Electron microscopy of secondary structure in partially denatured precursor and mature Escherichia coli 16 S and 23 S rRNA

The secondary structure of 16 S and 23 s rRNA sequences in 30 S preribosomal RNA of Escherichia coli was analyzed by electron microscopy after partial denaturation and compared to mature 16 S and 23 S rRNA examined under the same conditions. The sequences in the pre-rRNA notably lack the specific loops that dominate the 5'-terminal regions of mature 16 S and 23 S rRNA. In other respects, the sizes and locations of loops in the 23 S rRNA sequence are qualitatively very similar in mature and pre-rRNA. Eleven of 12 loops outside of the 5'-terminal domain correspond, with the most frequent features in the 3'-half of the molecule. In contrast, the sizes and locations of loops in the 16 S rRNA sequence differ between precursor and mature forms. In the pre-rRNA, instead of the 370-nucleotide 5'-terminal loop of mature rRNA, some 1000-nucleotide terminal loops are observed. The pre-rRNA also shows a frequent 610-nucleotide central loop and a large 1240-nucleotide loop not seen in the mature rRNA. Also, in the 3'-region of the sequence, the largest loops in pre-rRNA are 120 nucleotides shorter than in mature rRNA. We suggest that the structure of pre-rRNA may promote some alternate conformational features, and that these could be important during ribosome formation or function.     

Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA.

We found that the Escherichia coli cafA::cat mutant accumulated a precursor of 16S rRNA. This precursor migrated to the same position with 16.3S precursor found in the BUMMER strain that is known to be deficient in the 5' end processing of 16S rRNA. Accumulation of 16. 3S rRNA in the BUMMER mutant was complemented by introduction of a plasmid carrying the cafA gene. The mutant type cafA gene cloned from the BUMMER strain had a 11-bp deletion in its coding region. A small amount of the mature 16S rRNA was still formed in the cafA::cat mutant. This residual activity was found to be due to RNase E encoded by the rne/ams gene by rifampicin-chase experiments of the cafA::cat ams1 double mutant. These results indicated that the cafA gene encodes a novel RNase responsible for processing of the 5' end of 16S rRNA.     

Comparative analysis of the 5'-terminal nucleotide sequence and central domains of 16S rRNA of Yersinia pestis and Escherichia coli]

Partial nucleotide sequence of 16S rRNA (16-989 nn.) of plague agent (Yersinia pestis) was determined after sequencing of cloned cDNA fragments. The comparison of Y. pestis 16S rRNA sequence with that of E. coli shows a number of point sequence variation due to base changes. The base changes are found in 16S rRNA secondary structure regions that are localized on the surface of 30S ribosome subunit (hairpins 6 and 18) as well as in the regions that bind the proteins S8, S15, S16 and S20. These proteins of Y. pestis differ from the same proteins of E. coli by electrophoretic mobility, when analyzed by two-dimensional co-electrophoresis in polyacrylamide gel. The correlation between the structure of the four proteins and the structure of their binding sites in 16S rRNA are discussed.     

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.     

Electrophoretic mobility anomalies associated with PCR amplification of the intergenic spacer region between 16S and 23S ribosomal RNA genes of Fusobacterium necrophorum.

PCR amplification of the intergenic spacer region (ISR) between 16S and 23S rRNA genes among subspecies of the anaerobic bacterium Fusobacterium necrophorum gave identical patterns, with two forms of ISR identified. However, extra bands resulting from anomalous electrophoretic mobility of amplified DNA fragments with certain primer combinations were encountered. Therefore, PCR assays relying solely on banding patterns may be unreliable, and supporting sequence analysis is essential for correct culture identification.     

Determination of Specific Growth Rate by Measurement of Specific Rate of Ribosome Synthesis in Growing and Nongrowing Cultures of Acinetobacter calcoaceticus

RT-RiboSyn measures the specific rate of ribosome synthesis in distinct microbial populations by measuring the generation rate of precursor 16S rRNA relative to that of mature 16S rRNA when precursor 16S rRNA processing is inhibited. Good agreement was demonstrated between specific rate of ribosome synthesis and specific growth rate of Acinetobacter calcoaceticus.     

On the interpretation of small-angle x-ray solution scattering from spherical viruses.

The intermediates in the ribosome assembly in exponentially growing Escherichia coli have been identified by centrifuging a crude lysate, pulse-labeled with a radioactive RNA base, through a sucrose gradient and analyzing for precursor rRNA in the gradient fractions by gel electrophoresis. The major intermediate in the assembly of the 50 S subunit cosediments with the mature subunit, whereas two minor precursor species sediment between the 30 S and 50 S peaks. The assembly of the 30 S subunit proceeds via a minor intermediate sedimenting slightly behind the mature subunit and a major precursor particle that cosediments with the mature 30 S subunit.The fraction of the rRNA contained in these precursor particles was determined by direct determination of the amount of rRNA in the precursor particles, and from the labeling kinetics of their rRNA. The direct estimation indicated that about 2% of the total 23 S type RNA, and 3 to 5% of the total 16 S type RNA is harboured in precursor particles. In the kinetic experiments the specific activity of the nucleoside triphosphates and of the different ribosomal particles was followed after addition of a radioactive RNA precursor to the growth medium. The results were compared with a digital simulation of the flow of isotopes through the assembly pathways. This method indicated that approximately 2% of the total 23 S type RNA, as well as 2% of the total 16 S type RNA, is contained in the precursor particles.     

Comparison of mammalian mitochondrial ribosomal ribonucleic acid from different species

Mitochondrial ribosomal RNA species from mouse L cells, rat liver, rat hepatoma, hamster BHK-21 cells and human KB cells were examined by electrophoresis on polyacrylamide-agarose gels and sedimentation in sucrose density gradients. The S(E) (electrophoretic mobility) and S values of mitochondrial rRNA of all species were highly dependent on temperature and ionic strength of the medium; the S(E) values increased and the S values decreased with an increase in temperature at a low ionic strength. At an ionic strength of 0.3 at 23-25 degrees C or an ionic strength of 0.01 at 3-4 degrees C the S and S(E) values were almost the same being about 16.2-18.0 and 12.3-13.6 for human and mouse mitochondrial rRNA. The molecular weights under these conditions were calculated to be 3.8x10(5)-4.3x10(5) and 5.9x10(5)-6.8x10(5), depending on the technique used. At 25 degrees C in buffers of low ionic strength mouse mitochondrial rRNA species had a lower electrophoretic mobility than those of human and hamster. Under these conditions the smaller mitochondrial rRNA species of hamster had a lower electrophoretic mobility than that of human but the larger component had an identical mobility. Mouse and rat mitochondrial rRNA species had identical electrophoretic mobilities. Complex differences between human and mouse mitochondrial rRNA species were observed on sedimentation in sucrose density gradients under various conditions of temperature and ionic strength. Mouse L-cell mitochondrial rRNA was eluted after cytoplasmic rRNA on a column of methylated albumin-kieselguhr.     

Secondary structure maps of ribosomal RNA. II. Processing of mouse L-cell ribosomal RNA and variations in the processing pathway

Secondary structure mapping in the electron microscope was applied to ribosomal RNA and precusor ribosomal RNA molecules isolated from nucleoli and the cytoplasm of mouse L-cells. Highly reproducible loop patterns were observed in these molecules. The polarity of L-cell rRNA was determined by partial digestion with 3′-exonuclease. The 28 S region is located at the 5′-end of the 45 S rRNA precursor. Together with earlier experiments on labeling kinetics, these observations established a processing pathway for L-cell rRNA. The 45 S rRNA precursor is cleaved at the 3′-end of the 18 S RNA sequence to produce a 41 S molecule and a spacer-containing fragment (24 S RNA). The 41 S rRNA is cleaved forming mature 18 S rRNA and a 36 S molecule. The 36 S molecule is processed through a 32 S intermediate to the mature 28 S rRNA. This pathway is similar to that found in HeLa cells, except that in L-cells a 36 S molecule occurs in the major pathway and no 20 S precusor to 18 S RNA is found. The processing pathway and its intermediates in L-cells are analogous to those in Xenopus laevis, except for a considerable size difference in all rRNAs except 18 S rRNA.The arrangement of gene and transcribed spacer regions and of secondary structure loops, as well as the shape of the major loops were compared in L-cells, HeLa cell and Xenopus rRNA. The over-all arrangement of regions and loop patterns is very similar in the RNA from these three organisms. The shapes of loops in mature 28 S RNA are also highly conserved in evolution, but the shapes of loops in the transcribed spacer regions vary greatly. These observations suggest that the sequence complementarity that gives rise to this highly conserved secondary structure pattern may have some functional importance.     

Electron microscopic mapping of secondary structures in bacterial 16S and 23S ribosomal ribonucleic acid and 30S precursor ribosomal ribonucleic acid

Electron microscopy revealed reproducible secondary structure patterns within partially denatured 16S and 23S ribosomal ribonucleic acid (rRNA) from Escherichia coli. When prepared with 50% formamide-100 mM ammonium acetate, 16S rRNA included two small hairpins that appeared in over 50% of all molecules. Three open loops were observed with frequencies of less than 25%. In contrast, 23S rRNA included a terminal open loop and two additional large structures in over 75% of all molecules. These secondary structure patterns were conserved in the 16S and 23S rRNA from Pseudomonas aeruginosa. The secondary structure of the 30S precursor rRNA from the ribonclease III-deficient E. coli mutant AB105 was mapped after partial denaturation in 70% formamide-100 mM ammonium acetate. Two large open loops were superimposed on the 16S and 23S rRNA secondary structure patterns. These loops were the most frequent structures found on the precursor, and their stems coincided with ribonuclease III cleavage sites. A tentative 5'-3 orientation was determined for the secondary structure patterns of 16S and 23S rRNA from their relative locations within 30S precursor rRNA. The relation of secondary structure to ribosomal protein binding and ribonuclease III cleavage is discussed.     

The role of RbfA in 16S rRNA processing and cell growth at low temperature in Escherichia coli

RbfA, a 30S ribosome-binding factor, is a multicopy suppressor of a cold-sensitive C23U mutation of the 16S rRNA and is required for efficient processing of the 16S rRNA. At 37 degrees C, DeltarbfA cells show accumulation of ribosomal subunits and 16S rRNA precursor with a significantly reduced polysome profile in comparison with wild-type cells. RbfA is also a cold-shock protein essential for Escherichia coli cells to adapt to low temperature. In this study, we examined its association with the ribosome and its role in 16S rRNA processing and ribosome profiles at low temperature. In wild-type cells, following cold shock at 15 degrees C, the amount of free RbfA remained largely stable, while that of its 30S subunit-associated form became several times greater than that at 37 degrees C and a larger fraction of total 30S subunits was detected to be RbfA-containing. In DeltarbfA cells, the pre-16S rRNA amount increased after cold shock with a concomitant reduction of the mature 16S rRNA amount and the formation of polysomes was further reduced. A closer examination revealed that 30S ribosomal subunits of DeltarbfA cells at low temperature contained primarily pre-16S rRNA and little mature 16S rRNA. Our results indicate that the cold sensitivity of DeltarbfA cells is directly related to their lack of translation initiation-capable 30S subunits containing mature 16S rRNA at low temperature. Importantly, when the C-terminal 25 residue sequence was deleted, the resulting RbfADelta25 lost the abilities to stably associate with the 30S subunit and to suppress the dominant-negative, cold-sensitive phenotype of the C23U mutation in 16S rRNA but was able to suppress the 16S rRNA processing defect and the cold-sensitive phenotype of the DeltarbfA cells, suggesting that RbfA may interact with the 30S ribosome at more than one site or function in more than one fashion in assisting the 16S rRNA maturation at low temperature.     

Stability and maturation of E. coli ribosomal RNA.

The kinetics of rRNA maturation were investigated in a rifampicin permeable strain of E. coli during exponential growth in glucose minimal medium. The method used involves isotopic labelling of rRNA, and separation of precursor and mature forms by gel electrophoresis. The maturation of both 16s and 23s rRNA was found to follow first order kinetics. The mean life time of the precursors was found to be about 1.5 min. In glucose minimal medium all pulse label in precursors was recovered in mature rRNA, i.e. nascent rRNA is stable.     

Biogenesis of the yeast vacuole (lysosome). The precursor forms of the soluble hydrolase carboxypeptidase yscS are associated with the vacuolar membrane.

We have studied the structure, biosynthesis, intracellular routing, and vacuolar localization of carboxypeptidase ysCS in the yeast Saccharomyces cerevisiae. Nondenaturing polyacrylamide gel electrophoresis revealed two forms of carboxypeptidase yscS with different electrophoretic mobility. Antibodies specific for carboxypeptidase yscS recognized two glycoproteins of 77- and 74-kDa apparent molecular mass which differ by one N-linked carbohydrate residue. Both observations suggest that carboxypeptidase yscS exists in two catalytically active forms. The enzyme was found to be synthesized as two active high molecular mass precursor forms which are converted to the mature forms with a half-time of 20 min. The mature forms of carboxypeptidase yscS appeared soluble in the vacuolar lumen, while the precursor proteins accumulated tightly associated with the vacuolar membrane. The single hydrophobic domain present at the N terminus is believed to be responsible for the membrane association of the precursor molecules. Double mutants defective in proteinase yscA and proteinase yscB synthesize solely the carboxypeptidase yscS precursor forms. Correct proteolytic cleavage of the precursor forms was performed using purified proteinase yscB in vitro. Sec61, sec18, and sec7 mutants, conditionally defective in the secretory pathway, accumulate carboxypeptidase yscS precursor protein. Thus the carboxypeptidase yscS precursor molecules are delivered to the vacuole in a membrane bound form via the secretory pathway. After assembly into the vacuolar membrane, proteinase yscB presumably cleaves the precursor molecules to release soluble carboxypeptidase yscS forms into the lumen of the vacuole. The proposed mechanism is different from the delivery mechanism found for the other soluble vacuolar hydrolases in yeast.     

Studies on protein multimers. VII. Stabilization of E. coli beta-galactosidase by a 260-nm absorbing compound in crude preparations

5-Azacytidine, which has been shown to inhibit the maturation of ribosomal RNA from its precursors when added to the medium of cultured Novikoff hepatoma cells, alters the electrophoretic mobilities of the 45S and 32S ribosomal RNA precursors formed in Novikoff cells. Coelectrophoresis of total cell RNA samples shows that the 45S and 32S RNA precursors from 5-azacytidine-treated cells migrate slower than the corresponding precursors from control cells. 5-Azacytidine causes some reduction in the rate and degree of methylation of the 45S and 32S RNA precursors; however, the alteration in electrophoretic mobility and maturation of these two RNA species do not appear to be a consequence of undermethylation. Coelectrophoresis of undermethylated RNA produced by methionine starvation with normal RNA shows no differences in mobility of the ribosomal precursor RNA_s. 5-Fluorouridine and 8-azaguanine, also inhibitors of ribosomal RNA maturation, were not found to cause detectable differences in migration of the ribosomal precursor RNA_s.