Linkage of cation binding and folding in human telomeric quadruplex DNA

Formation of DNA quadruplexes requires monovalent cation binding. To characterize the cation binding stoichiometry and linkage between binding and folding, we carried out KCl titrations of Tel22 (d[A(GGGTTA)₃]), a model of the human telomere sequence, using a fluorescent indicator to determine [K⁺]_free and circular dichroism to assess the extent of folding. At [K⁺]_free = 5 mM (sufficient for > 95% folding), the apparent binding stoichiometry is 3K⁺/Tel22; at [K⁺]_free = 20 mM, it increased to 8-10K⁺/Tel22. Thermodynamic analysis shows that at [K⁺]_free = 5 mM, K⁺ binding contributes approximately − 4.9 kcal/mol for folding Tel22. The overall folding free energy is − 2.4 kcal/mol, indicating that there are energetically unfavorable contributions to folding. Thus, quadruplex folding is driven almost entirely by the energy of cation binding with little or no contribution from other weak molecular interactions.     

Polymorphism of human telomeric quadruplex structures

Human telomeric DNA consists of tandem repeats of the sequence d(TTAGGG). Compounds that can stabilize the intramolecular DNA G-quadruplexes formed in the human telomeric sequence have been shown to inhibit the activity of telomerase and telomere maintenance, thus the telomeric DNA G-quadruplex has been considered as an attractive target for cancer therapeutic intervention. Knowledge of intramolecular human telomeric G-quadruplex structure(s) formed under physiological conditions is important for structure-based rational drug design and thus has been the subject of intense investigation. This review will give an overview of recent progress on the intramolecular human telomeric G-quadruplex structures formed in K(+) solution. It will also give insight into the structure polymorphism of human telomeric sequences and its implications for drug targeting.     

Intramolecular quadruplex conformation of human telomeric DNA assessed with 125I-radioprobing

A repeated non-coding DNA sequence d(TTAGGG)_n is present in the telomeric ends of all human chromosomes. These repeats can adopt multiple inter and intramolecular non-B-DNA conformations that may play an important role in biological processes. Two intramolecular structures of the telomeric oligonucleotide dAGGG(TTAGGG)₃, antiparallel and parallel, have been solved by NMR and X-ray crystallography. In both structures, the telomeric sequence adopts an intramolecular quadruplex structure that is stabilized by G-4 quartets, but the ways in which the sequence folds into the quadruplex are different. The folds of the human telomeric DNA were described as an anti-parallel basket-type and a parallel propeller-type. We applied ¹²⁵I-radioprobing to determine the conformation of the telomeric quadruplex in solution, in the presence of either Na⁺ or K⁺ ions. The probability of DNA breaks caused by decay of ¹²⁵I is inversely related to the distance between the radionuclide and the sugar unit of the DNA backbone; hence, the conformation of the DNA backbone can be deduced from the distribution of breaks. The probability of breaks measured in the presence of Na⁺ and K⁺ were compared with the distances in basket-type and propeller-type quadruplexes obtained from the NMR and crystal structures. Our radioprobing data demonstrate that the antiparallel conformation was present in solution in the presence of both K⁺ and Na⁺. The preferable conformation in the Na⁺-containing solution was the basket-type antiparallel quadruplex whereas the presence of K⁺ favored the chair-type antiparallel quadruplex. Thus, we believe that the two antiparallel and the parallel conformations may coexist in solution, and that their relative proportion is determined by the type and concentration of ions.     

Conformational dynamics of the human propeller telomeric DNA quadruplex on a microsecond time scale

The human telomeric DNA sequence with four repeats can fold into a parallel-stranded propeller-type topology. NMR structures solved under molecular crowding experiments correlate with the crystal structures found with crystal-packing interactions that are effectively equivalent to molecular crowding. This topology has been used for rationalization of ligand design and occurs experimentally in a number of complexes with a diversity of ligands, at least in the crystalline state. Although G-quartet stems have been well characterized, the interactions of the TTA loop with the G-quartets are much less defined. To better understand the conformational variability and structural dynamics of the propeller-type topology, we performed molecular dynamics simulations in explicit solvent up to 1.5 μs. The analysis provides a detailed atomistic account of the dynamic nature of the TTA loops highlighting their interactions with the G-quartets including formation of an A:A base pair, triad, pentad and hexad. The results present a threshold in quadruplex simulations, with regards to understanding the flexible nature of the sugar-phosphate backbone in formation of unusual architecture within the topology. Furthermore, this study stresses the importance of simulation time in sampling conformational space for this topology.     

Loop flexibility in human telomeric quadruplex small-molecule complexes

Quadruplex nucleic acids can be formed at the ends of eukaryotic chromosomes. Their formation and stabilisation by appropriate small molecules can be used as a means of inhibiting the telomere maintenance functions of telomerase in human cancer cells. The crystal structures have been determined for a number of complexes between these small molecules and human telomeric DNA and RNA quadruplexes. The detailed structural characteristics of these complexes have been surveyed here and the variations in conformation for the TTA and UUA loops have been explored. Loop conformations have been classified in terms of a number of discrete types and their distribution among the crystal structures. Sugar conformation and backbone angles have also been examined and trends highlighted. One particular loop class has been found to be most prevalent. Implications for in particular, rational drug design, are discussed.     

Acceleration of DNA strand exchange by polycation comb-type copolymer.

The accelerating effect of cationic substances on DNA strand exchange reaction between 20 bp DNA duplex and its complementary single strand was studied. A comb-type polycationic copolymer which is composed of poly (L-lysine) backbone and dextran graft chain (PLL-g-Dex) and known to stabilize triplex DNA expedites the strand exchange reaction under physiological relevant conditions. Electrostatically small excess of the copolymer increased DNA strand exchange rate by 300-fold while large excess of spermine or cethyltrimethylammonium bromide, cationic detergent known to promote markedly hybridization of complementary DNA strands, showed slight effect. It should be noted that the copolymer promotes the strand exchange reaction while it stabilizes double stranded DNA.     

Acceleration of DNA strand exchange by polycation comb-type copolymer.

Polycation comb-type copolymers which are composed of poly(L-lysine) backbone and dextran graft chain (PLL-graft-Dex) accelerated DNA duplex and triplex formation and stabilized under physiologically relevant condition remarkably. In this study, we have examined the ability of polycation copolymer in promoting strand exchange between duplex DNA and its complementary single-stranded DNA. It was demonstrated that the strand exchange rate was considerably accelerated by the polycation comb-type copolymer.     

Novel trisubstituted acridines as human telomeric quadruplex binding ligands

A novel series of trisubstituted acridines were synthesized with the aim of mimicking the effects of BRACO19. These compounds were synthesized by modifying the molecular structure of BRACO19 at positions 3 and 6 with heteroacyclic moieties. All of the derivatives presented in the study exhibited stabilizing effects on the human telomeric DNA quadruplex. UV–vis spectroscopy, circular dichroism, linear dichroism and viscosimetry were used in order to study the nature of the DNA binding in more detail. The results show that all of the novel derivatives were able to fold the single-stranded DNA sequences into antiparallel G-quadruplex structures, with derivative 15 exhibiting the highest stabilizing capability. Cell cycle analysis revealed that a primary trend of the “braco”-like derivatives was to arrest the cells in the S- and G₂M-phases of the cell cycle within the first 72 h, with derivative 13 and BRACO19 proving particularly effective in suppressing cell proliferation. All studies derivatives were less toxic to human fibroblast cell line in comparison with HT 29 cancer cell line.     

Frustrated folding of guanine quadruplexes in telomeric DNA

Human chromosomes terminate in long, single-stranded, DNA overhangs of the repetitive sequence (TTAGGG)n. Sets of four adjacent TTAGGG repeats can fold into guanine quadruplexes (GQ), four-stranded structures that are implicated in telomere maintenance and cell immortalization and are targets in cancer therapy. Isolated GQs have been studied in detail, however much less is known about folding in long repeat sequences. Such chains adopt an enormous number of configurations containing various arrangements of GQs and unfolded gaps, leading to a highly frustrated energy landscape. To better understand this phenomenon, we used mutagenesis, thermal melting, and global analysis to determine stability, kinetic, and cooperativity parameters for GQ folding within chains containing 8–12 TTAGGG repeats. We then used these parameters to simulate the folding of 32-repeat chains, more representative of intact telomeres. We found that a combination of folding frustration and negative cooperativity between adjacent GQs increases TTAGGG unfolding by up to 40-fold, providing an abundance of unfolded gaps that are potential binding sites for telomeric proteins. This effect was most pronounced at the chain termini, which could promote telomere extension by telomerase. We conclude that folding frustration is an important and largely overlooked factor controlling the structure of telomeric DNA.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Molecular dynamics and principal components analysis of human telomeric quadruplex multimers

Guanine-rich DNA repeat sequences located at the terminal ends of chromosomal DNA can fold in a sequence-dependent manner into G-quadruplex structures, notably the terminal 150-200 nucleotides at the 3′ end, which occur as a single-stranded DNA overhang. The crystal structures of quadruplexes with two and four human telomeric repeats show an all-parallel-stranded topology that is readily capable of forming extended stacks of such quadruplex structures, with external TTA loops positioned to potentially interact with other macromolecules. This study reports on possible arrangements for these quadruplex dimers and tetramers, which can be formed from 8 or 16 telomeric DNA repeats, and on a methodology for modeling their interactions with small molecules. A series of computational methods including molecular dynamics, free energy calculations, and principal components analysis have been used to characterize the properties of these higher-order G-quadruplex dimers and tetramers with parallel-stranded topology. The results confirm the stability of the central G-tetrads, the individual quadruplexes, and the resulting multimers. Principal components analysis has been carried out to highlight the dominant motions in these G-quadruplex dimer and multimer structures. The TTA loop is the most flexible part of the model and the overall multimer quadruplex becoming more stable with the addition of further G-tetrads. The addition of a ligand to the model confirms the hypothesis that flat planar chromophores stabilize G-quadruplex structures by making them less flexible.     

Inhibited complete folding of consecutive human telomeric G-quadruplexes

Noncanonical DNA structures, termed G-quadruplexes, are present in human genomic DNA and are important elements in many DNA metabolic processes. Multiple sites in the human genome have G-rich DNA stretches able to support formation of several consecutive G-quadruplexes. One of those sites is the telomeric overhang region that has multiple repeats of TTAGGG and is tightly associated with both cancer and aging. We investigated the folding of consecutive G-quadruplexes in both potassium- and sodium-containing solutions using single-molecule FRET spectroscopy, circular dichroism, thermal melting and molecular dynamics simulations. Our observations show coexistence of partially and fully folded DNA, the latter consisting of consecutive G-quadruplexes. Following the folding process over hours in sodium-containing buffers revealed fast G-quadruplex folding but slow establishment of thermodynamic equilibrium. We find that full consecutive G-quadruplex formation is inhibited by the many DNA structures randomly nucleating on the DNA, some of which are off-path conformations that need to unfold to allow full folding. Our study allows describing consecutive G-quadruplex formation in both nonequilibrium and equilibrium conditions by a unified picture, where, due to the many possible DNA conformations, full folding with consecutive G-quadruplexes as beads on a string is not necessarily achieved.     

Cross-links of quadruplex structures from human telomeric DNA by dinuclear platinum complexes show the flexibility of both structures

The folding of AG(3)(T(2)AG(3))(3) was investigated in the presence of Na(+) or K(+) ions, by using the dinuclear platinum complexes [{trans-PtCl(NH(3))(2)}(2)H(2)N(CH(2))(n)NH(2)]Cl(2) (n = 2 or 6). AG(3)(T(2)AG(3))(3) has been previously found to adopt two different quadruplex structures: the antiparallel one in a solution containing Na(+) and the parallel one in a K(+)-containing crystal. The two structures are strikingly distinct and are not expected to form the same platinum cross-links. Therefore, characterization of the cross-links formed with platinum complexes in solution allowed the predominant conformation(s) to be identified. The bases coordinating the platinum atoms were identified by chemical and 3'-exonuclease digestions. The observed cross-links showed that the parallel structure exists in solution whatever the cation and confirmed the existence of the antiparallel structure in the presence of both cations as previously reported from cross-linking experiments of AG(3)(T(2)AG(3))(3) by mononuclear platinum complexes. Furthermore, the major platinum cross-links were unexpectedly formed between two guanines belonging to the same G-quartet. Their formation was rationalized using molecular dynamics simulations in implicit solvent of the two quadruplex structures. It was shown that they were flexible, allowing some guanines to leave reversibly the top G-quartet and thus rendering their N(7) atom accessible to platinum complexes. Our results also suggest that the human telomere sequence could be a target for such platinum complexes.     

Activation of DNA strand exchange by cationic comb-type copolymers: effect of cationic moieties of the copolymers

We have previously reported that poly(l-lysine)-graft-dextran cationic comb-type copolymers accelerate strand exchange reaction between duplex DNA and its complementary single strand by >4 orders of magnitude, while stabilizing duplex. However, the stabilization of the duplex is considered principally unfavourable for the accelerating activity since the strand exchange reaction requires, at least, partial melting of the initial duplex. Here we report the effects of different cationic moieties of cationic comb-type copolymers on the accelerating activity. The copolymer having guanidino groups exhibited markedly higher accelerating effect on strand exchange reactions than that having primary amino groups. The high accelerating effect of the former is considered to be due to its lower stabilizing effect on duplex DNA, resulting from its increased affinity to single-stranded DNA. The difference in affinity was clearly demonstrated by a fluorescence correlation spectroscopy study; the interaction of the former with single-stranded DNA still remained high even at 1 M NaCl, while that of the latter completely disappeared. These results suggest that some modes of interactions, such as hydrogen bonding, other than electrostatic interactions between the copolymers having guanidino groups and DNAs may be involved in strand exchange activation.     

Structural polymorphism of intramolecular quadruplex of human telomeric DNA: effect of cations, quadruplex-binding drugs and flanking sequences

G-quadruplex structures formed in the telomeric DNA are thought to play a role in the telomere function. Drugs that stabilize the G-quadruplexes were shown to have anticancer effects. The structures formed by the basic telomeric quadruplex-forming unit G(3)(TTAG(3))(3) were the subject of multiple studies. Here, we employ (125)I-radioprobing, a method based on analysis of the distribution of DNA breaks after decay of (125)I incorporated into one of the nucleotides, to determine the fold of the telomeric DNA in the presence of TMPyP4 and telomestatin, G-quadruplex-binding ligands and putative anticancer drugs. We show that d[G(3)(TTAG(3))(3)(125)I-CT] adopts basket conformation in the presence of NaCl and that addition of either of the drugs does not change this conformation of the quadruplex. In KCl, the d[G(3)(TTAG(3))(3)(125)I-CT] is most likely present as a mixture of two or more conformations, but addition of the drugs stabilize the basket conformation. We also show that d[G(3)(TTAG(3))(3)(125)I-CT] with a 5'-flanking sequence folds into (3+1) type 2 conformation in KCl, while in NaCl it adopts a novel (3+1) basket conformation with a diagonal central loop. The results demonstrate the structural flexibility of the human telomeric DNA; and show how cations, quadruplex-binding drugs and flanking sequences can affect the conformation of the telomeric quadruplex.     

Drug recognition and stabilisation of the parallel-stranded DNA quadruplex d(TTAGGGT)4 containing the human telomeric repeat

The NMR structure of the parallel-stranded DNA quadruplex d(TTAGGGT)(4), containing the human telomeric repeat, has been determined in solution in complex with a fluorinated pentacyclic quino[4,3,2-kl]acridinium cation (RHPS4). RHPS4 has been identified as a potent inhibitor of telomerase at submicromolar levels (IC(50) value of 0.33(+/-0.13)microM), exhibiting a wide differential between telomerase inhibition and acute cellular toxicity. All of the data point to RHPS4 exerting its chemotherapeutic potency through interaction with, and stabilisation of, four-stranded G-quadruplex structures. RHPS4 forms a dynamic interaction with d(TTAGGGT)(4), as evident from 1H and 19F linewidths, with fast exchange between binding sites induced at 318 K. Perturbations to DNA chemical shifts and 24 intermolecular nuclear Overhauser effects (NOEs) identify the 5'-ApG and 5'-GpT steps as the principle intercalation sites; a structural model has been refined using NOE-restrained molecular dynamics. The central G-tetrad core remains intact, with drug molecules stacking at the ends of the G-quadruplex. The partial positive charge on position 13-N of the acridine ring appears to act as a "pseudo" potassium ion and is positioned above the centre of the G-tetrad in the region of high negative charge density. In both ApG and GpT intercalation sites, the drug is seen to converge to the same orientation in which the pi-system of the drug overlaps primarily with two bases of each G-tetrad. The drug is held in place by stacking interactions with the G-tetrads; however, there is some evidence for a more dynamic, weakly stabilised A-tetrad that stacks partially on top of the drug at the 5'-end of the sequence. Together, the interactions of RHPS4 increase the t(m) of the quadruplex by approximately 20 degrees C. There is no evidence for drug intercalation within the G-quadruplex; however, the structural model strongly supports end-stacking interactions with the terminal G-tetrads.     

Binding properties of human telomeric quadruplex multimers: a new route for drug design

Human telomeric G-quadruplex structures are known to be promising targets for an anticancer therapy. In the past decade, several research groups have been focused on the design of new ligands trying to optimize the interactions between these small molecules and the G-quadruplex motif. In most of these studies, the target structures were the single quadruplex units formed by short human DNA telomeric sequences (typically 21-26 nt). However, the 3′-terminal single-stranded human telomeric DNA is actually 100-200 bases long and can form higher-order structures by clustering several consecutive quadruplex units (multimers). Despite the increasing number of structural information on longer DNA telomeric sequences, very few data are available on the binding properties of these sequences compared with the shorter DNA telomeric sequences.In this paper we use a combination of spectroscopic (CD, UV and fluorescence) and calorimetric techniques (ITC) to compare the binding properties of the (TTAGGG)₈TT structure formed by two adjacent quadruplex units with the binding properties of the (AG₃TT)₄ single quadruplex structure. The three side-chained triazatruxene derivative azatrux and TMPyP4 cationic porphyrin were used as quadruplex ligands. We found that, depending on the drug, the number of binding sites per quadruplex unit available in the multimer structure was smaller or greater than the one expected on the basis of the results obtained from individual quadruplex binding studies. This work suggests that the quadruplex units along a multimer structure do not behave as completely independent. The presence of adjacent quadruplexes results in a diverse binding ability not predictable from single quadruplex binding studies. The existence of quadruplex-quadruplex interfaces in the full length telomeric overhang may provide an advantageous factor in drug design to enhance both affinity and selectivity for DNA telomeric quadruplexes.