the energetics and dynamics of individual structural motifs in a 29-mer RNA oligomer containing the sarcin-ricin domain. The stability of individual base pairs in the structure was characterized from measurements of the exchange rates of imino protons using nuclear magnetic resonance spectroscopy at 10 degrees C. The measurements also provided the rates of opening and closing for selected base pairs. The results reveal that the structural stabilization free energies in the sarcin-ricin domain are broadly distributed between 2.9 and 10.6 kcal/mol. One of the least stable sites in the structure is the noncanonical G-A base pair located next to the phosphodiester bond that is cleaved by alpha-sarcin. The low stability of this base pair supports the proposal that cleavage by alpha-sarcin occurs by a base flipping mechanism. The opening dynamics of other base pairs is affected by elements of the structure such as the bulged-G motif and its cross-strand stacking. Participation in these motifs increases the lifetimes of the bases in an open, solvent-accessible conformation.     

Kinetics for exchange of imino protons in the d(C-G-C-G-A-A-T-T-C-G-C-G) double helix and in two similar helices that contain a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and an extra adenine, d(C-G-C-A-G-A-A-T-T-C-G-C-G)

The relaxation lifetimes of imino protons from individual base pairs were measured in (I) a perfect helix, d(C-G-C-G-A-A-T-T-C-G-C-G), (II) this helix with a G . C base pair replaced with a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and (III) the perfect helix with an extra adenine base in a mismatch, d(C-G-C-A-G-A-A-T-T-C-G-C-G). The lifetimes were measured by saturation recovery proton nuclear magnetic resonance experiments performed on the imino protons of these duplexes. The measured lifetimes of the imino protons were shown to correspond to chemical exchange lifetimes at higher temperatures and spin-lattice relaxation times at lower temperatures. Comparison of the lifetimes in these duplexes showed that the destabilizing effect of the G . T base pair in II affected the opening rate of only the nearest-neighbor base pairs. For helix III, the extra adenine affected the opening rates of all the base pairs in the helix and thus was a larger perturbation for opening of the base pairs than the G . T base pair. The temperature dependence of the exchange rates of the imino proton in the perfect helix gives values of 14-15 kcal/mol for activation energies of A . T imino protons. These relaxation rates were shown to correspond to exchange involving individual base pair opening in this helix, which means that one base-paired imino proton can exchange independent of the others. For the other two helices that contain perturbations, much larger activation energies for exchange of the imino protons were found, indicating that a cooperative transition involving exchange of at least several base pairs was the exchange mechanism of the imino protons. The effects of a perturbation in a helix on the exchange rates and the mechanisms for exchange of imino protons from oligonucleotide helices are discussed.     

Thermodynamics and kinetics for base-pair opening in the P1 duplex of the Tetrahymena group I ribozyme

The thermodynamics and kinetics for base-pair opening of the P1 duplex of the Tetrahymena group I ribozyme were studied by NMR hydrogen exchange experiments. The apparent equilibrium constants for base pair opening were measured for most of the imino protons in the P1 duplex using the base catalysts NH3, HPO4(2-) or TRIS. These equilibrium constants were also measured for several modified P1 duplexes, and the C-2.G23 base pair was the most stable base pair in all the duplexes. The conserved U-1*G22 base pair is required for activity of the ribozyme and the data here show that this wobble base pair destabilizes neighboring base pairs on only one side of the wobble. A 2'-OMe modification on the U-3 residue stabilized its own base pair but had little effect on the neighboring base pairs. Three base pairs, U-1*G22, C-2*G23 and A2*U21 showed unusual equilibrium constants for opening and possible implications of the opening thermodynamics of these base pairs on the undocking rates of the P1 helix with catalytic core are discussed.     

1H NMR determination of base-pair lifetimes in oligonucleotides containing single base mismatches

Proton nuclear magnetic resonance (NMR) spectroscopy is employed to characterize the kinetics of base-pair opening in a series of 9mer duplexes containing different single base mismatches. The imino protons from the different mismatched, as well as fully matched, duplexes are assigned from the imino-imino region in the WATERGATE NOESY spectra. The exchange kinetics of the imino protons are measured from selective longitudinal relaxation times. In the limit of infinite exchange catalyst concentration, the exchange times of the mismatch imino protons extrapolate to much shorter lifetimes than are commonly observed for an isolated GC base pair. Different mismatches exhibit different orders of base-pair lifetimes, e.g. a TT mismatch has a shorter base-pair lifetime than a GG mismatch. The effect of the mismatch was observed up to a distance of two neighboring base pairs. This indicates that disruption in the duplex caused by the mismatch is quite localized. The overall order of base-pair lifetimes in the selected sequence context of the base pair is GC > GG > AA > CC > AT > TT. Interestingly, the fully matched AT base pair has a shorter base-pair lifetime relative to many of the mismatches. Thus, in any given base pair, the exchange lifetime can exhibit a strong dependence on sequence context. These findings may be relevant to the way mismatch recognition is accomplished by proteins and small molecules.     

Energetics of base pair opening in a DNA dodecamer containing an A3T3 tract.

Nuclear magnetic resonance spectroscopy has been used to characterize the kinetics and energetics of opening of base pairs in the DNA dodecamer [d(CGCAAATTTGCG)]2. The dodecamer contains an A3T3 tract that induces intrinsic curvature of the helix axis. Previous studies from this and other laboratories have shown that the kinetics of base pair opening in AnTn tracts is unique: the opening rates of the A.T base pairs in the interior of the tract are much lower than that of the A.T base pair at the 5'-end of the tract. In the present work, we have investigated the energetics of the pathways for opening of the A.T base pairs in the A3T3 tract. The energetic parameters of the activated state(s) are obtained from the temperature dependence of the opening rate constants. The lower opening rates for the A.T base pairs situated in the interior of the tract are shown to originate from higher activation enthalpies which are compensated, in part, by increases in the activation entropies. We have also obtained an energetic characterization of the open state(s) of the A.T base pairs in the dodecamer by measuring the equilibrium constants for base pair opening and their temperature dependence. The results suggest that the transitions from closed to open state(s) in the A.T base pairs of the A3T3 tract are energetically similar.     

Proton nuclear magnetic resonance investigation of the conformation and dynamics in the synthetic deoxyribonucleic acid decamers d(ATATCGATAT) and d(ATATGCATAT)

A variety of one-dimensional proton NMR methods have been used to investigate the properties of two synthetic DNA decamers, d(ATATCGATAT) and d(ATATGCATAT). These results, in conjunction with the results of two-dimensional NMR experiments, permit complete assignment of the base proton resonances. Low-field resonances were assigned by sequential "melting" of the A . T base pairs and by comparison of the spectra of the two decamers. Below 20 degree C spin-lattice relaxation is dominated by through-space dipolar interactions. A substantial isotope effect on the G imino proton relaxation is observed in 75% D2O, confirming the importance of the exchangeable amino protons in the relaxation process. A somewhat smaller isotope effect is observed on the T imino proton relaxation. At elevated temperatures spin-lattice relaxation of the imino protons is due to proton exchange with solvent. Apparent activation energies for exchange vary from 36 kcal/base pair for base pairs (3,8) to 64 kcal/mol for the most interior base pairs (5,6), indicating that disruption of part, or all, of the double helix contributes significantly to the exchange of the imino protons in these decamers. By contrast, single base pair opening events are the major low-temperature pathways for exchange from A X T and G X C base pairs in the more stable higher molecular weight DNA examined in other studies. The temperature dependence of the chemical shifts and line widths of certain aromatic resonances indicates that the interconversion between the helix and coil states is not in fast exchange below the melting temperature, Tm. Within experimental error, no differential melting of base pairs was found in either molecule, and both exhibited melting points Tm = 50-52 degrees C. Spin-spin and spin-lattice relaxation rates of the nonexchangeable protons (TH6, AH8, and AH2) are consistent with values calculated by using an isotropic rotor model with a rotational correlation time of 6 ns and interproton distances appropriate for B-family DNA. The faster decay of AH8 compared with GH8 is attributed to an interaction between the thymine methyl protons and the AH8 protons in adjacent adenines (5'ApT3'). The base protons (AH8, GH8, and TH6) appear to be located close (1.9-2.3 A) to sugar H2',2" protons.(ABSTRACT TRUNCATED AT 400 WORDS)     

AT-rich region and repeated sequences - the essential elements of replication origins of bacterial replicons

Repeated sequences are commonly present in the sites for DNA replication initiation in bacterial, archaeal, and eukaryotic replicons. Those motifs are usually the binding places for replication initiation proteins or replication regulatory factors. In prokaryotic replication origins, the most abundant repeated sequences are DnaA boxes which are the binding sites for chromosomal replication initiation protein DnaA, iterons which bind plasmid or phage DNA replication initiators, defined motifs for site-specific DNA methylation, and 13-nucleotide-long motifs of a not too well-characterized function, which are present within a specific region of replication origin containing higher than average content of adenine and thymine residues. In this review, we specify methods allowing identification of a replication origin, basing on the localization of an AT-rich region and the arrangement of the origin's structural elements. We describe the regularity of the position and structure of the AT-rich regions in bacterial chromosomes and plasmids. The importance of 13-nucleotide-long repeats present at the AT-rich region, as well as other motifs overlapping them, was pointed out to be essential for DNA replication initiation including origin opening, helicase loading and replication complex assembly. We also summarize the role of AT-rich region repeated sequences for DNA replication regulation.     

Statistical significance of symmetrical and repetitive segments in DNA.

Methods of computer analysis for the recurrence of symmetrical and repetitive elements in large numbers of DNA sequences are described, together with derivations of appropriate quantitative criteria for the evaluation of the statistical significance of these elements in DNAs of different base composition. Examples of some extraordinary variations in the occurrence of symmetrical and repetitive elements are provided, many of which are new. Special consideration is devoted to a determination of the statistical significance of a two-fold palindrome at the origin of replication. A computer search of 14 independently determined DNA sequences containing an origin of replication locus indicates each contains a large two-fold palindrome. The average length of this palindrome is 28 +/- 6 base pairs, of which 22 contribute to the palindromic symmetry. The probability of occurrence of such a palindrome is only 1/26000, while the probability of occurrence in all 14 different species is (1/26000).     

Evidence for a chromosome origin unwinding system broadly conserved in bacteria

Genome replication is a fundamental requirement for the proliferation of all cells. Throughout the domains of life, conserved DNA replication initiation proteins assemble at specific chromosomal loci termed replication origins and direct loading of replicative helicases (1). Despite decades of study on bacterial replication, the diversity of bacterial chromosome origin architecture has confounded the search for molecular mechanisms directing the initiation process. Recently a basal system for opening a bacterial chromosome origin (oriC) was proposed (2). In the model organism Bacillus subtilis, a pair of double-stranded DNA (dsDNA) binding sites (DnaA‐boxes) guide the replication initiator DnaA onto adjacent single-stranded DNA (ssDNA) binding motifs (DnaA‐trios) where the protein assembles into an oligomer that stretches DNA to promote origin unwinding. We report here that these core elements are predicted to be present in the majority of bacterial chromosome origins. Moreover, we find that the principle activities of the origin unwinding system are conserved in vitro and in vivo. The results suggest that this basal mechanism for oriC unwinding is broadly functionally conserved and therefore may represent an ancestral system to open bacterial chromosome origins.     

Conserved DNA structures in origins of replication.

According to the model of Bramhill and Kornberg, initiation of DNA replication in prokaryotes involves binding of an initiator protein to origin DNA and subsequent duplex opening of adjacent direct repeat sequences. In this report, we have used computer analysis to examine the higher-order DNA structure of a variety of origins of replication from plasmids, phages, and bacteria in order to determine whether these sequences are localized in domains of altered structure. The results demonstrate that the primary sites of initiator protein binding lie in discrete domains of DNA bending, while the direct repeats lie within well-defined boundaries of an unusual anti-bent domain. The anti-bent structures arise from a periodicity of A3 and T3 tracts which avoids the 10-11 bp bending periodicity. Since DNA fragments which serve as replicators in yeast also contain these two conserved structural elements, the results provide new insight into the universal role of conserved DNA structures in DNA replication.