Reovirus mu1 structural rearrangements that mediate membrane penetration

Membrane penetration by nonenveloped reoviruses is mediated by the outer-capsid protein, mu1 (76 kDa). Previous evidence has suggested that an autolytic cleavage in mu1 allows the release of its N-terminally myristoylated peptide, mu1N (4 kDa), which probably then interacts with the target-cell membrane. A substantial rearrangement of the remaining portion of mu1, mu1C (72 kDa), must also have occurred for mu1N to be released, and some regions in mu1C may make additional contacts with the membrane. We describe here a particle-free system to study conformational rearrangements of mu1. We show that removal of the protector protein sigma3 is not sufficient to trigger rearrangement of free mu1 trimer and that free mu1 trimer undergoes conformational changes similar to those of particle-associated mu1 when induced by similar conditions. The mu1 rearrangements require separation of the mu1 trimer head domains but not the mu1N/C autocleavage. We have also obtained a relatively homogeneous form of the structurally rearranged mu1 (mu1*) in solution. It is an elongated monomer and retains substantial alpha-helix content. We have identified a protease-resistant approximately 23-kDa fragment of mu1*, which contains the largely alpha-helical regions designated domains I and II in the conformation of mu1 prior to rearrangement. We propose that the mu1 conformational changes preceding membrane penetration or disruption during cell entry involve (i) separation of the beta-barrel head domains in the mu1 trimer, (ii) autolytic cleavage at the mu1N/C junction, associated with partial unfolding of mu1C and release of mu1N, and (iii) refolding of the N-terminal helical domains of mu1C, with which mu1N was previously complexed, accompanied by dissociation of the mu1 trimer.     

The regulated production of mu m and mu s mRNA is dependent on the relative efficiencies of mu s poly(A) site usage and the c mu 4-to-M1 splice.

The relative abundance of the mRNAs encoding the membrane (mu m) and secreted (mu s) forms of immunoglobulin mu heavy chain is regulated during B-cell maturation by a change in the mode of RNA processing. Current models to explain this regulation involve either competition between cleavage-polyadenylation at the proximal (mu s) poly(A) site and cleavage-polyadenylation at the distal (mu m) poly(A) site [poly(A) site model] or competition between cleavage-polyadenylation at the mu s poly(A) site and splicing of the C mu 4 and M1 exons, which eliminates the mu s site (mu s site-splice model). To test certain predictions of these models and to determine whether there is a unique structural feature of the mu s poly(A) site that is essential for regulation, we constructed modified mu genes in which the mu s or mu m poly(A) site was replaced by other poly(A) sites and then studied the transient expression of these genes in cells representative of both early- and late-stage lymphocytes. Substitutions at the mu s site dramatically altered the relative usage of this site and caused corresponding reciprocal changes in the usage of the mu m site. Despite these changes, use of the proximal site was still usually higher in plasmacytomas than in pre-B cells, indicating that regulation does not depend on a unique feature of the mu s poly(A) site. Replacement of the distal (mu m) site had no detectable effect on the usage of the mu s site in either plasmacytomas or pre-B cells. These findings are inconsistent with the poly(A) site model. In addition, we noted that in a wide variety of organisms, the sequence at the 5' splice junction of the C mu 4-to-M1 intron is significantly different from the consensus 5' splice junction sequence and is therefore suboptimal with respect to its complementary base pairing with U1 small nuclear RNA. When we mutated this suboptimal sequence into the consensus sequence, the mu mRNA production in plasmacytoma cells was shifted from predominantly mu s to exclusively mu m. This result unequivocally demonstrated that splicing of the C mu 4-to-M1 exon is in competition with usage of the mu s poly(A) site. A key feature of this regulatory phenomenon appears to be the appropriately balanced efficiencies of these two processing reactions. Consistent with predictions of the mu s site-splice model, B cells were found to contain mu m precursor RNA that had undergone the C mu 4-to-M1 splice but had not yet been polyadenylated at the mu m site.     

Molecular requirements for the mu-induced light chain gene rearrangement in pre-B cells.

During B cell differentiation rearrangement of immunoglobulin (Ig) genes is partially regulated by the Ig proteins. Rearrangement of heavy (H) chain genes is inhibited, whilst that of light (L) chain genes is induced by the membrane form of the mu H chain. In order to analyse additional structural requirements of mu induced L chain gene rearrangement we transfected wild-type mu and mutant mu constructs lacking functional exons encoding the first or second constant domains into Abelson murine leukemia virus (AMuLV) transformed pre-B cells. All mu chains are expressed on the surface of the pre-B cell and all associate with omega and iota, two proteins forming a surrogate light chain, necessary for mu membrane expression. Nevertheless, only wild-type mu and not the mutant mu proteins promote L gene rearrangement. A heterodimer of proteins with Mr of 33 kd and 36 kd was found associated with wild-type but not with the mutant mu proteins. Continuous presence of mu is required for L chain gene recombination since loss of mu stopped and readdition of mu started L gene rearrangement. We propose that the protein complex composed of mu and the 33 kd/36 kd protein heterodimer is responsible for the activation of the L chain gene locus and its rearrangement.     

The contribution of constant region domains to the binding of murine IgM to Fc mu receptors on T cells

IgM hybridoma constant region domain deletional mutants were used to investigate the domain requirements for binding of murine IgM to Fc mu receptors (Fc mu R) on normal murine T lymphocytes. Parental Sp 6:18 (mu, kappa; anti-trinitrophenyl) and its mutant proteins or their trinitrophenyl-antigen immune complexes were tested for their ability to inhibit the binding of pentameric IgM to Fc mu R on T lymphocytes. Inhibition was observed with ligands containing multiple copies of the third constant region domain. Inhibition did not occur with ligands missing the third constant region domain. In addition, a battery of rat monoclonal antibodies specific for individual murine IgM constant region domains was tested for the ability to inhibit the binding of pentameric murine IgM to Fc mu R on normal murine T lymphocytes. Total inhibition was observed with the antibodies directed to different epitopes located in C mu 3, but significant inhibition was not observed with antibodies directed to C mu 1, C mu 2, or C mu 4. Studies with domain deletional mutants and anti-domain antibodies have independently provided strong evidence that the C mu 3 domain plays a major role in the binding of IgM to Fc mu R on T lymphocytes and that C mu 1, C mu 2, and C mu 4 are not essential for binding. These studies have also provided evidence that valency and avidity influence the binding of IgM to T lymphocytes that express Fc mu R.     

Heterogeneity of bone marrow lymphocytes: radioautographic detection of pre-B cells bearing cytoplasmic mu chains, and of B and T lymphocytes, and characterization of null lymphoid cells

A radioautographic immunolabeling technique has been developed to detect pre-B cells bearing cytoplasmic mu chains among populations of bone marrow lymphoid cells identified by conventional hematologic stains. 125I-Anti-mu antibody was applied either to fixed marrow smears, labeling total mu chains both in the cytoplasm (c mu) and at the cell surface (s mu), or to cell suspensions, labeling s mu alone. In stained radioautographs the incidence of c mu+ s mu- pre-B cells was derived both indirectly by subtracting values for s mu+ cells from those for total mu+ cells of various sizes in normal mice and directly by the total mu chain labeling in mice depleted of s mu+ cells by anti-IgM treatment in vivo. Binding specificity was demonstrated by the displacement of labeling by nonradioactive anti-mu antibody. The c mu+ s mu- cells showed a bimodal size distribution. They accounted for 40% of the large lymphoid cells and 30% of the small lymphocytes in the marrow. A further 50% of the small lymphocytes were B lymphocytes (s mu+) and 8% were T lymphocytes (Thy 1.2+). Thus, the technique demonstrates the presence of c mu+ s mu- pre-B cells among both proliferating large lymphoid cells and nondividing small lymphocytes, as classically defined in marrow smears. In addition, the results reveal a broad size distribution of mu- lymphoid cells, including a subset of small lymphocytes which lack c mu, s mu, and Thy 1.2 and thus cannot be assigned to either B or T lineage by these criteria. The findings suggest that in addition to B cells the marrow may produce other types of lymphoid cells, yet to be defined.     

The requirement of light chain for the surface deposition of the heavy chain of immunoglobulin M

The murine tumor line 70Z/3 resembles a pre-B lymphocyte in containing the heavy chain of IgM (mu) as a cytoplasmic protein in the apparent absence of light chain (L). However, these cells can be induced by lipopolysaccharide to differentiate into a B lymphocyte-like state, containing mu2L2 tetramers as membrane-bound molecules. This is a accompanied by an increase in mu synthesis, the acquisition of complex carbohydrate by mu, and the induction of L chain. We wished to determine which of these events is critical for membrane deposition of mu. We found that uninduced 70Z/3 cells, as well as lipopolysaccharide-uninducible variants, contained a low, constitutive level of membrane bound mu, all of which was found as mu2L2. Dextran sulfate, another inducing agent, apparently caused a redistribution of this pre-existing surface mu without altering the pattern of mu synthesis or processing. One lipopolysaccharide-uninducible variant showed a small subset of surface mu-positive cells, and the proportion of these cells increased with a prolonged induction period. The increase in mu synthesis was nearly normal, but mu did not acquire complex carbohydrate. However, the delayed appearance of surface mu-positive cells was paralleled by a delayed increase in L chain, which occurred only in those cells with mu on their membrane. We concluded that L chain signals the transport of mu to the cell surface.     

Optimal production of glutathione by controlling the specific growth rate of yeast in fed-batch culture

The optimal of the specific growth rate was obtained with simple mathematical model in a yeast fed-batch cultures. The model was based on the mass balance around the fed-batch system and the relationship between the specific growth rate, mu, and the specific production rate of glutathione, rho(G). The optimal profile of mu was calculated as a bang-bang type, That is mu, should start from the maximum value, mu(max) and should be kept at mu(max); then mu should be switched to mu(c), which gives a maximum value of rho(G). It was proven from the maximum principle that switching was needed only once, with the switching time from mu(max) to mu(c) depending on the final required glutathione content. Finally, this ideal profile of mu for the maximum production of glutathione was realized by manipulating the substrates feed rate in the fed-batch culture. Using the extended Kalman filter and a programmed-controller/feedback-compensator (PF) system, mu could be controlled at the optimal profile obtained. As a result, the maximum production of glutathione was accomplished fairly successfully. However, further improvement in the controller performance for mu is desired. The control strategy employed here can be applied to other batch reaction processes.     

Insights into mu opioid pharmacology the role of mu opioid receptor subtypes

Although mu opioids share many pharmacological characteristics, they also reveal many differences. Many approaches over the years have suggested the existence of multiple mu opioid receptors. The unique selectivities of naloxonazine, for example, provided a way of distinguishing mu, from mu2 actions. Studies of morphine-6beta-gluruconide suggested that its actions involved yet another mu opioid receptor subtype. The cloning of a mu opioid receptor, MOR-1, provided a way of exploring this possibility at the molecular level. Recent studies have now identified a number of splice variants of this gene that appear to be important in the production of mu opioid analgesia.     

Spike trains in a stochastic Hodgkin-Huxley system

We consider a standard Hodgkin-Huxley model neuron with a Gaussian white noise input current with drift parameter mu and variance parameter sigma(2). Partial differential equations of second order are obtained for the first two moments of the time taken to spike from (any) initial state, as functions of the initial values. The analytical theory for a 2-component (V,m) approximation is also considered. Let mu(c) (approximately 4.15) be the critical value of mu for firing when noise is absent. Large sample simulation results are obtained for mumu(c), for many values of sigma between 0 and 25. For the time to spike, the 2-component approximation is accurate for all sigma when mu=10, for sigma>7 when mu=5 and only when sigma>15 when mu=2. When mumu(c), most paths show similar behavior and the moments exhibit smoothly changing behavior as sigma increases. Thus there are a different number of regimes depending on the magnitude of mu relative to mu(c): one when mu is small and when mu is large; but three when mu is close to and above mu(c). Both for the Hodgkin-Huxley (HH) system and the 2-component approximation, and regardless of the value of mu, the CV tends to about 1.3 at the largest value (25) of sigma considered. We also discuss in detail the problem of determining the interspike interval and give an accurate method for estimating this random variable by decomposing the interval into stochastic and almost deterministic components.     

Eimeria juniataensis sp. n. (Protozoa: Eimeriidae) from the map turtle, Graptemys Geographica, in Pennsylvania.

Eimeria juniataensis sp. n. is described from the map turtle, Graptemys geographica, in Pennsylvania. The spherical to subspherical oocysts of E. juniataensis are 11.5 to 18.5 mu by 11.5 to 16.5 mu (mean, 13.5 by 12.9mu). The broadly fusiform sporocysts are 7.5 to 10 mu by 4 to 6.5 mu (mean, 8.3 by 5.0mu) and a Stieda body is present. Oocyst and sporocyst residua are present. This is the first report of an eimerian species from Graptemys.     

Ectopic recombination within homologous immunoglobulin mu gene constant regions in a mouse hybridoma cell line.

We have transferred a pSV2neo vector containing the wild-type constant region of the immunoglobulin mu gene (C mu) into the mutant hybridoma igm482, which bears a 2-bp deletion in the third constant-region exon of its haploid chromosomal mu gene (C mu 3). Independent igm482 transformants contain the wild-type immunoglobulin C mu region stably integrated in ectopic chromosomal positions. We report here that the wild-type immunoglobulin C mu region can function as the donor sequence in a gene conversion event which corrects the 2-bp deletion in the mutant igm482 chromosomal C mu 3 exon. The homologous recombination event restores normal immunoglobulin M production in the mutant cell.     

Cytotoxicity of anti-beta 2-microglobulin xenoantisera to human and murine myeloid progenitor cells and lack of cross-reactivity with colony-stimulating activity

A previous report has suggested an antigenic relationship between beta 2-microglobulin (beta 2 mu) and granulocyte colony-stimulating activity (CSA). Since human myeloid progenitor cells (CFU-C) express HLA antigens and beta 2 mu is a known molecular component of HLA antigens, we wondered whether the reported effect of anti-beta 2 mu heteroantisera on in vitro granulopoiesis might result from cytotoxicity to CFU-C rather than from cross-reactivity with CSA. To test this, we used rabbit antibody reactive with human and murine beta 2 mu (anti-beta 2 mu). Treatment of human and murine bone marrow cells with anti-beta 2 mu and complement resulted in 95+% inhibition of CFU-C colony formation compared to controls. To test for an effect on CSA, anti-beta 2 mu was incubated with human and murine sources of CSA. After addition of goat anti-rabbit Ig antiserum to precipitate immune complexes and unbound anti-beta 2 mu, the supernatant fluid retained CSA but was no longer cytotoxic to CFU-C. These results indicate that human and murine CFU-C express membrane beta 2 mu and that anti-beta 2 mu antibody does not cross-react with human or murine CSA.     

Quantitative analysis of idiotypic mimicry and allelic exclusion in mice with a mu Ig transgene

Analysis of C57BL/6 mice (IgM allotype, Igh-6b or mu b) that carry an Ig H chain transgene of a different allotype (mu a) shows that IgM molecules of mixed allotype (mu a mu b) are present among serum antibodies. The finding was extended to hybridomas prepared from nonimmune transgenic mice, many of which also failed to exhibit allelic exclusion. The proportions of mu a and mu b secreted by individual hybridomas varied markedly, and the product of an individual hybridoma was found to be heterogeneous with respect to the allotype content of individual molecules. The ratio of mu a:mu b chains secreted by individual hybridomas was found to correlate with the number of transgene copies remaining in each hybridoma, and several hybridomas that secrete only mu b-positive molecules had apparently lost all but one copy of the transgene. An idiotype characteristic of the transgene was found to be present only in association with the transgenic (mu a) allotype, and indirect evidence strongly suggests that the idiotype was present only on mu a polypeptide chains. Thus, there is no evidence in this system for the induction of idiotypically cross-reactive endogenous molecules.     

Reovirus sigma NS protein localizes to inclusions through an association requiring the mu NS amino terminus

Cells infected with mammalian reoviruses contain phase-dense inclusions, called viral factories, in which viral replication and assembly are thought to occur. The major reovirus nonstructural protein mu NS forms morphologically similar phase-dense inclusions when expressed in the absence of other viral proteins, suggesting it is a primary determinant of factory formation. In this study we examined the localization of the other major reovirus nonstructural protein, sigma NS. Although sigma NS colocalized with mu NS in viral factories during infection, it was distributed diffusely throughout the cell when expressed in the absence of mu NS. When coexpressed with mu NS, sigma NS was redistributed and colocalized with mu NS inclusions, indicating that the two proteins associate in the absence of other viral proteins and suggesting that this association may mediate the localization of sigma NS to viral factories in infected cells. We have previously shown that mu NS residues 1 to 40 or 41 are both necessary and sufficient for mu NS association with the viral microtubule-associated protein mu 2. In the present study we found that this same region of micro NS is required for its association with sigma NS. We further dissected this region, identifying residues 1 to 13 of mu NS as necessary for association with sigma NS, but not with mu 2. Deletion of sigma NS residues 1 to 11, which we have previously shown to be required for RNA binding by that protein, resulted in diminished association of sigma NS with mu NS. Furthermore, when treated with RNase, a large portion of sigma NS was released from mu NS coimmunoprecipitates, suggesting that RNA contributes to their association. The results of this study provide further evidence that mu NS plays a key role in forming the reovirus factories and recruiting other components to them.     

Cover Image,Volume 234, Number 10, October 2019

Cytoskeleton which includes microtubule and actin filaments plays important roles during mammalian oocyte maturation. In the present study, we showed that protein kinase C mu (PKC mu) was one potential key molecule which affected cytoskeleton dynamics in mouse oocytes. Our results showed that PKC mu expressed and localized at the poles of the spindle during oocyte maturation, and PKC mu expression reduced in the oocytes from 6-month-old mice or 24 hr in vitro culture. We knocked down the expression of PKC mu in oocytes using morpholino injection to explore the relationship between PKC mu and subcellular structure defects. The loss of PKC mu reduced oocyte maturation competence, showing with decreased polar body extrusion rate and increased rate of symmetric division. Further analysis indicated that PKC mu decrease caused the spindle organization defects, and this could be confirmed by the decreased tubulin acetylation level. Moreover, we found that PKC mu affected the phosphorylation level of cofilin for actin assembly, which further affected cytoplasmic actin distribution and spindle positioning. In summary, our data indicated that PKC mu is one key factor for oocyte maturation through its roles on the spindle organization and actin filament distribution.     

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.