cis sequences involved in modulating expression of Bacillus licheniformis amyL in Bacillus subtilis: effect of sporulation mutations and catabolite repression resistance mutations on expression.

Nutrient conditions which trigger sporulation also activate expression of the Bacillus licheniformis alpha-amylase gene, amyL. Glucose represses both spore formation and expression of amyL. A fusion was constructed between the B. licheniformis alpha-amylase regulatory and 5' upstream sequences (amyRi) and the Escherichia coli lacZ structural gene to identify sequences involved in mediating temporal activation and catabolite repression of the amyL gene in Bacillus subtilis. amyRi-directed expression in a variety of genetic backgrounds and under different growth conditions was investigated. A 108-base-pair sequence containing an inverted repeat sequence, ribosome-binding site, and 26 codons of the structural gene was sufficient to mediate catabolite repression of amyL. spo0 mutations (spo0A, spo0B, spo0E, and spo0H) had no significant effect on temporal activation of the gene fusion when the recipient strains were grown in nonrepressing medium. However, in glucose-grown cultures the presence of a spo0A mutation resulted in more severe repression of amyRi-lacZ. In contrast, a spo0H mutation reduced the repressive effect of glucose on amyRi-lacZ expression. The spo0A effect was relieved by an abrB mutation. Initiation of sporulation is not a prerequisite for either temporal activation or derepression of alpha-amylase synthesis. Mutations causing resistance to catabolite repression in B. subtilis GLU-47, SF33, WLN30, and WLN104 also relieved catabolite repression of amyRi-lacZ.     

Molecular cloning of cis-acting regulatory alleles of the Bacillus subtilis amyR region by using gene conversion transformation.

Three cis-acting alleles (gra-10, gra-5, and amyR2) of the Bacillus subtilis amyR promoter locus each cause catabolite repression-resistance of amyE-encoded alpha-amylase synthesis. The gra-10, gra-5, and amyR2 alleles were transferred from the chromosomes of their respective hosts to a plasmid carrying the amyR1-amyE+ gene by the process of gene conversion which is carried out during transformation of competent B. subtilis by plasmid clones carrying homologous DNA. The cloned amyR promoter regions containing the gra-10 and gra-5 mutations were shown to confer catabolite repression-resistance in cis to the synthesis of chloramphenicol acetyltransferase encoded by the cat-86 indicator gene when subcloned into the promoter-probe plasmid pPL603B. Implications concerning both the regulation of amyR utilization and the process of gene conversion in B. subtilis are discussed.     

Expression of the promoter for the maltogenic amylase gene in Bacillus subtilis 168

An additional amylase, besides the typical alpha-amylase, was detected for the first time in the cytoplasm of B. subtilis SUH4-2, an isolate from Korean soil. The corresponding gene (bbmA) encoded a maltogenic amylase (MAase) and its sequence was almost identical to the yvdF gene of B. subtilis 168, whose function was unknown. Southern blot analysis using bbmA as the probe indicated that this gene was ubiquitous among various B. subtilis strains. In an effort to understand the physiological function of the bbmA gene in B. subtilis, the expression pattern of the gene was monitored by measuring the beta-galactosidase activity produced from the bbmA promoter fused to the amino terminus of the lacZ structural gene, which was then integrated into the amyE locus on the B. subtilis 168 chromosome. The promoter was induced during the mid-log phase and fully expressed at the early stationary phase in defined media containing beta-cyclodextrin (beta-CD), maltose, or starch. On the other hand, it was kept repressed in the presence of glucose, fructose, sucrose, or glycerol, suggesting that catabolite repression might be involved in the expression of the gene. Production of the beta-CD hydrolyzing activity was impaired by the spo0A mutation in B. subtilis 168, indicating the involvement of an additional regulatory system exerting control on the promoter. Inactivation of yvdF resulted in a significant decrease of the beta-CD hydrolyzing activity, if not all. This result implied the presence of an additional enzyme(s) that is capable of hydrolyzing beta-CD in B. subtilis 168. Based on the results, MAase encoded by bbmA is likely to be involved in maltose and beta-CD utilization when other sugars, which are readily usable as an energy source, are not available during the stationary phase.     

Significance of HPr in catabolite repression of alpha-amylase.

CcpA and HPr are presently the only two proteins implicated in Bacillus subtilis global carbon source catabolite repression, and the ptsH1 mutation in the gene for the HPr protein was reported to relieve catabolite repression of several genes. However, alpha-amylase synthesis by B. subtilis SA003 containing the ptsH1 mutation was repressed by glucose. Our results suggest HPr(Ser-P) may be involved in but is not required for catabolite repression of alpha-amylase, indicating that HPr(Ser-P) is not the sole signaling molecule for CcpA-mediated catabolite repression in B. subtilis.     

Isolation of Mutants Defective in α-Amylase from Bacillus subtilis: Genetic Analyses

The rate of alpha-amylase (EC 3.2.1.1) synthesis in Bacillus subtilis is regulated by a gene, amyR, located near a structural gene, amyE, for the enzyme. To construct a fine map of the amyR-amyE region, we isolated 28 mutants defective in alpha-amylase activity. Eleven mutants out of 28 showed no alpha-amylase activity, whereas the other 17 showed less alpha-amylase activity than the parent. Out of 17 partially positive alpha-amylase mutants, 10 produced temperature-sensitive enzymes, and 4 produced immunologically altered enzymes, two of which are concurrently temperature-sensitive, and 5 produced smaller amounts of alpha-amylases which are indistinguishable from normal enzyme in their temperature sensitivity and immunological properties. Two out of 11 alpha-amylase-negative mutants produced material that cross-reacted with anti-amylase serum, and 3 mutants carried suppressible mutations by the suppressor described by Okubo. Mapping data indicate that all 28 mutation sites are located in the amyE region, and none of the groups of the mutants mentioned above contains lesions that are clustered in a single region of amyE. The amyR gene seems most likely to adjoin the terminal region of amyE.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

Effect of decoyinine on the regulation of alpha-amylase synthesis in Bacillus subtilis.

Decoyinine, an inhibitor of GMP synthetase, allows sporulation in Bacillus subtilis to initiate and proceed under otherwise catabolite-repressing conditions. The effect of decoyinine on alpha-amylase synthesis in B. subtilis, an event which exhibits regulatory features resembling sporulation initiation, was examined. Decoyinine did not overcome catabolite repression of alpha-amylase synthesis in a wild-type strain of B. subtilis but did cause premature and enhanced synthesis in a mutant strain specifically blocked in catabolite repression of alpha-amylase synthesis. Decoyinine had no effect on alpha-amylase enzymatic activity. Thus, it appears that the catabolite control mechanisms governing alpha-amylase synthesis and sporulation in B. subtilis differ in their responses to decoyinine and hence must consist at least partially of separate components.     

Genetic Control of the Rate of α-Amylase Synthesis in Bacillus subtilis

The level of extracellular alpha-amylase (EC 3.2.1.1) of Bacillus subtilis Marburg was increased about fivefold by introducing the amyR marker from B. natto 1212 through transformation. amyR2 of B. natto 1212 has been assumed to determine a high level of alpha-amylase of the organism. The gene acts specifically on alpha-amylase synthesis but not on the production of other extracellular enzymes. alpha-Amylase of an amyR2-carrying strain was found to be quite similar to that of an isogenic amyR1-carrying strain in the thermostability and electrophoretic behavior of whichever amylase the strain produces. Marburg-type alpha-amylase (amyEm) or B. natto-alpha-amylase (amyEn). Anti-amylase serum titration indicates that a high level of the enzyme activity in the amyR2-carrying strain is caused by the existence of more enzyme rather than the presence of an enzyme having higher efficiency. This is supported further by the fact that amyR controls the synthesis of the amyE gene product in mutant M9, which synthesizes a temperature-sensitive-alpha-amylase, and in mutant M07, which secretes cross-reacting material. The results indicate that amyR regulates the rate of alpha-amylase synthesis.     

The gene amyE(TV1) codes for a nonglucogenic alpha-amylase from Thermoactinomyces vulgaris 94-2A in Bacillus subtilis.

We isolated the gene amyE(TV1) from Thermoactinomyces vulgaris 94-2A encoding a nonglucogenic alpha-amylase (AmyTV1). A chromosomal DNA fragment of 2,247 bp contained an open reading frame of 483 codons, which was expressed in Escherichia coli and Bacillus subtilis. The deduced amino acid sequence of the AmyTV1 protein was confirmed by sequencing of several peptides derived from the enzyme isolated from a T. vulgaris 94-2A culture. The amino acid sequence was aligned with several known alpha-amylase sequences. We found 83% homology with the 48-kDa alpha-amylase part of the Bacillus polymyxa beta-alpha-amylase polyprotein and 50% homology with Taka amylase A of Aspergillus oryzae but only 45% homology with another T. vulgaris amylase (neopullulanase, TVA II) recently cloned from strain R-47. The putative promoter region was characterized with primer extension and deletion experiments and by expression studies with B. subtilis. Multiple promoter sites (P3, P2, and P1) were found; P1 alone drives about 1/10 of the AmyTV1 expression directed by the native tandem configuration P3P2P1. The expression levels in B. subtilis could be enhanced by fusion of the amyE(TV1) coding region to the promoter of the Bacillus amyloliquefaciens alpha-amylase gene.     

Isolation and expression of a constitutive variant of the chloramphenicol-inducible plasmid gene cat-86 under control of the Bacillus subtilis 168 amylase promoter

The amyR1 region controls the regulated expression of the Bacillus subtilis 168 amylase gene amyE. When cloned into the B. subtilis promoter-cloning plasmid pPL603, amyR1 has been shown to activate expression of the promoter-indicator gene cat-86. In this chimeric plasmid, p5' alpha B10, cat-86 expression was maximal in stationary phase B. subtilis cells and cat-86 expression was repressible by glucose. Both these properties are similar to the regulated expression of the B. subtilis amyE gene. In addition, cat-86 expression in p5' alpha B10 was inducible with chloramphenicol (Cm). The inducibility phenotype of cat-86 has been shown to be independent of the promoter that is used to activate the gene, and inducibility has been suggested to result from the presence of a pair of inverted-repeat sequences that span the ribosome-binding site (RBS) for cat-86. A spontaneous deletion mutant of p5' alpha B10 was isolated, p5' alpha B10 delta 1, in which cat-86 expression was constitutive with respect to Cm, but the basic pattern of amyR1-directed regulation of cat-86 was intact. The rightward deletion endpoint was within the upstream member of the pair of inverted repeats that immediately precede cat-86. This result is therefore consistent with the role proposed for the inverted repeats in Cm inducibility. The leftward endpoint of the deletion is within the amyR1 region and thus allows a more precise determination of the functional domain of amyR1.     

Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis.

In gram-positive bacteria, HPr, a phosphocarrier protein of the phosphoenolpyruvate:sugar phosphotransferase system (PTS), is phosphorylated by an ATP-dependent, metabolite-activated protein kinase on seryl residue 46. In a Bacillus subtilis mutant strain in which Ser-46 of HPr was replaced with a nonphosphorylatable alanyl residue (ptsH1 mutation), synthesis of gluconate kinase, glucitol dehydrogenase, mannitol-1-P dehydrogenase and the mannitol-specific PTS permease was completely relieved from repression by glucose, fructose, or mannitol, whereas synthesis of inositol dehydrogenase was partially relieved from catabolite repression and synthesis of alpha-glucosidase and glycerol kinase was still subject to catabolite repression. When the S46A mutation in HPr was reverted to give S46 wild-type HPr, expression of gluconate kinase and glucitol dehydrogenase regained full sensitivity to repression by PTS sugars. These results suggest that phosphorylation of HPr at Ser-46 is directly or indirectly involved in catabolite repression. A strain deleted for the ptsGHI genes was transformed with plasmids expressing either the wild-type ptsH gene or various S46 mutant ptsH genes (S46A or S46D). Expression of the gene encoding S46D HPr, having a structure similar to that of P-ser-HPr according to nuclear magnetic resonance data, caused significant reduction of gluconate kinase activity, whereas expression of the genes encoding wild-type or S46A HPr had no effect on this enzyme activity. When the promoterless lacZ gene was put under the control of the gnt promoter and was subsequently incorporated into the amyE gene on the B. subtilis chromosome, expression of beta-galactosidase was inducible by gluconate and repressed by glucose. However, we observed no repression of beta-galactosidase activity in a strain carrying the ptsH1 mutation. Additionally, we investigated a ccpA mutant strain and observed that all of the enzymes which we found to be relieved from carbon catabolite repression in the ptsH1 mutant strain were also insensitive to catabolite repression in the ccpA mutant. Enzymes that were repressed in the ptsH1 mutant were also repressed in the ccpA mutant.     

Secretion of Bacillus subtilis alpha-amylase in the periplasmic space of Escherichia coli

The Bacillus subtilis alpha-amylase structural gene (amyE) lacking its own signal peptide coding sequence was joined to the end of the Escherichia coli alkaline phosphatase (phoA) signal peptide coding sequence by using the technique of oligonucleotide-directed site-specific deletion. On induction of the phoA promoter, the B. subtilis alpha-amylase was expressed and almost all the activity was found in the periplasmic space of E. coli. The sequence of the five amino-terminal amino acids of the secreted polypeptide was Glu-Thr-Ala-Asn-Lys-, and thus the fused protein was correctly processed by the E. coli signal peptidase at the end of the phoA signal peptide.     

Construction and characterization of recombinant Bacillus subtilis JY123 able to transport xylose efficiently

It has been known that wild type Bacillus subtilis cannot grow rapidly in a minimal medium containing xylose as a sole carbon source because it does not have a xylose-specific transporter. In this study, the arabinose:H(+) symporter, AraE protein from B. subtilis was expressed in B. subtilis 168 in order to transport xylose efficiently. The AraE expression cassette was constructed to contain the xylose-inducible xylA promoter, araE gene and fba terminator, and integrated into the chromosomal amyE gene in B. subtilis 168. Batch cultures in a defined medium with xylose only or a mixture of xylose and glucose showed that expression of AraE led to fast and complete consumption of initially added xylose and hence a considerable increase in cell growth of the recombinant B. subtilis JY123 expressing AraE. Considering the systematic analysis of cell growth, sugar consumption, respiratory quotient and xylulokinase activity, it was certain that AraE protein could transport xylose into B. subtilis efficiently.