共查询到20条相似文献,搜索用时 15 毫秒
1.
Dissolution of alpha-cyclodextrin (alpha-CD) in 9:1 water-nitromethane smoothly generates the title compound, which crystallizes as the pentahydrate in the orthorhombic space group P2(1)2(1)2(1) with a = 9.452(4), b = 14.299(3), c = 37.380(10) A, and Z = 4. Its crystal structure analysis revealed the alpha-CD macrocycle in an unstrained conformation stabilized through a ring of O-2...O-3' hydrogen bonds between five of the six adjacent glucose residues. The nitromethane is located in the alpha-CD cavity in an orientation parallel to the plane of the macrocycle, and assumes two sites of equal population with the nitro group in excessive thermal motion; the guest is held by van der Waals contacts and C-H...O-type hydrogen bonds to the pyranose H-3 and H-5 protons. The packing of the macrocycles in the crystal lattice is of cage herringbone-type with an extensive intra- and intermolecular hydrogen bonding network. The ready formation of a nitromethane inclusion complex in aqueous nitromethane, and the subtleties of its molecular structure amply demonstrate the ease with which water is expelled from the alpha-CD cavity by a more hydrophobic co-solvent. 相似文献
2.
The decomposition of allyl isothiocyanate (AITC) in an aqueous solution was depressed in the presence of cyclodextrin (CD), it's suppression effect increasing in the order of none < beta-CD < alpha-CD. The results of kinetic and thermodynamic analysis of the CD-AITC inclusion complexes showed that the inclusion process was mostly governed by an enthalpy change (delta H degree) rather than by an entrophy change (delta S degree), and that Van der Waals forces played a primary role int he inclusion. Steric factors were important for the reaction activity of AITC inclusion into the CD cavity, especially significant being the stereospecificity between the size of the CD cavity and the AITC molecule which is the main factor concerning it's activity. Our results suggest that the association stability and activity of the included AITC molecule are important factors in the suppression mechanism for CDs. Therefore, both these factors would make an alpha-CD-AITC system more advantageous than a beta-CD-AITC system, and the marked suppression effect of alpha-CD on the decomposition of AITC can be attributed to the formation of inclusion complexes in an aqueous solution. 相似文献
3.
Cruciferous vegetables contain a series of relatively unique secondary metabolites of amino acids, called glucosinolates, from which isothiocyanates (ITC) can be generated. While glucosinolates are not thought to be bioactive directly, ITC appear to have anticarcinogenic activity. Sinigrin, the predominant aliphatic glucosinolate in cruciferous vegetables, is hydrolyzed to yield allylisothiocyanate (AITC), which, following absorption and metabolism in humans, is excreted in the urine as an N-acetyl-cysteine (NAC) conjugate. AITC possesses numerous biochemical and physiological activities. This study examined the induction of quinine reductase (QR) by AITC and synthetic AITC-NAC in Hepa1c1c7 murine hepatoma cells. AITC and AITC-NAC inhibited cell growth in a dose-dependent manner. The induction of QR activity and QR mRNA expression was dose-responsive over a range of 0.1-2.5 microM. AITC caused 2.0- and 3.1-fold inductions of QR with 1- and 2-microM treatments, respectively. By comparison, 1 and 2 microM AITC-NAC caused 2.9- and 3.7-fold inductions of QR, respectively. Considering the potential of ITC to prevent cancer, these results provide a basis for the use of NAC-ITC conjugates as chemopreventive agents. 相似文献
4.
Mhejabeen Shaikh Jyotirmayee Mohanty Achikanath C Bhasikuttan Haridas Pal 《Photochemical & photobiological sciences》2008,7(8):979-985
Ground state absorption and steady-state and time-resolved fluorescence measurements have been carried out to understand the host-guest interactions of p-diethylaminobenzonitrile (DEABN) and p-dimethylaminobenzonitrile (DMABN) dyes with alpha-cyclodextrin (alpha-CD) and beta-cyclodextrin (beta-CD) hosts. DEABN and DMABN dyes show both locally excited (LE) state and intramolecular charge transfer (ICT) state emissions in solution. The LE and ICT emissions of the dyes are seen to get modulated in the presence of alpha-CD and beta-CD hosts. The results indicate that the dyes form 1 : 1 inclusion complexes with both the hosts. Comparing the binding constants and the fluorescence characteristics of different dye x CD systems it is inferred that DEABN adopts a completely different orientation on complexation with alpha-CD than in the other cases of dye.CD systems. It is indicated that while in all other cases of dye x CD systems the N,N-dialkyl group of the dyes enters the host cavity leaving the C[triple bond, length as m-dash]N group projected out into the water phase, the DEABN dye enters the alpha-CD cavity (smallest CD) with its C[triple bond, length as m-dash]N group entering the host cavity. The differences in the orientation of the dye in the host cavities is understood to be determined by the requirement of maximum van der Waals contact of the encapsulated dye with the host cavity for maximum stability of the complex and the relative sizes of the substituents of the dye compared to the host cavities. From the observation that the binding constants for the present dye x CD systems are not that significantly high, it is inferred that the hydrophobic interaction mainly govern the inclusion complex formation in the present systems. 相似文献
5.
6.
Cyclomaltooligosaccharides (cyclodextrins, CDs) are cyclic oligomers having six, seven, or eight units of alpha-D-glucose, named as cyclomaltohexaose (alpha-CD), cyclomaltoheptaose (beta-CD) and cyclomaltooctaose (gamma-CD), respectively. The molecule of CD has a cavity in which the interior is hydrophobic relative to its outer surface. The solubility of cyclodextrins in water is unusual, as an irregular trend is observed in the series of the cyclic oligomers of glucose. beta-CD is at least nine times less soluble than the others CDs. This intriguing behavior has been investigated, and some interesting explanations in terms of the effect caused by CD on the water lattice structure have been proposed. In this work a comparative study on the solubility of alpha, beta, and gamma-cyclodextrins was carried out in H2O and D2O and reveals a much lower solubility of the three CDs in D2O. The solid-phase structure of the CDs in equilibrium with the solution is quite similar with both solvents. The results are discussed in terms of the CD molecular structure and the differences in the hydrogen bonds formed between H2O and D2O. 相似文献
7.
《Journal of enzyme inhibition and medicinal chemistry》2013,28(3):523-529
Earlier, we have reported the synthesis and anti-inflammatory evaluation of different 3-(4H-1,2,4-triazol-3-ylthio)-N-substituted propanamide. In this article, we are reporting the various tautomeric forms of the most active anti-inflammatory compound, 3-(4H-1,2,4-triazol-3-ylthio)-N-phenylpropanamide (6a) and their virtual screening by molecular docking using six principle tautomeric forms. Docking analysis suggested that compound 3-(4H-1,2,4-triazol-3-ylthio)-N-phenylpropanamide (6a) bound with COX-1 selectively and drug receptor complex was stabilized by tautomerism. Noticeably, hydroxy group formed by tautomerism appreciably improve the drug receptor interactions. It was also supervised that the compound 3-(4H-1,2,4-triazol-3-ylthio)-N-phenylpropanamide (6a) docked near the gate of COX-1 active site and might block the conversion of arachidonic acid to prostaglandin (PG) H2 in the active site of COXs. Moreover, we have carried out receptor based electrostatic analysis to clarify the electronic, steric and hydrophobic field requirement of 3-(4H-1,2,4-triazol-3-ylthio)-N-phenylpropanamide (6a) to interact with COX -1 receptor. 相似文献
8.
Supramolecular gene delivery vectors showing enhanced transgene expression and good biocompatibility
Soluble supramolecular inclusion complexes were formed by threading alpha-cyclodextrin (alpha-CD) molecules over poly(ethylene glycol) (PEG) and poly(epsilon-caprolactone) (PCL) chains of ternary block copolymers of PEG, PCL and polyethylenimine (PEI). Characteristic shifts of PCL absorptions in FTIR, (1)H NMR and UV spectra strongly suggest that alpha-CD is threaded over PEG and PCL blocks. Due to the reduced hydrophobic interaction between PCL blocks, the resulting supramolecular complexes displayed a dramatically increased solubility, in comparison with the ternary block copolymers. Their ability to complex DNA was almost as efficient as that of branched PEI 25 kDa, as shown in the ethidium bromide fluorescence quenching experiments. Resulting DNA polyplexes displayed a size of around 200 nm and a neutral surface charge. Microscopy studies in 3T3 fibroblasts revealed an efficient cellular uptake. Transfection efficiencies of inclusion complexes were in the same order of magnitude as PEI. In contrast to PEI a 100x lower toxicity was observed by MTT-assay, allowing the administration of nitrogen-to-phosphate ratios of up to 20. These new gene delivery systems merit further characterization under in vivo conditions. 相似文献
9.
Determination of conformational properties of glycolipid head groups by 2H NMR of oriented multibilayers 总被引:6,自引:0,他引:6
The conformations and orientations of the glucose and glycerol moieties of a monoglucosyl lipid in hydrated bilayers have been determined in detail by deuterium nuclear magnetic resonance (2H NMR). Multibilayer membranes of 1,2-di-O-tetradecyl-3-O-(beta-D-glucopyranosyl)glycerol (DTGL), of dimyristoylphosphatidylcholine (DMPC), and of a mixture of DTGL and DMPC were oriented between glass plates. The glucolipid was selectively labeled with deuterium on the pyranose ring and at C3 of glycerol, whereas DMPC was labeled at the C4 position of the sn-2 chain. Quadrupolar splittings were measured as a function of the angle between the bilayer normal and the magnetic field direction. The results establish that the director of motional averaging, the direction about which motion and order are axially symmetric, is the bilayer normal for all the head group, the glycerol backbone, and the hydrophobic core. Segmental order parameters were determined to be 0.45, 0.65, and 0.40, respectively, for the various regions of DTGL in the membranes. The latter results indicate that there is some motion on the time scale of 10(5) s-1 about the C1'(glucose)-O-C3(glycerol) glycosidic bond but that its amplitude is very restricted. Comparison of 1H-decoupled and 1H-coupled 2H NMR spectra of the C3-labeled glycolipid gave estimates of the 2H-2H dipolar coupling between the deuterons at this position. The orientation of the glycerol C3 hydroxymethylene subunit was calculated relative to the bilayer normal, and the C2-C3 bond was found to be tilted away from the bilayer normal by 3 +/- 1 degree.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献
10.
Liver fatty acid-binding protein (LFABP) is a 14 kDa cytosolic polypeptide, differing from other family members in the number of ligand binding sites, the diversity of bound ligands, and the transfer of fatty acid(s) to membranes primarily via aqueous diffusion rather than direct collisional interactions. Distinct two-dimensional (1)H-(15)N nuclear magnetic resonance (NMR) signals indicative of slowly exchanging LFABP assemblies formed during stepwise ligand titration were exploited, without determining the protein-ligand complex structures, to yield the stoichiometries for the bound ligands, their locations within the protein binding cavity, the sequence of ligand occupation, and the corresponding protein structural accommodations. Chemical shifts were monitored for wild-type LFABP and an R122L/S124A mutant in which electrostatic interactions viewed as being essential to fatty acid binding were removed. For wild-type LFABP, the results compared favorably with the data for previous tertiary structures of oleate-bound wild-type LFABP in crystals and in solution: there are two oleates, one U-shaped ligand that positions the long hydrophobic chain deep within the cavity and another extended structure with the hydrophobic chain facing the cavity and the carboxylate group lying close to the protein surface. The NMR titration validated a prior hypothesis that the first oleate to enter the cavity occupies the internal protein site. In contrast, (1)H and (15)N chemical shift changes supported only one liganded oleate for R122L/S124A LFABP, at an intermediate location within the protein cavity. A rationale based on protein sequence and electrostatics was developed to explain the stoichiometry and binding site trends for LFABPs and to put these findings into context within the larger protein family. 相似文献
11.
Structure of the K95 antigen from Escherichia coli O75:K95:H5, a capsular polysaccharide containing furanosidic KDO-residues 总被引:1,自引:0,他引:1
The structure of the K95 antigenic capsular polysaccharide (K95 antigen) of Escherichia coli O75:K95:H5 was elucidated by determination of the composition, 1H- and 13C-n.m.r. spectroscopy, periodate oxidation, and methylation analysis. The K95 polysaccharide, which contains furanosidic 3-deoxy-D-manno-2-octulosonic acid (KDOf) residues, consists of----3)-beta-D-Rib-(1----8)-KDOf-(2----repeating units, has a molecular weight of approximately 25,000 (approximately 65 repeating units), and is randomly O-acetylated (1 acetyl group per repeating unit at unknown positions). 相似文献
12.
A series of 16 1-phenyl-1H-1,2,3-triazoles with substituents at both the 4- and 5-positions of the triazole ring were synthesized, and a total of 49 compounds, including previously reported 4- or 5-monosubstituted analogues, were examined for their ability to inhibit the specific binding of [(3)H]4'-ethynyl-4-n-propylbicycloorthobenzoate (EBOB), a non-competitive antagonist, to human homo-oligomeric beta3 and hetero-oligomeric alpha1beta2gamma2 gamma-aminobutyric acid (GABA) receptors. Among all tested compounds, the 4-n-propyl-5-chloromethyl analogue of 1-(2,6-dichloro-4-trifluoromethylphenyl)-1H-1,2,3-triazole showed the highest level of affinity for both beta3 and alpha1beta2gamma2 receptors, with K(i) values of 659pM and 266nM, respectively. Most of the tested compounds showed selectivity for beta3 over alpha1beta2gamma2 receptors. Among all 1-phenyl-1H-1,2,3-triazoles, the 4-n-propyl-5-ethyl analogue exhibited the highest (>1133-fold) selectivity, followed by the 4-n-propyl-5-methyl analogue of 1-(2,6-dibromo-4-trifluoromethylphenyl)-1H-1,2,3-triazole with a >671-fold selectivity. The 2,6-dichloro plus 4-trifluoromethyl substitution pattern on the benzene ring was found to be important for the high affinity for both beta3 and alpha1beta2gamma2 receptors. Comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) provided similar contour maps, revealing that an electronegative substituent at the 4-position of the benzene ring, a compact, hydrophobic substituent at the 4-position of the triazole ring, and a small, electronegative substituent at the 5-position of the triazole ring play significant roles for the high potency in beta3 receptors. Molecular docking studies suggested that the putative binding sites for 1-phenyl-1H-1,2,3-triazole antagonists are located in the channel-lining 2'-6' region of the second transmembrane segment of beta3 and alpha1beta2gamma2 receptors. A difference in the hydrophobic environment at the 2' position might underlie the selectivity of 1-phenyl-1H-1,2,3-triazoles for beta3 over alpha1beta2gamma2 receptors. The compounds that had high affinity for beta3 receptors with homology to insect GABA receptors showed insecticidal activity against houseflies with LD(50) values in the pmol/fly range. The information obtained in the present study should prove helpful for the discovery of selective insect control chemicals. 相似文献
13.
Cyclodextrins (CDs) possess hydrophobic surfaces, which probably shield the hydrophobic surfaces of denatured proteins and prevent the direct interactions between the surfaces which are believed to be responsible for protein aggregation during refolding process. This probability was evaluated by studying the refolding process of denatured alpha-amylase in the presence and absence of alpha-CD, as a dilution additive agent. Our data indicate that in the presence of 100 mM alpha-CD in the refolding buffer, the extent of aggregation reduces by almost 90%. Spectrofluorometric analysis of the refolding intermediate(s) also indicates that the tertiary structure of the refolded alpha-amylase, in the presence of alpha-CD, is very similar to the tertiary structure of the native protein. However, this similarity was distorted upon addition of exogenous hydrophobic (aliphatic or aromatic) amino acids to the refolding buffer, meaning that the hydrophobic interactions between alpha-CD and the denatured protein play significant role in preventing aggregate formation. In addition, by weakening the extent of these hydrophobic interactions by adding polarity-reducing agent (e.g. ethylene glycol) to the refolding buffer, more aggregates were formed. In contrast, strengthening these interactions by enhancing the ionic strength of the refolding buffer made these hydrophobic interactions very strong. Therefore, alpha-CD could not depart from the protein/alpha-CD complex, as it usually does during the process of refolding. As a result, more aggregates were formed in the presence of alpha-CD compared to the corresponding control samples. 相似文献
14.
15.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
16.
Mannose-containing Polysaccharides of the Apiculate Yeasts Nadsonia, Hanseniaspora, Kloeckera, and Saccharomycodes, and Their Use as an Aid in Classification 下载免费PDF全文
The mannose-containing polysaccharides formed by species of Nadsonia, Hanseniaspora, Kloeckera, and Saccharomycodes were extracted with hot aqueous alkali and purified by precipitation as their copper complexes. N. fulvescens and N. elongata formed galactomannans, while Hanseniaspora and Kloeckera species and S. ludwigii formed mannans. H. valbyensis, H. uvarum, and K. apiculata were a group which formed mannans which had identical H-1 regions in their proton magnetic resonance (PMR) spectra, and H. osmophila, K. africana, and K. magna mannas formed another group based on similar spectra. K. javanica formed a mannan with an H-1 spectral region which resembled that of the H. valbyensis group in some respects and that of the H. osmophila group in others. The H-1 portion of the PMR spectrum of S. lugwigii mannan was very complex and was unlike that of any other apiculate yeast studied. 相似文献
17.
Sy D Le Gravier Y Goodfellow J Vovelle F 《Journal of biomolecular structure & dynamics》2003,21(1):15-29
Plant ns-LTPs display an original structure with four helices and a flexible C-terminus, maintained together by four disulphide bridges and delineating an elongated central hydrophobic cavity. In order to relate these structural features to the protein stability and plasticity, combined molecular mechanics and simulated annealing calculations were undertaken on a wheat ns-LTP "mutant" with Cys-Ala replacement and with the application of core inter-residue restraints up to 2 A, reducing the cross-section size of the hydrophobic cavity. Analysis of the energy-minimized structures shows that removal of the disulphide bridges results in structures with a lower total energy and a smaller cavity volume. A 1-ns MD simulation at 300K in water, underlines that, despite the absence of a well-packed hydrophobic core, the native structure is extremely stable at room temperature and the cavity is not hydrated. This confirms that the disulphide bridges are essential for the existence of the cavity, whereas its plasticity depends both on the hydrophobic chain lining the cavity and on the C-terminal flexibility. A high temperature (500K) MD simulation confirms the stability of the secondary structure elements and the flexibility of the loops and of the C-terminal segment. Two important structural transitions during this simulation are discussed and possible routes for the insertion and release of hydrophobic ligands are suggested. 相似文献
18.
G N Callahan D Pardi M A Giedlin J P Allison D M Morizot W J Martin 《Journal of immunology (Baltimore, Md. : 1950)》1983,130(1):471-479
LT-85 is an alveolegenic adenocarcinoma induced in mutant C3HfB/HeN (C3Hf) mice. This tumor, however, grows preferentially in allogeneic, wild-type C3H/HeN (C3H) mice. The tumor-associated transplantation antigen has been mapped to the K end of the major histocompatibility complex. H-2K antigens were isolated from detergent extracts of LT-85 cells by immunoprecipitation with monoclonal antibody. The tryptic peptides of these antigens were compared, by using high-pressure liquid chromatography, with the tryptic peptides of H-2K antigens isolated from syngeneic mutant C3Hf and ancestral wild-type C3H spleen cells. We found that the H-2K antigens of the LT-85 tumor cells were very similar to, but distinct from, those present on syngeneic C3Hf lymphoid cells. We also found, however, that the H-2K antigens of LT-85 tumor cells were clearly different from the H-2K antigens of allogeneic C3H spleen cells. The H-2K antigens of LT-85 cells are therefore foreign to syngeneic C3Hf cells, but do not represent expression by the tumor cells of the allogeneic H-2K antigens expressed by normal C3H cells. Furthermore, the nature of the differences observed between the H-2K antigens of LT-85 cells and C3Hf and C3H spleen cells strongly suggests that the structure of the H-2K molecule of LT-85 cells is identical in some regions to the H-2K molecule of C3Hf cells, and in other regions to the H-2K molecule of C3H cells. 相似文献
19.
Flavanone 3beta-hydroxylases (F3H) are key enzymes in the synthesis of flavonol and anthocyanin. In this study, three F3H cDNAs from Oryza sativa (OsF3H-1 approximately 3) were cloned by RT-PCR and expressed in E. coli as gluthatione S-transferase (GST) fusion proteins. The purified recombinant OsF3Hs used flavanone, naringenin and eriodictyol as substrates. The reaction products with naringen and eriodictyol were determined by nuclear magnetic resonance spectroscopy to be dihydrokaempferol and taxifolin, respectively. OsF3H-1 had the highest enzymatic activity whereas the overall expression of OsF3H-2 was highest in all tissues except seeds. Flavanone 3beta-hydroxylase could be a useful target for flavonoid metabolic engineering in rice. 相似文献
20.
T J Norwood D A Crawford M E Steventon P C Driscoll I D Campbell 《Biochemistry》1992,31(27):6285-6290
Nuclear magnetic resonance (NMR) studies of the c subunit of F1F0 ATP synthase from Escherichia coli are presented. A combination of homonuclear (1H-1H) and heteronuclear (1H-15N) 2D and 3D methods was applied to the 79-residue protein, dissolved in trifluoroethanol. Resonance assignment for all the backbone amide groups and many C alpha H side-chain protons was achieved. Analysis of inter- and intraresidue 1H-1H nuclear Overhauser effect (NOE) data and scalar coupling constant information indicates that this protein contains two extended regions of predominant alpha-helical character (residues 10-40 and 48-77) separated by an eight-residue segment which displays little evidence of ordered secondary structure. This model is consistent with information about the molecular motion of the protein deduced from 15N-1H heteronuclear NOE data and observed pKa values of carboxylic acid groups. 相似文献