Interaction of glucocorticoid · receptor complexes with rat liver nuclei

Some previous reports on acellular binding of glucocorticoid · receptor complexes to rat liver nuclei have pointed to the conclusion that there exists a small number of high affinity nuclear “receptor” sites. Various investigations lead us to the opposite conclusion and suggest that these results were actually due to the presence, in the cytosol, of one or several macromolecules which inhibited the binding to nuclei of steroid · receptor complexes. The mechanism of this inhibition was examined. It appeared to be due not to a competition between both molecules for the same nuclear acceptor site but to an interaction in the cytosol between teh inhibitor and the steroid · receptor complex which prevented the binding of the latter to the nuclei. The search for high affinity specific acceptor sites was also negative for physiological saline conditions and for the non-salt-extractable fraction of the nuclear receptor. When 940-fold purified receptor · steroid complexes were used, very high concentrations of complexes could be achieved and saturation of nuclei was then observed, but only under physiological ionic strength conditions. However, the interaction was of relatively low affinity (K_A = 3.8 · 10⁷ M^?1) and to a great number of acceptor sites (N = 26.2 pmol/mg DNA), largely exceeding the cellular concentration of receptor (5.8 pmol/mg DNA).These results suggested that saturation of nuclei by steroid · receptor complexes should not occur in the intact liver cell. They were confirmed by studies on the distribution of steroid · receptor complexes in liver slices incubated with various concentrations of [³H]dexamethasone. For all hormone concentrations a constant proportion (90%) of the complexes was found in the nuclei, thus showing no saturation of the nuclear acceptor sites.     

The nuclear matrix is the site of glucocorticoid receptor complex action in the nucleus

Binding of highly purified glucocorticoid receptor complexes to nuclear matrix was evaluated. Extraction of purified nuclei with 2M potassium chloride and brief deoxyribonuclease digestion leaves a matrix structure containing 1% of nuclear DNA and 6-12% of nuclear proteins. The nuclear matrix retained two binding sites for receptor complexes, a high affinity, low capacity site and a low affinity, high capacity site. These sites have affinities and capacities consistent with those reported for binding of these complexes to intact nuclei. More extensive deoxyribonuclease treatment of the matrix resulted in a marked reduction of high affinity complex binding. Furthermore, the DNA binding form of the receptor complex but not the unactivated receptor complex bound to DNA fibers anchored to nuclear matrix as visualized by 18 nm gold particle receptor complexes. The data suggest that the nuclear matrix is the major site for coordinating glucocorticoid hormone action in the nucleus.     

Binding of glucocorticoid receptors to DNA.

DNA has been implicated as the nuclear acceptor for receptor-glucocorticoid complexes. The present study concerns the interaction of these complexes, isolated from cultured rat hepatoma cells, with purified DNA. This association is rapid, reaching a maximum within a few minutes at 0 degrees, whereas dissociation requires several hours. DNA binds neither free glucocorticoids nor those complexed with transcortin or cytosol proteins different from the receptor. Receptors which are not complexed by steroid have little or no affinity for DNA. "Activation," necessary for the binding of receptor-steroid complexes to isolated nuclei, also enhances DNA binding. The capacity of DNA for binding receptor-steroid complexes is large; saturation was not observed at the complex concentrations studied, using either crude or partially purified receptor preparations. The association of complexes with DNA is inhibited by divalent cations, at increasing ionic strengths, and by mercurial reagents. Complexes bind equally well to bacterial, bacteriophage, or rat DNA; however, there was either no or substantially reduced binding by bacterial 23 S rRNA. The binding of complexes to native DNA is roughly 3-fold greater than to denatured DNA. These characteristics are consistent with the possibility that DNA is the nuclear acceptor for receptor-glucocorticoid complexes; however, the actual composition of the acceptor sites remains unknown.     

Specific binding of androgen and androgen-receptor complex by microsomes from rat ventral prostate

Microsomes from rat ventral prostate show the presence of a high affinity-low capacity population of androgen-binding sites with affinity for ionic exchange resin similar to that of cytosol androgen receptor (AR), as manifested by similar results obtained with hydroxylapatite. The affinity for mibolerone was similar for both forms (Ka = 0.5-2.9 x 10(10) M-1). The membrane-bound form can be extracted in hypotonic buffer, with retention of binding properties. Isotonic sucrose allowed higher degree of extractability of the microsomal AR than 10% (v/v) glycerol. The presence of hormone lends stability to the microsomal AR, while high salt or nonionic detergents have a deleterious effect on their longevity. The microsomal receptor form is not sensitive to serine-proteases as opposed to the cytosol AR. After exhaustive extraction of binding sites, microsomes are capable of accepting cytosol mibolerone-receptor complexes to a level corresponding to the concentration of depleted binding sites; microsomes from non-target tissue do not manifest such capability. Microsomal AR complexes do not bind DNA and they are not activated after heat treatment. Mixed preparations of extracted microsomal complexes with cytosol complexes showed heat-induced increased ability to bind DNA to the same level of diluted cytosol complex alone, indicating the absence of a microsomal inhibitor of DNA binding. The results indicate the co-existence of a non-DNA binding form of the AR in the microsomal membranes with the classical DNA binding form of the AR present in the cytosol of ventral prostate homogenates.     

Studies on the nuclear binding of steroid hormone-receptor complex; characteristics of binding of nuclei from fetal rat liver to 3H-dexamethasone-liver cytoplasmic receptor complex

Binding of 3H-dexamethasone (Dex)-rat liver cytoplasmic receptor complex to nuclei from fetal rat livers in vitro exhibited a high-affinity and saturable nature (Kd=1.5 X 10- M, maximal binding sites=470 fmole/mg DNA), and the binding was inhibited competitively by prior injection of Dex in vivo. While binding of 3H-Dex-receptor complex to nuclei from adult rat liver was in low affinity and unsaturable, and injection of Dex prior to the sacrifice of animals did not influence the nuclear binding to 3H-Dex-receptor complex in vitro. Differential salt-extraction with KCl solution of the nuclear bound 3H-Dex receptor complex revealed the presence of salt-extractable and residual forms of bound receptors. The amount of the fraction extracted with 0.3 M KCl reached its maximum at 10 min after the start of incubation, while the 1.0 M KCl-extractable and residual fractions reached their maximum plateaus after 30 min of the incubation. Scatchard analysis revealed that the binding of the receptor complex to the 0.3M and 1.0M KCl fractions was saturable, while the residual fraction did not show any tendency of saturation under the experimental conditions employed in the present study. The results obtained in this work were compared to those which have been reported by other investigators.     

An analysis of the binding of the chick oviduct progesterone-receptor to chromatin.

The binding of progesterone-receptor complexes to chromatin from target and nontarget tissues was studied in vitro. Chromatin from both target and nontarget tissues responds in a similar manner to saly and cofactors and has the same K(D) (approx. 3.10(-9) M) for the progesterone-receptor complex. The only observed difference in the binding of the progesterone-receptor complex to target and nontarget chromatins is the difference in total number of acceptor sites. oviduct chromatin has approx. 1300 sites/pg DNA, spleen chromatin has approx. 840 sites/pg DNA, and erythrocyte chromatin has about 330 sites/pg DNA. The K(D) and number of acceptor sites for progesterone-receptor complex binding to oviduct chromatin remains the same even after extensive purification of the progesterone-receptor complex. Activation of cytosol labeled with [3H]progesterone by preincubation at 25 degrees C, analogous to that required for maximal nuclear binding, occurs if the binding studies to chromatin are performed in 0.025 M salt. The absence of an observable temperature effect when the studies are performed at 0.15 M salt is due to the activation of the receptor by salt. The dissociation of the progesterone-receptor complex from chromatin exhibits a single dissociation rate and the initial event is the appearance of free progesterone rather than a progesterone-receptor complex. Lastly, the treatment of chromatin with an antibody prepared against either single-stranded DNA or double-stranded DNA does not alter the extent of binding of the progesterone-receptor complex. Similarly, pretreatment of chromatin with a single-stranded nuclease does not inhibit the capacity of chromatin to bind the hormone-receptor complex.     

Studies on the nuclear binding of steroid hormone-receptor complex; binding of liver and thymus dexamethasone-receptor complex and prostate dihydrotestosterone-receptor complex to nuclei from various tissues.

To examine the binding specificity of steroid hormone-cytoplasmic receptor complexes to nuclei, binding of 3H-dexamethasone (Dex)-liver, 3H-Dex-thymus and 3H-dihydrotestosterone (DHT)-prostate receptor complexes to nuclei from liver, prostate, thymus, spleen and kidney was studied. It was observed that a significant amount of steroid-receptor complexes was bound to any nuclei used in the present study and the extent of the binding of receptor complexes to nuclei from homologous tissues was not always greater than that to nuclei from heterogenous tissues. However, a significant portion of the 3H-Dex-liver and 3H-DHT-prostate receptor complexes was not absorbed by nuclei from kidney, spleem, and thymus, and the unabsorbed complexes were efficiently bound to liver and prostate nuclei. The results obtained indicate that two types of receptor complex with regard to nuclear binding were present in cytosols of liver and prostate; one binds to nuclei from kidney, spleen, thymus, liver and prostate and the other does not bind to nuclei from kidney, spleen and thymus but does bind to nuclei of liver and prostate. The latter type of receptor complex was not observed in the cytosol from the thymus.     

Cytosol type II sites in the rat uterus: interaction with an endogenous ligand

Previous studies from our laboratory demonstrated that normal, but not malignant tissues, contain a ligand which competes for [3H]estradiol binding to nuclear type II sites in the rat uterus. Since elevated nuclear levels of type II sites are correlated with estrogen stimulation of uterine growth and DNA synthesis, we believe this ligand may regulate cell growth. The present studies show that the ligand for nuclear type II sites also interacts with type II sites in uterine cytosol. This was demonstrated by dilution experiments which show that greater quantities of type II sites are measured in dilute (10 mg/ml) than in concentrated (40 mg/ml) uterine cytosol. Furthermore, stripping of uterine cytosol with 1% dextrancoated charcoal, or pre-binding cytosol type II sites to hydroxylapetite (HAP) prior to binding analysis, removed the ligand from these preparations such that high levels of type II sites were measured. Following charcoal stripping, cytosol type II sites demonstrated good specificity for estrogenic hormones but not progesterone, corticosterone, or the triphenylethylene anti-estrogen, nafoxidine. Since the level of type II sites in the cytosol always preceded and exceeded the level of this site measured in uterine nuclei at all times following estrogen treatment (0-96 h), we believe cytosol type II sites may function as an type II-ligand binding protein (LBP) which regulates the availability of the ligand for interaction with nuclear type II sites. This is consistent with our observation that type II sites are not depleted from uterine cytosol by estrogen treatment and nuclear type II sites are very tightly associated with the nuclear matrix.     

Binding of receptor-hydrocortisone complexes to isolated nuclei from embryonic neural retina cells

Hydrocortisone (HC) induces glutamine synthetase in the embryonic chick neural retina. The binding of cytoplasmic receptor-hydrocortisone (R-HC) complexes to isolated retina nuclei has been studied in a cell-free system. Optimal conditions, specificity and quantitative aspects of binding were determined. The isolated nuclei retained binding specificity for the R-HC complex prepared from retina cytosol. Free HC, estradiol-receptor complexes from retina cytosol and HC-receptor complexes from mouse brain cytosol or from chick serum did not bind to the nuclei. Assuming monovalency of the binding sites, the number of nuclear acceptor sites per retina cell for the R-HC complex was estimated to be in the range of 1500. These sites were resistant to RNAse but sensitive to DNAse.     

An analysis of the binding of the chick oviduct progesterone-receptor to chromatin

The binding of progesterone-receptor complexes to chromatin from target and nontarget tissues was studied in vitro. Chromatin from both target and non-target tissues responds in a similar manner to saly and cofactors and has the same K_D (approx. 3·10⁻⁹ M) for the progesterone-receptor complex. The only observed difference in the binding of the progesterone-receptor complex to target and nontarget chromatins is the difference in total number of acceptor sites. Oviduct chromatin has approx. 1300 sites/pg DNA, spleen chromatin has approx. 840 sites/pg DNA, and erythrocyte chromatin has about 330 sites/pg DNA. The K_D and number of acceptor sites for progesterone-receptor complex binding to oviduct chromatin remains the same even after extensive purification of the progesterone-receptor complex. Activation of cytosol labeled with [³H]progesterone by preincubation at 25°C, analogous to that required for maximal nuclear binding, occurs if the binding studies to chromatin are performed in 0.025 M salt. The absence of an observable temperature effect when the studies are performed at 0.15 M salt is due to the activation of the receptor by salt. The dissociation of the progesterone-receptor complex from chromatin exhibits a single dissociation rate and the initial event is the appearance of free progesterone rather than a progesterone-receptor complex. Lastly, the treatment of chromatin with an antibody prepared against either single-stranded DNA or double-stranded DNA does not alter the extent of binding of the progesterone-receptor complex. Similarly, pretreatment of chromatin with a single-stranded nuclease does not inhibit the capacity of chromatin to bind the hormone-receptor complex.     

In vitro interaction of 63-nickel(II) with chromatin and DNA from rat kidney and liver nuclei

The interaction of nickel(II) with chromatin was studied in vitro and in isolated nuclei from rat liver and kidney. Nickel(II) bound to chromatin, polynucleosomes (DNA + histone octamer protein complex), and to deproteinized DNA both in intact nuclei and in vitro. The amount of nickel(II) bound depended on the concentration of nickel(II), the presence of chromosomal proteins and the binding sites on DNA which provide a stable coordination environment for nickel(II). The binding of nickel(II) to chromatin and to DNA in whole nuclei was much slower than in vitro indicating that assessibility of the DNA binding sites was influenced by the presence of the nuclear membrane, nuclear matrix and nuclear proteins and/or by the condensed nuclear structure of chromatin. Since DNA containing bound nickel(II) was isolated from chromatin, nickel(II) directly interacted with stable binding sites on the DNA molecule in chromatin. Nickel(II) was associated with the histone and non-histone nuclear proteins as well as the DNA in rat liver and kidney chromatin. Nickel(II) was found to bind to calf thymus histones in vitro. Nickel(II)-nuclear protein and -DNA interactions were investigated by gel electrophoretic analysis of in vitro incubation products. Although nickel-histone and nickel-non-histone protein interactions were completely disrupted by the electrophoretic conditions, fluorography revealed the presence of inert nickel(II)-DNA and/or nickel(II)-DNA-protein complexes.     

Dynamics of oestrogen-receptor distribution between the cytosol and nuclear fractions of immature rat uterus after oestradiol administration.

1. The nuclear-myofibrilar (800g pellet) fraction of the uterus from immature (22-23 days old) rats not exposed to oestrogen exhibits saturable binding of oestradiol. The nuclear binding capacity represents approximately 10% of that of the cytosol fraction (approx. 3.5 fmol/mug of DNA). The predominant part (0.3.5 fmol/mug of DNA) of the nuclear binind sites are present in the residual pellet after extraction with 0.5 M-KC1. 2. By using an exchange technique in vitro, determinations of the nuclear binding sites have been carried out after administration of 1 mug of oestradiol in vivo. Within 0.5h after the hormone injection, the concentration of nuclear bindng sites increased to approx. 0.4 fmol/mug of DNA in the 0.5 M-KC1-extractable fraction, and to approx. 1.2 fmol/mug of DNA in the residual fraction. Meanwhile the cytosol oestrogen-receptor concentration decreased to approx. 10% of its initial value. In the following period from 0.5 h after the oestradiol injection onwards, the concentration of nuclear oestrogen receptors decreased with halflife values of approx. 140 and 200 min for the KC1(0.5 M)-extractable and residual form respectively. At the same time, the cytosol receptor concentration increased to reach approx. 50% of the initial value by the 6h. This increase could not be blocked by cycloheximide. The initial concentration of cytosol receptor was restored approx. 11h after the injection and the increase during the 6-11h period was sensitive to cycloheximide inhibition, suggesting protein-synthesis-dependence of the process. 3. With the (more) physiological dose of oestradiol (0.1 mug), the decrease the cytosol receptor was only 50% by 4h and this was followed by a period (up to 12h after injection) during which the initial concentration was restored. During this period the increase of the receptor can be blocked by cycloheximide.     

Concentration and cellular distribution of androgen receptor in human prostatic neoplasia: can estrogen treatment increase androgen receptor content?

The concentration of androgen receptor in cytosol (free and total sites) and nuclear fractions from benign (28 specimens) and malignant prostatic tissue from treated (16 specimens) and untreated patients (10 specimens) were assayed using [3H]methyltrienolone (3H R-1881) as ligand under conditions which stabilize AR and prevent binding of 3H R-1881 to progesterone receptor. It was found that optimum results were obtained when sodium molybdate (10 mM) was added after separation of the nuclear pellet rather than during tissue homogenization; when cytosol and nuclear exchange assays were carried out at 15 degrees C rather than at 0 degrees C; and when hydroxylapatite was used to separate free and bound steroid in the nuclear assay. Although AR values were variable in both BPH and carcinoma tissue, certain patterns of concentration, occupancy, and cellular distribution were observed in different patient groups. In BPH and untreated carcinoma tissue, the mean occupancy of cytosol AR by endogenous androgens was high, but the mean nuclear AR concentration was higher in BPH than in carcinoma tissue. Androgen receptor concentrations in tissue from orchiectomized patients were consistent with the effects of androgen deprivation: total cell AR was depleted, and a higher proportion was present as free cytosol AR. However, in tissue from most patients who had been treated with diethylstilbestrol (DES) on a long-term basis, total cell AR values were high. Although most of the AR was present as free cytosol AR, in three of four patients who had been treated with both orchiectomy and DES, the concentrations of bound cytosol AR and nuclear AR were similar to those in untreated patients.     

Interaction of glucocorticoid receptor-steroid complexes with acceptor sites.

The binding of the "activated" receptor-glucocorticoid complexes of cultured rat hepatoma cells to nuclei, chromatin, and DNA has been studied under cell-free conditions. A critical factor in determining the shape of the binding curve is shown to be an inhibitory material which is present in crude cytosol and which can be removed without destroying the receptor-steroid complex. These and other results argue that the apparent saturation observed in earlier experiments may have been due to the inhibitors. Thus, the actual number of acceptor sites in hepatoma tissue culture cell nuclei is much larger than previously estimated and their affinity for the complex is lower. Nuclear binding experiments indicate that the inhibitory material interacts with the receptor-steroid complex. The inhibitors appear to be macromolecular; but their effects cannot be mimicked by albumin or hemoglobin. The acceptor capacity at low ionic strength for binding receptor-glucocorticoid complexes increases when proceeding from nuclei to DNA. An analysis of the kinetics of association and dissociation and of the relative binding behavior of nuclei and DNA argues that the affinity of complex for nuclei is much greater than for DNA. DNA-associated histones reduce the amount of complex that binds to DNA. These and perhaps other chromosomal proteins may be responsible for the ordering of acceptor capacity. Evidence is presented that the difference in affinities of nuclear and DNA acceptors could also be due to chromosomal proteins. In nuclei, these proteins may thus both reduce the amount of complex binding by rendering regions of DNA less accessible and increase the binding affinity of some, or all, of those DNA binding sites which remain exposed.     

Androgen receptor complex binding in murine skeletal muscle nuclei

Examination of binding of androgen-receptor complexes from murine skeletal muscle cytosol was performed by modified nuclear retention assay and modified nuclear acceptor assay. The experiments showed the binding of androgen-receptor complexes to the nuclear acceptor sites to be a cooperative process. Hill analysis of the data obtained resulted in a Hill coefficient of 3,6. The apparent dissociation constant for binding of cytosolic [³H]-testosterone-receptor complexes to nuclei was found to be in the range of K_D = 6 ? 8 × 10^?11 M. The nuclear matrix was able to bind androgen-receptor complexes in a saturable way, too.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

The extraction by micrococcal nuclease of glucocorticoid receptors and mouse mammary tumor virus DNA sequences is dissociated.

Glucocorticoid receptors (RG) and mammary tumor virus (MM-TV) DNA sequences were extracted by micrococcal nuclease digestion from the nuclei of C3H mouse mammary tumor cells in order to specify their relative distribution in chromatin. RG was labelled and translocated into the nuclei by incubating cells with 3H Dexamethasone (3H Dex). The purified nuclei were then treated at 2 degrees C with micrococcal nuclease. Three chromatin fractions were successively obtained: an isotonic extract (ne3H1), ahypotonic extract (ne2) and the residual pellet (P). The Dex-RG complexes were measured by the hydroxyapatite technique. The MMTV DNA sequences were titrated by molecular hybridization with an excess of MMTV radioactive cDNA probe. Up to 75% of the nuclear 3H Dex and the MMTV radioactive cDNA probe. Up to 75% of the nuclear 3H Dex and MMTV DNA sequences were extracted in a concentration dependent manner while only 10-15% of nucleic acids became soluble in 10% perchloric acid. The extracted 3H Dex-RG complex was found to be partly bound to soluble chromatin and partly free. The free complex displayed similar sedimentation constants (4S, 7S) and DNA binding ability to the cytosol receptor. The 3H Dex-RG complexes were 2 to 8 fold more concentrated in ne1, which is known to be enriched in active chromatin, than in ne2. Conversely, the concentration of MMTV DNA sequences per microgram DNA was the same in the three nuclear fractions. These results suggest that the Dex-RG complexes are concentrated in an active fraction of chromatin. We propose that, among the 20-30 copies of MMTV genes per haploid genome, only a small proportion are transcribed or regulated.     

Human progesterone receptor binding to mouse mammary tumor virus deoxyribonucleic acid: dependence on hormone and nonreceptor nuclear factor(s)

Using crude progesterone receptor preparations from T47D human breast cancer cells, we show by immunoprecipitation assay that receptor specifically and with high affinity recognizes the hormone response element (HRE) of the mouse mammary tumor virus (MMTV). The use of crude preparations minimizes alterations of receptors or loss of associated factors that may occur during purification. Specific binding was obtained at 1:1 molar ratios of receptor to DNA, and HRE sequences are recognized with an affinity at least 3 orders of magnitude greater than nonspecific DNA. We have compared the DNA-binding activities of different forms of progesterone receptors. The unliganded 8S cytosol receptor had low but detectable binding activity for MMTV DNA. Addition of hormone to cytosol produced a small but consistent 2.5-fold increase. In vitro methods of transforming cytosol receptors from an 8S to a 4S species failed to increase DNA-binding further. By contrast, 4S receptors bound by R5020 in whole cells and extracted from nuclei by salt, displayed a substantially higher (average, 11-fold) binding activity than an equal number of unliganded cytosol receptors. The dissociation constants for cytosol and nuclear receptor binding to MMTV DNA were similar (approximately 2 x 10(-9) M). Thus, nuclear receptors possess a higher capacity for binding to specific recognition sequences. These results suggest that hormone or a hormone-dependent mechanism increases the intrinsic DNA-binding activity of receptors independent of receptor transformation from 8S to 4S. Further experiments indicate that a nonreceptor activity in nuclear extracts can increase the sequence-specific DNA-binding activity of cytosol receptors. This activity is present in both T47D cells and receptor-negative MDA-231 cells. We conclude that the higher DNA-binding activity of the nuclear receptor-hormone complex is due in part to receptor interaction with other nuclear proteins or factors. Such interactions may function to maintain receptors in a disaggregated active complex or to stabilize their binding to specific DNA sites.     

Structure, subnuclear distribution, and nuclear matrix association of the mammalian telomeric complex

Mammalian telomeres are composed of long arrays of TTAGGG repeats complexed with the TTAGGG repeat binding factor, TRF. Biochemical and ultrastructural data presented here show that the telomeric DNA and TRF colocalize in individual, condensed structures in the nuclear matrix. Telomeric TTAGGG repeats were found to carry an array of nuclear matrix attachment sites occurring at a frequency of at least one per kb. The nuclear matrix association of the telomeric arrays extended over large domains of up to 20-30 kb, encompassing the entire length of most mammalian telomeres. TRF protein and telomeric DNA cofractionated in nuclear matrix preparations and colocalized in discrete, condensed sites throughout the nuclear volume. FISH analysis indicated that TRF is an integral component of the telomeric complex and that the presence of TRF on telomeric DNA correlates with the compact configuration of telomeres and their association with the nuclear matrix. Biochemical fractionation of TRF and telomeric DNA did not reveal an interaction with the nuclear lamina. Furthermore, ultrastructural analysis indicated that the mammalian telomeric complex occupied sites throughout the nuclear volume, arguing against a role for the nuclear envelope in telomere function during interphase. These results are consistent with the view that mammalian telomeres form nuclear matrix- associated, TRF-containing higher order complexes at dispersed sites throughout the nuclear volume.