Simian virus 40 origin auxiliary sequences weakly facilitate T-antigen binding but strongly facilitate DNA unwinding.

The complete simian virus 40 (SV40) origin of DNA replication (ori) consists of a required core sequence flanked by two auxiliary sequences that together increase the rate of DNA replication in monkey cells about 25-fold. Using an extract of SV40-infected monkey cells that reproduced the effects of ori-auxiliary sequences on DNA replication, we examined the ability of ori-auxiliary sequences to facilitate binding of replication factors and to promote DNA unwinding. Although the replicationally active form of T antigen in these extracts had a strong affinity for ori-core, it had only a weak but specific affinity for ori-auxiliary sequences. Deletion of ori-auxiliary sequences reduced the affinity of ori-core for active T antigen by only 1.6-fold, consistent with the fact that saturating concentrations of T antigen in the cell extract did not reduce the stimulatory role of ori-auxiliary sequences in replication. In contrast, deletion of ori-auxiliary sequences reduced the efficiency of ori-specific, T-antigen-dependent DNA unwinding in cell extracts at least 15-fold. With only purified T antigen in the presence of topoisomerase I to unwind purified DNA, ori-auxiliary sequences strongly facilitated T-antigen-dependent DNA conformational changes consistent with melting the first 50 base pairs. Under these conditions, ori-auxiliary sequences had little effect on the binding of T antigen to DNA. Therefore, a primary role of ori-auxiliary sequences in DNA replication is to facilitate T-antigen-dependent DNA unwinding after the T-antigen preinitiation complex is bound to ori-core.     

Interaction of Simian Virus 40 chromatin with Simian Virus 40 T-antigen.

We have studied the binding of the tumor antigen (T-antigen) of simian virus 40 to simian virus 40 chromatin (minichromosomes). The minichromosomes isolated from infected cells by a modification of standard techniques were relatively free of contaminating RNA and cellular DNA and had a ratio (by weight) of protein to DNA of approximately 1; their DNA was 50 to 60% digestible to an acid-soluble form by staphylococcal nuclease. Cleavage of this chromatin with restriction endonucleases indicated that the nuclease-resistant regions were randomly distributed in the population of minichromosomes, but were not randomly distributed within minichromosomes. Only 20 to 35% of these minichromosomes adsorbed nonspecifically to nitrocellulose filters, permitting binding studies between simian virus 40 T-antigen and chromatin to be performed. Approximately two to three times as much T-antigen was required to bind chromatin as to bind an equivalent amount of free DNA. When T-antigen was present in excess, both chromatin and free DNA were quantitatively retained on the filters. On the other hand, when DNA or chromatin was present in excess, only one-third as much chromatin as DNA was retained. We suggest that T-antigen-chromatin complexes may be formed by the cooperative binding of T-antigen to chromatin, whereas T-antigen-DNA complexes may be formed by simple bimolecular interactions.     

A long synthetic peptide containing a nuclear localization signal and its flanking sequences of SV40 T-antigen directs the transport of IgM into the nucleus efficiently

Synthetic short peptides containing only the nuclear localization signal (NLS) direct the transport of nonnuclear proteins into the nucleus. As a conjugate of the synthetic peptide with immunoglobulin M (IgM) did not enter the nucleus, there was believed to be a size limit for nuclear transport of NLS-conjugated proteins. However, we found that IgM conjugated with purified nucleoplasmin, a nuclear protein of Xenopus oocytes, rapidly accumulated in the nucleus. For direct comparison with the short peptide, we prepared a long peptide containing the NLS and its flanking sequences of SV40 large T-antigen and its mutated long peptide, in which possible phosphorylation sites located at the amino terminal of the NLS were changed to alanine. Kinetic experiments showed that wild-type long peptide-IgM conjugates were almost entirely taken up into the nucleus within 30 min after their injection, whereas almost 60 min was required for the mutated long peptide-IgM conjugates to enter the nucleus of all the cells examined, and there was no apparent accumulation of short peptide-IgM conjugates in the nucleus within 60 min. These results indicate that even when the kinetics of transport are affected by amino acid substitutions, the long peptide directs the transport of large molecules such as IgM into the nucleus.     

Simian virus 40 (SV40) T-antigen mutations in tumorigenic transformation of SV40-immortalized human uroepithelial cells.

pSV2Neo, a plasmid that contains the wild-type simian virus 40 (SV40) origin of replication (ori), is widely used in mammalian cell transfection experiments. We observed that pSV2Neo transforms two nontumorigenic SV40-immortalized human uroepithelial cell lines (SV-HUC and CK/SV-HUC2) to G418 resistance (G418r) at a frequency lower than that at which it transforms SV-HUC tumorigenic derivatives (T-SV-HUC). Transient expression studies with the chloramphenicol transferase assay showed that these differences could not be explained by differences in Neo gene expression. However, when we replaced the SV40 ori in pSV2Neo with a replication-defective ori to generate G13.1Neo and G13.1'Neo, the G418r transformation frequency of the SV40-immortalized cell lines was elevated. Because SV40 T antigen stimulates replication at its ori, we tested plasmid replication in these transfected cell lines. The immortalized cell lines that showed low G418r transformation frequencies after transfection with pSV2Neo showed high levels of plasmid replication, while the T-SV-HUC that showed high G418r transformation frequencies failed to replicate pSV2Neo. To determine whether differences in the status of the T-antigen gene contributed to the phenomenon, we characterized the T-antigen gene in these cell lines. The results showed that the T-SV-HUC had sustained mutations in the T-antigen gene that would interfere with the ability of the T antigen to stimulate replication at its ori. Most T-SV-HUC contained a super-T-antigen replication-defective ori that apparently resulted from the partial duplication of SV40 early genes, but one T-SV-HUC had a point mutation in the ori DNA-binding domain of the T-antigen gene. These results correlate with the high G418r transformation frequencies with pSV2Neo in T-SV-HUC compared with SV-HUC and CK/SV-HUC2. Furthermore, these results suggest that alterations in SV40 T antigen may be important in stabilizing human cells immortalized by SV40 genes that contain the wild-type SV40 ori, thus contributing to tumorigenic transformation. This is the first report of a super T antigen occurring in human SV40-transformed cells.     

Simian virus 40 large T-antigen function is required for induction of tetraploid DNA content during lytic infection.

Infection of quiescent CV-1 cells with simian virus 40 mutant tsA30 at 37 degrees C resulted in the induction of two rounds of cellular DNA synthesis in T-antigen-positive cells, as previously described for wild-type simian virus 40. Following infection with tsA30 at 40.5 degrees C, T-antigen-positive cells were induced into S phase and reached a diploid G2 DNA content; however, a second S phase was not initiated. The failure of tsA30-infected CV-1 cells to enter tetraploid S phase at 40.5 degrees C identifies a T-antigen function, distinct from T-antigen functions responsible for stimulation of cell DNA synthesis, which is required for initiation of a second round of DNA synthesis without mitosis.     

Dimerization of simian virus 40 T-antigen hexamers activates T-antigen DNA helicase activity.

Chromosomal DNA replication in higher eukaryotes takes place in DNA synthesis factories containing numerous replication forks. We explored the role of replication fork aggregation in vitro, using as a model the simian virus 40 (SV40) large tumor antigen (T antigen), essential for its DNA helicase and origin-binding activities. Previous studies have shown that T antigen binds model DNA replication forks primarily as a hexamer (TAgH) and to a lesser extent as a double hexamer (TAgDH). We find that DNA unwinding in the presence of ATP or other nucleotides strongly correlates with the formation of TAgDH-DNA fork complexes. TAgH- and TAgDH-fork complexes were isolated, and the TAgDH-bound fork was denatured at a 15-fold-higher rate during the initial times of unwinding. TAgDH bound preferentially to a DNA substrate containing a 50-nucleotide bubble, indicating the bridging of each single-stranded DNA/duplex DNA junction, and this DNA molecule was also unwound at a high rate. Both the TAgH- and TAgDH-fork complexes were relatively stable, with the half-life of the TAgDH-fork complex greater than 40 min. Our data therefore indicate that the linking of two viral replication forks serves to activate DNA replication.     

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Simian virus 40 T-antigen: identification of tryptic peptides in the C-terminal region and definition of the reading frame

T-antigen (the simian virus 40 A cistron protein) was purified by immunoprecipitation and electrophoresis on polyacrylamide gels from monkey kidney CV-1 cells infected with simian virus S (SV-S), dl1263, or dl1265 and digested with trypsin. The tryptic peptides, labeled with [35S]methionine, [35S]cysteine, or [3H]proline, were fractionated either by chromatography on Chromobead-P resin or by two-dimensional electrophoresis and chromatography on cellulose thin layers. The T-antigen of SV-S was shown to give rise to a proline-rich (approximately 6 mol of proline) tryptic peptide which was absent in dl1265 T-antigen and hence, on the basis of DNA sequence data, must originate from the C-terminus of the SV-S protein. T-antigen from dl1265, but not SV-S, yielded a cysteine-rich terminal tryptic peptide. The presence of these cysteines caused the protein to be retarded during electrophoresis under the usual conditions in polyacrylamide gels. The T-antigen of dl1263 possessed the proline-rich tryptic peptide; the data are consistent with there being only one peptide altered by the deletion. Both deletion mutants produced a T-antigen that had a higher electrophoretic mobility than SV-S T-antigen but still a larger apparent molecular weight than was predicted by the DNA sequence. The major form of T-antigen found in several lines of 3T3 cells transformed by these mutants was indistinguishable from the T-antigen found in infected cells, and in addition seemed to associate normally with the host-coded 53,000-dalton protein. Except for a minor form of T-antigen with a slightly lower mobility in gels but the same C-terminus, no other polypeptides were detected among the extracted and immunoprecipitated proteins whose electrophoretic mobility was affected by either deletion.     

Simian virus 40 large T-antigen point mutants that are defective in viral DNA replication but competent in oncogenic transformation.

The large T antigen of simian virus 40 (SV40) is a multifunctional protein that is essential in both the virus lytic cycle and the oncogenic transformation of cells by SV40. To investigate the role of the numerous biochemical and physiological activities of T antigen in the lytic and transformation processes, we have studied DNA replication-deficient, transformation-competent large T-antigen mutants. Here we describe the genetic and biochemical analyses of two such mutants, C2/SV40 and C11/SV40. The mutants were isolated by rescuing the integrated SV40 DNA from C2 and C11 cells (CV-1 cell lines transformed with UV-irradiated SV40). The mutant viral early regions were cloned into the plasmid vector pK1 to generate pC2 and pC11. The mutations that are responsible for the deficiency in viral DNA replication were localized by marker rescue. Subsequent DNA sequencing revealed point mutations that predict amino acid substitutions in the carboxyl third of the protein in both mutants. The pC2 mutation predicts the change of Lys----Arg at amino acid 516. pC11 has two mutations, one predicting a change of Pro----Ser at residue 522, and another predicting a Pro----Arg change at amino acid 549. The two C11 mutations were separated from each other to form two distinct viral genomes in pC11A and pC11B. pC2, pC11, pC11A, and pC11B are able to transform both primary and established rodent cell cultures. The C11 and C11A T antigens are defective in ATPase activity, suggesting that wild-type levels of ATPase activity are not necessary for the oncogenic transformation of cells by T antigen.     

Functional analysis of a simian virus 40 super T-antigen.

The SV3T3 C120 line of simian virus 40-transformed mouse cells synthesizes no large T-antigen of molecular weight 94,000 but instead a super T-antigen of molecular weight 145,000. In the accompanying paper (Lovett et al., J. Virol. 44:963-973, 1982), we showed that the integrated viral DNA segment SV3T3-20-K contains a perfect, in-phase, tandem duplication of 1.212 kilobases within the large T-antigen coding sequences. Our data suggested that this integrated template encodes mRNAs of 3.9 and 3.6 kilobases, the smaller of which directs the synthesis of the super T-antigen of molecular weight 145,000. We transfected the DNA segment SV3T3-20-K into nonpermissive rat cells and into TK- mouse L cells and analyzed the T-antigens and viral mRNAs in the transfectants; these data prove directly the coding assignments suggested previously. The super T-antigen retained the ability to induce morphological transformation, and may even transform better than the wild-type protein. It also retained the ability to bind to the cell-coded p53 protein. Transfection into permissive CV-1 cells showed that the super T-antigen encoded by SV3T3-20-K was incapable of initiating DNA replication at the viral origin. The duplication in SV3T3-20-K thus defines a mutation which separates the transformation and DNA replication functions of large T-antigen. We discuss why such mutations may be selected in transformed cells.     

Membrane interactions of simian virus 40 large T-antigen: influence of protein sequences and fatty acid acylation.

To sort out possible influences of protein sequences and fatty acid acylation on the plasma membrane association of simian virus 40 large T-antigen, we have analyzed the membrane interactions of carboxy-terminal fragments of large T-antigen, encoded by the adenovirus type 2 (Ad2+)-simian virus 40 hybrid viruses Ad2+ND1 and Ad2+ND2. The 28,000 (28K)-molecular-weight protein of Ad2+ND1 as well as the 42K and 56K proteins of Ad2+ND2 associate preferentially with membranous structures and were found in association with the membrane system of the endoplasmic reticulum and with plasma membranes. Neither the endoplasmic reticulum membrane- nor the plasma membrane-associated 28K protein of Ad2+ND1 is fatty acid acylated. We, therefore, conclude that fatty acid acylation is not necessary for membrane association of this protein and suggest that an amino acid sequence in this protein is responsible for its membrane interaction. In contrast, the 42K and 56K proteins of Ad2+ND2 in plasma membrane fractions contain fatty acid. However, the interaction of these proteins with the plasma membrane differs from that of the 28K protein of Ad2+ND1: whereas the 28K protein of Ad2+ND1 interacts stably with Nonidet P-40-soluble constituents of the plasma membrane, the 42K and 56K proteins of Ad2+ND2 are tightly bound to the Nonidet P-40-insoluble plasma membrane lamina. Thus, an amino acid sequence in the amino-terminal region of the 28K protein confers membrane affinity to these proteins, whereas a region between the amino-terminal end of the 42K protein of Ad2+ND2 and the amino-terminal end of the 28K protein of Ad2+ND1 contains a reactive site for fatty acid acylation. This posttranslational modification correlates with the stable association of the 42K and 56K proteins with the plasma membrane lamina. We suggest that the same sequences also mediate the proper plasma membrane association of large T-antigen in simian virus 40-transformed cells.