Mammalian cells are not killed by DNA single-strand breaks caused by hydroxyl radicals from hydrogen peroxide

Cell killing by ionizing radiation has been shown to be caused by hydroxyl free radicals formed by water radiolysis. We have previously suggested that the killing is not caused by individual OH free radicals but by the interaction of volumes of high radical density with DNA to cause locally multiply damaged sites (LMDS) (J. F. Ward, Radiat. Res. 86, 185-195, 1985). Here we test this hypothesis using hydrogen peroxide as an alternate source of OH radicals. The route to OH production from H2O2 is expected to cause singly damaged sites rather than LMDS. Chinese hamster V79-171 cells were treated with H2O2 at varying concentrations for varying times at 0 degree C. DNA damage produced intracellularly was measured by alkaline elution and quantitated in terms of Gray-equivalent damage by comparing the rate of its elution with that of DNA from gamma-irradiated cells. The yield of DNA damage produced increases with increasing concentration of H2O2 and with time of exposure. H2O2 is efficient in producing single-strand breaks; treatment with 50 microM for 30 min produces damage equivalent to that formed by 10 Gy of gamma irradiation. In the presence of a hydroxyl radical scavenger, dimethyl sulfoxide (DMSO), the yield of damage decreases with increasing DMSO concentration consistent with the scavenging of hydroxyl radicals traveling an average of 15 A prior to reacting with the DNA. In contrast to DNA damage production, cell killing by H2O2 treatment at 0 degree C is inefficient. Concentrations of 5 X 10(-2) M H2O2 for 10 min are required to produce significant cell killing; the DNA damage yield from this treatment can be calculated to be equivalent to 6000 Gy of gamma irradiation. The conclusion drawn is that individual DNA damage sites are ineffectual in killing cells. Mechanisms are suggested for killing at 0 degree C at high concentrations and for the efficient cell killing by H2O2 at 37 degrees C at much lower concentrations.     

Ferrous ion-induced strand breaks in the DNA plasmid pBR322 are not mediated by hydrogen peroxide

Ferrous ion-induced generation of single and multiple strand breaks in the DNA plasmid pBR322 induces the formation of two new plasmid forms with altered electrophoretic mobility. The yield of these plasmid forms, the circular relaxed and the linear forms, depended on the applied Fe²⁺ concentration. This property was independent of the presence of hydrogen peroxide in the incubation mixture indicating the lack of Fenton chemistry to explain the DNA degradation. The removal of dioxygen or the presence of superoxide dismutase diminished partially the yield of ferrous ion-induced DNA plasmid degradation, while catalase was without any effect. Autoxidation of divalent iron as followed by the formation of a coloured iron-phenanthroline complex was enhanced in a concentration-dependent manner by phosphate and bicarbonate and very efficiently using a mixture of 0.15 M NaCl, 1.2 mM phosphate, 23.8 mM bicarbonate, pH 7.4, that concentrations correspond closely to the intracellular values of buffer components. Thus, the formation of a yet unknown reactive species from Fe²⁺, and dioxygen, that is complexed to buffer components especially phosphate and its contribution in DNA plasmid degradation is more likely than the often cited formation of hydroxyl radicals in result of the Fenton reaction from Fe²⁺ and hydrogen peroxide. Dedicated to Prof. K. Arnold on the occasion of his 65th birthday.     

Induction and repair of DNA single-strand breaks in EM9 mutant CHO cells treated with hydrogen peroxide

In this study we investigated the induction and rejoining of DNA single-strand breaks (SSBs) produced by H2O2 in the repair-deficient EM9 mutant Chinese hamster ovary (CHO) cell line. The effect of the poly(ADP-ribose)-transferase inhibitor 3-aminobenzamide (3-ABA) on SSB-rejoining and on cell killing was also evaluated. Results were compared with those obtained previously with the parent cell line (AA8). Cells were treated with H2O2 on ice for 1 h, after which they were either harvested or allowed to repair their damage at 37 degrees C either in the presence or absence of 3-ABA (5 mM). The cells were then assayed either for survival using a colony-forming assay or for their level of DNA SSBs using alkaline elution. EM9 cells were somewhat more sensitive than AA8 cells to the cytotoxic effects of H2O2. However, because the repair mutant showed slightly lower levels of DNA SSBs than did its parental cell line, this sensitivity could not be explained on the basis of alterations in initial damage. The rejoining of the H2O2-induced DNA SSBs followed exponential kinetics in both cell lines; however, EM9 cells rejoined these breaks at a slower rate (t1/2 of 10 min) than did AA8 cells (t1/2 of 5 min). The increased sensitivity of the EM9 cells therefore appears to correlate with a reduced ability to remove these lesions from their DNA. As previously demonstrated for the AA8 cells, 3-ABA treatment resulted in both a retardation of the removal of H2O2-induced DNA SSBs and potentiation of cytotoxicity in the EM9 cells. However, the degree of these effects were similar for both AA8 and EM9 cells. These data provide further evidence that the cytotoxic effects of low concentrations of H2O2 are mediated by damage to DNA, and suggest that the rate at which DNA SSBs are rejoined is important for cell survival.     

Evidence that DNA fragmentation in apoptosis is initiated and propagated by single-strand breaks

Apoptosis is characterised by the degradation of DNA into a specific pattern of high and low molecular weight fragments seen on agarose gels as a distribution of sizes between 50-300 kb and sometimes, but not always, a ladder of smaller oligonucleosomal fragments. Using a 2D pulsed field-conventional agarose gel electrophoresis technique, where the second dimension is run under either normal or denaturing conditions, we show that single-strand breaks are introduced into DNA at the initial stages of fragmentation. Using single-strand specific nuclease probes we further show that the complete fragmentation pattern, including release of small oligonucleosomal fragments can also be generated by a single-strand endonuclease. Three classes of sites where single-strand breaks accumulate were identified. The initial breaks produce a distribution of fragment sizes (50 kb to >1 Mb) similar to those generated by Topoisomerase II inhibitors suggesting that cleavage may commence at sites of attachment of DNA to the nuclear matrix. A second class of rare sites is also cut further reducing the size distribution of the fragments to 50-300 kb. Thirdly, single-strand breaks accumulate at the linker region between nucleosomes eventually causing double-strand scissions which release oligonucleosomes. These observations further define the properties of the endonuclease responsible for DNA fragmentation in apoptosis.     

Matching of single-strand breaks to form double-strand breaks in DNA

Single-strand breaks (ssb) in opposite strands of DNA can be sufficiently near that a double-strand break (dsb) results. A theory is presented by which the maximum number h of base pairs which cannot prevent double-strand breakage can be determined from the rates of production of ssb and dsb. The assumptions required to derive the necessary equations as well as the range of validity of the equations are discussed in detail. In the experiments ssb and dsb were produced by x-irradiation in buffers which do not eliminate indirect effects and were measured by analytical ultracentrifugation. Values of h have been determined in low and high ionic strength and in low ionic strength over a range of temperatures. The values, 2.64 and 15.8, were obtained for high and low ionic strength, respectively.     

Effect of Ganoderma lucidum on human DNA is dose dependent and mediated by hydrogen peroxide

Ganoderma lucidum, an oriental fungus, is widely used for the promotion of health and longevity and is reported to have antioxidant and genoprotective properties. The aim of this study was to investigate the effect of G. lucidum on human lymphocytic DNA ex vivo using the comet assay, and to explore the mechanism of action and the effect of dose. Results showed that G. lucidum has a genoprotective effect at low concentration (0.0001% w/v), but damaged DNA at higher concentrations. The mechanism of damage appeared to be mediated by hydrogen peroxide, which was generated in vitro by G. lucidum, as the effect was ameliorated by the presence of catalase. At concentrations at which no damage was induced, G. lucidum appeared to confer protection against subsequent oxidant challenge to cells. The production of hydrogen peroxide by G. lucidum and its cytotoxic effects should be considered as a factor in future studies. However, the protective effect of G. lucidum at low concentration may explain, in part, some of the reported health benefits of this herb.     

Cigarette tar causes single-strand breaks in DNA

The results of this study demonstrate, for the first time, that cigarette tar causes DNA damage. Incubation in vitro of phage PM2 DNA with aqueous extracts of cigarette tar results in the introduction of DNA single-strand breaks. The effects of protective enzymes and radical scavengers indicate the involvement of active oxygen species. Although the semiquinone components of tar reduce dioxygen forming superoxide radicals and hydrogen peroxide, our results suggest that hydroxyl radicals formed via metal catalyzed decomposition of hydrogen peroxide are ultimately responsible for the DNA lesions. Our results also suggest that the metals in tar are reduced by the semiquinone components of tar and by superoxide at comparable rates.     

Production of DNA single-strand breaks in unstimulated splenocytes by dimethylnitrosamine

In an attempt to elucidate the mechanism whereby primary hepatocytes, but not liver S9 homogenates, generate immunosupprssive metabolites of dimethylnitrosamine (DMN), the production of DNA single-strand breaks (SSB) in unstimulated splenocytes was investigated with alkaline-elution analysis. Both hepatocytes and S9 homogenates induced SSB in cultured splenocytes by DMN - minimum detectable doses with the two metabolic activation systems (MAS) were 1 microM and 5 mM, respectively. DNA elution profiles were linear in splenocytes co-cultured with DMN and hepatocytes and convex in splenocytes incubated with DMN and S9 homogenates. Aminoacetonitrile (AAN; 10 mM), a DMN demethylase inhibitor, reversed SSB in splenocytes when incubated with either MAS. Addition of exogenous calf-thymus DNA to the hepatocyte co-culture medium did not affect the production of SSB. Rocking the hepatocyte-splenocyte cultures changed the elution profile from linear to convex. All of these treatments have been previously shown to block the immunosuppression by DMN in the hepatocyte co-culture system. These results indicate that the immunosuppression by DMN is not related to DNA damage, as measured by the production of SSB, and suggest that the metabolism of DMN to intermediates capable of producing genotoxicity and immunotoxicity may be qualitatively and/or quantitatively different.     

A reaction on the formation of hydrogen peroxide by microorganisms in solid media

Summary In this paper a special culture medium for the detection of H₂O₂ formed by bacteria producing acid from glucose and by certain moulds is discussed and the preparation of the same is described. This medium can be used with success instead of the blood benzidine medium and was found to be decidedly more sensitive in so far that it allows to trace very small quantities of H₂O₂. The mineral manganese peroxide as used in this medium differs in many respects from the precipitate obtained by mixing solutions of manganous sulfate and permanganate as used bySöhngen.Experiments with moulds have given indications as regards the production of a soluble glucose oxidase.     

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.     

Measurement of DNA single-strand breaks by alkaline elution and fluorometric DNA quantification

The method presented is based on the alkaline elution procedure for the determination of DNA single-stand (ss) breaks developed by Kohn and on the principles of DNA quantification after binding with the dye Hoechst 33258. In the present study, modification of the alkaline elution procedure with regard to the elution solution volume was performed. The influences of the DNA strandedness, the ethylenediaminetetraacetate/tetraethylammonium hydroxide denaturation and elution solution presence, the DNA solution pH, the dye amount, and the incubation time for the formation of the dye-ssDNA complex on the DNA fluorometric quantification were also studied. The modified DNA alkaline elution procedure followed by the optimized fluorometric determination of the ssDNA was applied on liver tissue from both untreated and treated (N-nitroso-N-methylurea- administered) Wistar rats. The criteria for the selection of the appropriate estimator and statistical analysis of the obtained results are also presented. The method of the DNA alkaline elution followed by fluorometric determination of ssDNA as modified and evaluated is an accurate and reliable approach for the determination of in vivo induced ssDNA strand breaks.     

Sodium selenide toxicity is mediated by O2-dependent DNA breaks

Hydrogen selenide is a recurrent metabolite of selenium compounds. However, few experiments studied the direct link between this toxic agent and cell death. To address this question, we first screened a systematic collection of Saccharomyces cerevisiae haploid knockout strains for sensitivity to sodium selenide, a donor for hydrogen selenide (H(2)Se/HSe(-/)Se(2-)). Among the genes whose deletion caused hypersensitivity, homologous recombination and DNA damage checkpoint genes were over-represented, suggesting that DNA double-strand breaks are a dominant cause of hydrogen selenide toxicity. Consistent with this hypothesis, treatment of S. cerevisiae cells with sodium selenide triggered G2/M checkpoint activation and induced in vivo chromosome fragmentation. In vitro, sodium selenide directly induced DNA phosphodiester-bond breaks via an O(2)-dependent reaction. The reaction was inhibited by mannitol, a hydroxyl radical quencher, but not by superoxide dismutase or catalase, strongly suggesting the involvement of hydroxyl radicals and ruling out participations of superoxide anions or hydrogen peroxide. The (?)OH signature could indeed be detected by electron spin resonance upon exposure of a solution of sodium selenide to O(2). Finally we showed that, in vivo, toxicity strictly depended on the presence of O(2). Therefore, by combining genome-wide and biochemical approaches, we demonstrated that, in yeast cells, hydrogen selenide induces toxic DNA breaks through an O(2)-dependent radical-based mechanism.     

Involvement of single-strand breaks in complex formation between single-stranded DNA and nucleoids of Bacillus subtilis

Molecular Genetics and Genomics - RNase-unfolded chromosomes of competent Bacillus subtilis are able to take up single-stranded homologous donor DNA fragments in vitro to form donor-recipient DNA...     

Involvement of single-strand breaks in complex formation between single-stranded DNA and nucleoids of Bacillus subtilis

Summary RNase-unfolded chromosomes of competent Bacillus subtilis are able to take up single-stranded homologous donor DNA fragments in vitro to form donor-recipient DNA complexes (Van Randen and Venema 1981). The unfolded chromosomes behave as supercoiled DNA molecules. X-irradiation increased the formation of unstable and stable complexes between donor and recipient DNA during incubation at 37° C. The complex-forming ability of the unfolded chromosomes increased linearly with increasing X-ray dose, even after complete relaxation of the unfolded chromosomes had occurred. Limited DNase I action increased the complex-forming ability of the chromosomes as effectively as X-irradiation.Unstable donor-recipient DNA complexes can be distinguished from stable ones by their dissociation upon density gradient centrifugation in CsCl at pH 11.2. They are stable at pH 10 (Van Randen et al. 1982a). At an intermediate pH value during isopycnic centrifugation, a fraction of the unstable complexes were stable, suggesting that a range of stabilities existed among the unstable complexes. The donor moiety of the stable donor-recipient DNA complexes was far more resistant to nuclease S1 treatment than that of the unstable ones.     

Influence of DNA conformation on radiation-induced single-strand breaks

It is usually assumed that sparsely ionizing radiation produces randomly distributed DNA breakages. This seems to be supported by the finding that in some DNA fragments single-strand scissions occur uniformly at all nucleotide sites, regardless of sequence. We performed experiments on two DNA fragments of about 300 by having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA.