Nucleotide sequence of a spinach chloroplast valine tRNA.

The nucleotide sequence of a spinach chloroplast valine tRNA (sp. chl. tRNA Val) has been determined. This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N. crassa, 61-62% homology). Sp. chl. tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology). Sp. chl. tRNA Val, like all other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs.     

The nucleotide sequence of spinach chloroplast methionine elongator tRNA.

The nucleotide sequence of spinach chloroplast methionine elongator tRNA (sp. chl. tRNAm Met) has been determined. This tRNA is considerably more homologous to E. coli tRNAm Met (67% homology) than to the three known eukaryotic tRNAm Met (50-55% homology). Sp. chl. tRNAm Met, like the eight other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs.     

Yeast mitochondrial methionine initiator tRNA: characterization and nucleotide sequence.

Two methionine tRNAs from yeast mitochondria have been purified. The mitochondrial initiator tRNA has been identified by formylation using a mitochondrial enzyme extract. E. coli transformylase however, does not formylate the yeast mitochondrial initiator tRNA. The sequence was determined using both 32P-in vivo labeled and 32P-end labeled mt tRNAf(Met). This tRNA, unlike N. crassa mitochondrial tRNAf(Met), has two structural features typical of procaryotic initiator tRNAs: (i) it lacks a Watson-Crick base-pair at the end of the acceptor stem and (ii) has a T-psi-C-A sequence in loop IV. However, both yeast and N. crassa mitochondrial initiator tRNAs have a U11:A24 base-pair in the D-stem unlike procaryotic initiator tRNAs which have A11:U24. Interestingly, both mitochondrial initiator tRNAs, as well as bean chloroplast tRNAf(Met), have only two G:C pairs next to the anticodon loop, unlike any other initiator tRNA whatever its origin. In terms of overall sequence homology, yeast mitochondrial tRNA(Met)f differs from both procaryotic or eucaryotic initiator tRNAs, showing the highest homology with N. crassa mitochondrial initiator tRNA.     

The nucleotide sequence and characterization of four chloroplast tRNAs from the alga codium fragile

The nucleotide sequences of four chloroplast tRNAs (methionine elongator, lysine, glycine, and arginine) from the siphonaceous green alga Codium fragile have been determined. These tRNAs have an unusually high A-U content compared to other chloroplast tRNAs and show varied, but in general only limited, sequence homology to the corresponding tRNAs of other chloroplasts. The locations of the genes for these four tRNAs have been determined and they show no similarity to the location of the corresponding tRNA genes in other chloroplasts. The Codium chloroplast glycine tRNA has an unmodified uridine in the wobble position of the anticodon, a characteristic rarely found in tRNA but present in mitochondrial tRNAs which read the genetic code by extended wobble.     

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCA_OH. It shows 93% homology with spinach chloroplast tRNA^Pro (UGG) and 72% homology with bean mitochondrial tRNA^Pro (UGG), the other two known plant organellar tRNAs^Pro.     

Structure and function of initiator methionine tRNA from the mitochondria of Neurospora crassa.

Initiator methionine tRNA from the mitochondria of Neurospora crassa has been purified and sequenced. This mitochondrial tRNA can be aminoacylated and formylated by E. coli enzymes, and is capable of initiating protein synthesis in E. coli extracts. The nucleotide composition of the mitochondrial initiator tRNA (the first mitochondrial tRNA subjected to sequence analysis) is very rich in A + U, like that reported for total mitochondrial tRNA. In two of the unique features which differentiate procaryotic from eucaryotic cytoplasmic initiator tRNAs, the mitochondrial tRNA appears to resemble the eucaryotic initiator tRNAs. Thus unlike procaryotic initiator tRNAs in which the 5′ terminal nucleotide cannot form a Watson-Crick base pair to the fifth nucleotide from the 3′ end, the mitochondrial tRNA can form such a base pair; and like the eucaryotic cytoplasmic initiator tRNAs, the mitochondrial initiator tRNA lacks the sequence -TΨCG(or A) in loop IV. The corresponding sequence in the mitochondrial tRNA, however, is -UGCA- and not -AU(or Ψ)CG-as found in all eucaryotic cytoplasmic initiator tRNAs. In spite of some similarity of the mitochondrial initiator tRNA to both eucaryotic and procaryotic initiator tRNAs, the mitochondrial initiator tRNA is basically different from both these tRNAs. Between these two classes of initiator tRNAs, however, it is more homologous in sequence to procaryotic (56–60%) than to eucaryotic cytoplasmic initiator tRNAs (45–51%).     

Transfer RNA genes in the cap-oxil region of yeast mitochondrial DNA.

A cytoplasmic "petite" (rho-) clone of Saccharomyces cerevisiae has been isolated and found through DNA sequencing to contain the genes for cysteine, histidine, leucine, glutamine, lysine, arginine, and glycine tRNAs. This clone, designated DS502, has a tandemly repeated 3.5 kb segment of the wild type genome from 0.7 to 5.6 units. All the tRNA genes are transcribed from the same strand of DNA in the direction cap to oxil. The mitochondrial DNA segment of DS502 fills a sequence gap that existed between the histidine and lysine tRNAs. The new sequence data has made it possible to assign accurate map positions to all the tRNA genes in the cap-oxil span of the yeast mitochondrial genome. A detailed restriction map of the region from 0 to 17 map units along with the locations of 16 tRNA genes have been determined. The secondary structures of the leucine and glutamine tRNAs have been deduced from their gene sequences. The leucine tRNA exhibits 64% sequence homology to an E. coli leucine tRNA.     

Identification of two methionine transfer RNA genes in the maize mitochondrial genome

Two methionine transfer RNA (tRNA) genes were identified in the maize mitochondrial genome by nucleotide sequence analysis. One tRNA gene was similar in nucleotide sequence and secondary structure to the initiator methionine tRNA genes of eubacteria and higher plant chloroplast genomes. This tRNA gene also had extensive nucleotide homology (99%) with an initiator methionine tRNA gene described for the wheat mitochondrial genome. The other methionine tRNA gene sequence was distinct and more closely resembled an elongator methionine tRNA.     

Lupin chloroplast and mitochondrial tRNA populations and their genes

Transfer RNAs isolated from lupin chloroplasts and mitochondria were compared by two-dimensional gel electrophoresis. Twenty chloroplast and 24 mitochondrial tRNA species were identified. The saturation hybridization between lupin chloroplast DNA and 125I-labelled lupin chloroplast tRNAs pointed to the presence of about 34 tRNA genes in lupin chloroplast DNA. The number of mitochondrial tRNA genes estimated by the same method was about 30 genes. EcoRI restriction digest of lupin mitochondrial DNA probed with 32P-labelled lupin mitochondrial tRNAs revealed only a small number of positive restriction fragments. Some of these mitochondrial restriction fragments hybridized with 32P-labelled chloroplast tRNA.     

The leaky UGA termination codon of tobacco rattle virus RNA is suppressed by tobacco chloroplast and cytoplasmic tRNAs(Trp) with CmCA anticodon.

RNA-1 molecules from tobacco rattle virus (TRV) and pea early-browning virus (PEBV), two members of the tobravirus group, have recently been shown to contain internal, in-frame UGA termination codons which are suppressed in vitro. Our results suggest that a UGA stop codon also exists in RNA-1 of pepper ringspot virus (PRV), another tobravirus. UGA suppression may therefore be a universal feature of the expression of tobravirus genomes. We have isolated two natural suppressor tRNAs from uninfected tobacco plants on the basis of their ability to promote readthrough over the leaky UGA codon of TRV RNA-1 in a wheat germ extract depleted of endogenous mRNAs and tRNAs. Their amino acid acceptance and nucleotide sequences identify the two UGA-suppressor tRNAs as chloroplast (chl) and cytoplasmic (cyt) tryptophan-specific tRNAs with the anticodon CmCA. These are the first UGA suppressor tRNAs to be identified in plants. They have several interesting features. (i) Chl tRNA(Trp) suppresses the UGA stop codon more efficiently than cyt tRNA(Trp). (ii) Chl tRNA(Trp) contains an A24:U11 pair in the D-stem as does the mutated Escherichia coli UGA-suppressor tRNA(Trp) which is a more active suppressor than wild-type tRNA(Trp). (iii) The suppressor activity of chl tRNA(Trp) is dependent on the nucleotides surrounding the stop codon because it recognizes UGA in the TRV context but not the UGA in the beta-globin context.     

Mitochondrial tRNAs as light strand replication origins: Similarity between anticodon loops and the loop of the light strand replication origin predicts initiation of DNA replication

Stem-loop hairpins formed by mitochondrial light strand replication origins (OL) and by heavy strand DNA coding for tRNAs that form OL-like structures initiate mitochondrial replication. The loops are recognized by one of the two active sites of the vertebrate mitochondrial gamma polymerase, which are homologuous to the active sites of class II amino-acyl tRNA synthetases. Therefore, the polymerase site recognizing the OL loop could recognize tRNA anticodon loops and sequence similarity between anticodon and OL loops should predict initiation of DNA replication at tRNAs. Strengths of genome-wide deamination gradients starting at tRNA genes estimate extents by which replication starts at that tRNA. Deaminations (A→G and C→T) occur proportionally to time spent single stranded by heavy strand DNA during mitochondrial light strand replication. Results show that deamination gradients starting at tRNAs are proportional to sequence similarity between OL and tRNA loops: most for anticodon-, least D-, intermediate for TψC-loops, paralleling tRNA synthetase recognition interactions with these tRNA loops. Structural and sequence similarities with regular OLs predict OL function, loop similarity is dominant in most tRNAs. Analyses of sequence similarity and structure independently substantiate that DNA sequences coding for mitochondrial tRNAs sometimes function as alternative OLs. Pathogenic mutations in anticodon loops increase similarity with the human OL loop, non-pathogenic polymorphisms do not. Similarity/homology alignment hypotheses are experimentally testable in this system.     

Transfer RNAs of potato (Solanum tuberosum) mitochondria have different genetic origins.

Total transfer RNAs were extracted from highly purified potato mitochondria. From quantitative measurements, the in vivo tRNA concentration in mitochondria was estimated to be in the range of 60 microM. Total potato mitochondrial tRNAs were fractionated by two-dimensional polyacrylamide gel electrophoresis. Thirty one individual tRNAs, which could read all sense codons, were identified by aminoacylation, sequencing or hybridization to specific oligonucleotides. The tRNA population that we have characterized comprises 15 typically mitochondrial, 5 'chloroplast-like' and 11 nuclear-encoded species. One tRNA(Ala), 2 tRNAs(Arg), 1 tRNA(Ile), 5 tRNAs(Leu) and 2 tRNAs(Thr) were shown to be coded for by nuclear DNA. A second, mitochondrial-encoded, tRNA(Ile) was also found. Five 'chloroplast-like' tRNAs, tRNA(Trp), tRNA(Asn), tRNA(His), tRNA(Ser)(GGA) and tRNA(Met)m, presumably transcribed from promiscuous chloroplast DNA sequences inserted in the mitochondrial genome, were identified, but, in contrast to wheat (1), potato mitochondria do not seem to contain 'chloroplast-like' tRNA(Cys) and tRNA(Phe). The two identified tRNAs(Val), as well as the tRNA(Gly), were found to be coded for by the mitochondrial genome, which again contrasts with the situation in wheat, where the mitochondrial genome apparently contains no tRNA(Val) or tRNA(Gly) gene (2).     

Nuclear-encoded mitochondrial tRNAs of Trypanosoma brucei have a modified cytidine in the anticodon loop.

The mitochondrial genome of Trypanosoma brucei does not appear to encode any tRNA genes. Isolated organellar tRNAs hybridize to nuclear DNA, suggesting that they are synthesized in the nucleus and subsequently imported into the mitochondrion. Most imported tRNAs have cytosolic counterparts, showing identical mobility on two-dimensional polyacrylamide gels. We have compared three nuclear-encoded mitochondrial tRNAs (tRNA(Lys), tRNA(Leu), tRNA(Tyr)) with their cytosolic isoforms by direct enzymatic sequence analysis. Our findings indicate that the primary sequences of the mitochondrial and the corresponding cytosolic tRNAs are identical. However, we have identified a mitochondrion-specific nucleotide modification of each tRNA which is localized to a conserved cytidine residue at the penultimate position 5' of the anticodon. The modification present in mature mitochondrial tRNA(Tyr) was not found in a mutant tRNA(Tyr) defective in splicing in either cytosolic or mitochondrial fractions. The mutant tRNA(Tyr) has been expressed in transformed cells and its import into mitochondria has been demonstrated, suggesting that the modified cytidine residue is not required for import and therefore may be involved in adapting imported tRNAs to specific requirements of the mitochondrial translation machinery.     

Nucleotide sequences of the mitochondrial genes trnS(TGA) encoding tRNA(TGASer) in Oenothera berteriana and Arabidopsis thaliana

The genes encoding tRNA(TGASer) have been investigated in the mitochondrial (mt) genomes of Oenothera berteriana and Arabidopsis thaliana. Sequence analysis shows four nucleotide (nt) differences between the two dicots, but only two differences between each dicot and the available monocot sequences. Similarity comparisons identify these genes as encoding a native mt tRNA(TGASer), with less than 77% of the nt identical to the corresponding chloroplast tRNAs.     

tRNAs are imported into mitochondria of Trypanosoma brucei independently of their genomic context and genetic origin.

The mitochondrial genome of Trypanosoma brucei does not encode any identifiable tRNAs. Instead, mitochondrial tRNAs are synthesized in the nucleus and subsequently imported into mitochondria. In order to analyse the signals which target the tRNAs into the mitochondria, an in vivo import system has been developed: tRNA variants were expressed episomally and their import into mitochondria assessed by purification and nuclease treatment of the mitochondrial fraction. Three tRNA genes were tested in this system: (i) a mutated version of the trypanosomal tRNA(Tyr); (ii) a cytosolic tRNA(His) of yeast; and (iii) a human cytosolic tRNA(Lys). The tRNAs were expressed in their own genomic context, or containing various lengths of the 5'-flanking sequence of the trypanosomal tRNA(Tyr) gene. In all cases efficient import of each of the tRNAs was observed. We independently confirmed the mitochondrial import of the yeast tRNA(His), since in organello [alpha-32P]ATP-labelling of the 3'-end of the tRNA was inhibited by carboxyatractyloside, a highly specific inhibitor of the mitochondrial adenine nucleotide translocator. Import of heterologous tRNAs in their own genomic contexts supports the conclusion that no specific targeting signals are necessary to import tRNAs into mitochondria of T. brucei, but rather that the tRNA structure itself is sufficient to specify import.     

A sequence motif within trypanosome precursor tRNAs influences abundance and mitochondrial localization

Trypanosoma brucei lacks mitochondrial genes encoding tRNAs and must import nuclearly encoded tRNAs from the cytosol. The mechanism and specificity of this process remain unclear. We have identified a unique sequence motif, YGG(C/A)RRC, upstream of the genes encoding mitochondrially localized tRNAs in T. brucei. Both in vitro import studies and in vivo transfection studies indicate that deletion of the YGG(C/A)RRC sequence alters mitochondrial localization of tRNA(Leu), and in vivo studies also show a decrease in the cellular abundance of tRNA(Leu). These studies provide direct evidence for cis-acting RNA motifs within precursor tRNAs that facilitate the selection of tRNAs for mitochondrial import in trypanosomes. Furthermore, we found that mutations to the YGG(C/A)RRC sequence also altered the intracellular distribution of other endogenous tRNAs, suggesting a general role for this sequence in tRNA trafficking in trypanosomes.