Identification of a functional vitamin D response element in the human insulin-like growth factor binding protein-3 promoter

1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] plays a critical role in maintaining calcium and phosphate homeostasis and bone formation but also exhibits antiproliferative activity on many cancer cells, including prostate cancer. We have shown that the antiproliferative actions of 1,25-(OH)2D3 in the LNCaP human prostate cancer cell line are mediated in part by induction of IGF binding protein-3 (IGFBP-3). The purpose of this study was to determine the molecular mechanism involved in 1,25-(OH)2D3 regulation of IGFBP-3 expression and to identify the putative vitamin D response element (VDRE) in the IGFBP-3 promoter. We cloned approximately 6 kb of the IGFBP-3 promoter sequence and demonstrated its responsiveness to 1,25-(OH)2D3 in transactivation assays. Computer analysis identified a putative VDRE between -3296/-3282 containing the direct repeat motif GGTTCA ccg GGTGCA that is 92% identical with the rat 24-hydroxylase distal VDRE. In EMSAs, the vitamin D receptor (VDR) showed strong binding to the putative IGFBP-3 VDRE in the presence of 1,25-(OH)2D3. Supershift assays confirmed the presence of VDR in the IGFBP-3 VDRE complex. Chromatin immunoprecipitation assay demonstrated that 1,25-(OH)2D3 recruited the VDR/retinoid X receptor heterodimer to the VDRE site in the natural IGFBP-3 promoter in intact cells. In transactivation assays, the putative VDRE coupled to a heterologous simian virus 40 promoter construct was induced 2-fold by 1,25-(OH)2D3. Mutations in the VDRE resulted in a loss of inducibility confirming the critical hexameric sequence. In conclusion, we have identified a functional VDRE in the distal region of the human IGFBP-3 promoter. The induction of IGFBP-3 by 1,25-(OH)2D3 appears to be directly mediated via VDR interaction with this VDRE.     

Molecular mechanism underlying 1,25-dihydroxyvitamin D regulation of nephrin gene expression

Nephrin plays a key role in maintaining the structure of the slit diaphragm in the glomerular filtration barrier. Our previous studies have demonstrated potent renoprotective activity for 1,25-dihydroxyvitamin D (1,25(OH)(2)D(3)). Here we showed that in podocytes 1,25(OH)(2)D(3) markedly stimulated nephrin mRNA and protein expression. ChIP scan of the 6-kb 5' upstream region of the mouse nephrin gene identified several putative vitamin D response elements (VDREs), and EMSA confirmed that the VDRE at -312 (a DR4-type VDRE) could be bound by vitamin D receptor (VDR)/retinoid X receptor. Luciferase reporter assays of the proximal nephrin promoter fragment (-427 to +173) showed strong induction of luciferase activity upon 1,25(OH)(2)D(3) treatment, and the induction was abolished by mutations within -312VDRE. ChIP assays showed that, upon 1,25(OH)(2)D(3) activation, VDR bound to this VDRE leading to recruitment of DRIP205 and RNA polymerase II and histone 4 acetylation. Treatment of mice with a vitamin D analog induced nephrin mRNA and protein in the kidney, accompanied by increased VDR binding to the -312VDRE and histone 4 acetylation. 1,25(OH)(2)D(3) reversed high glucose-induced nephrin reduction in podocytes, and vitamin D analogs prevented nephrin decline in both type 1 and 2 diabetic mice. Together these data demonstrate that 1,25(OH)(2)D(3) stimulates nephrin expression in podocytes by acting on a VDRE in the proximal nephrin promoter. Nephrin up-regulation likely accounts for part of the renoprotective activity of vitamin D.     

Direct regulation of HOXA10 by 1,25-(OH)2D3 in human myelomonocytic cells and human endometrial stromal cells

Vitamin D receptor (VDR) and the functionally active form of its ligand, 1,25-(OH)2D3, have been implicated in female reproduction function and myeloid leukemic cell differentiation. HOXA10 is necessary for embryo implantation and fertility, as well as hematopoeitic development. In this study, we identified a direct role of vitamin D in the regulation of HOXA10 in primary human endometrial stromal cells, the human endometrial stromal cell line (HESC), and in the human myelomonocytic cell line, U937. Treatment of primary endometrial stromal cells, or the cell lines HESC and U937 with 1,25-(OH)2D3 increased HOXA10 mRNA and protein expression. VDR mRNA and protein were detected in primary uterine stromal cells as well as HESC and U937 cells. We cloned the HOXA10 upstream regulatory sequence and two putative vitamin D response elements (VDRE) into luciferase reporter constructs and transfected primary stromal cells and HESC. One putative VDRE (P1: -385 to -434 bp upstream of HOXA10) drove reporter gene expression in response to treatment with 1,25-(OH)2D3. In EMSA, VDR demonstrated binding to the HOXA10 VDRE in the presence of 1,25-(OH)2D3. 1,25-(OH)2D3 up-regulates HOXA10 expression by binding VDR and interacting with a VDRE in the HOXA10 regulatory region. Direct regulation of HOXA10 by vitamin D has implications for fertility and myeloid differentiation.     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.     

Analysis of the 5-lipoxygenase promoter and characterization of a vitamin D receptor binding site

1,25-Dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and transforming growth factor beta (TGFbeta) potently induce 5-lipoxygenase (5-LO) in myeloid cells. We analyzed vitamin D receptor (VDR) binding to putative vitamin D response elements within the 5-LO promoter and analyzed its function by reporter gene analysis. Binding of VDR and retinoid X receptor to the promoter region was shown in DNase I footprinting, electrophoretic mobility shift and chromatin immunoprecipitation assays. However, the identified VDR binding region did not mediate induction of reporter gene activity by 1,25(OH)(2)D(3)/TGFbeta, neither in the 5-LO promoter context nor with the thymidine kinase (tk) promoter. Insertion of the rat atrial natriuretic factor VDRE in reporter plasmids containing the 5-LO promoter diminished induction by 1,25(OH)(2)D(3)/TGFbeta as compared with the tk promoter. Similarly, low inductions were obtained when cells were transiently or stably transfected with constructs containing various 5-LO promoter regions. Concerning basal promoter activity, we identified a positive regulatory region (-779 to -229), which includes the VDR binding region, in 5-LO-positive MonoMac6 cells. In summary, the VDR/RXR complex binds to putative VDREs in the 5-LO promoter, but other sequences outside the 5-LO promoter seem to be responsible or additionally required for the prominent induction of 5-LO mRNA expression by 1,25(OH)(2)D(3) and TGFbeta.     

The Orosomucoid 1 protein is involved in the vitamin D – mediated macrophage de-activation process

Orosomucoid 1 (ORM1), also named Alpha 1 acid glycoprotein A (AGP-A), is an abundant plasma protein characterized by anti-inflammatory and immune-modulating properties. The present study was designed to identify a possible correlation between ORM1 and Vitamin D3 (1,25(OH)2D3), a hormone exerting a widespread effect on cell proliferation, differentiation and regulation of the immune system. In particular, the data described here indicated that ORM1 is a 1,25(OH)2D3 primary response gene, characterized by the presence of a VDRE element inside the 1 kb sequence of its proximal promoter region. This finding was demonstrated with gene expression studies, Chromatin Immunoprecipitation and luciferase transactivation experiments and confirmed by VDR full length and dominant negative over-expression. In addition, several experiments carried out in human normal monocytes demonstrated that the 1,25(OH)2D3 – VDR – ORM1 pathway plays a functional role inside the macrophage de-activation process and that ORM1 may be considered as a signaling molecule involved in the maintenance of tissue homeostasis and remodeling.